Literature DB >> 25300306

Molecular evidence for natural hybridization between wild loquat (Eriobotrya japonica) and its relative E. prinoides.

Qiang Fan, Sufang Chen, Mingwan Li, Wei Guo, Huijuan Jing, Wei Wu, Renchao Zhou1, Wenbo Liao.   

Abstract

BACKGROUND: Interspecific hybridization has long been recognized as a pivotal process in plant evolution and speciation. It occurs fairly common in the genera of the subtribe Pyrinae. In Eriobotrya, a small tree genus of Pyrinae, E. prinoides var. daduheensis has been recognized as either a variety of E. prinoides, a natural hybrid between E. prinoides and E. japonica, or a variety of E. japonica. However, to date, there has been no convincing evidence on its status.
RESULTS: Four nuclear genes and two chloroplast regions were sequenced in 89 individuals of these three Eriobotrya taxa from two locations where they coexist. A few fixed nucleotide substitutions or gaps were found in each of the investigated nuclear and chloroplast loci between E. japonica and E. prinoides. Of the 35 individuals of E. prinoides var. daduheensis, 33 showed nucleotide additivity of E. japonica and E. prinoides in at least one nuclear gene, and 10 of them harboured nucleotide additivity at all the four nuclear genes. Most haplotypes of E. prinoides var. daduheensis were also shared with those of E. japonica and E. prinoides. In the two chloroplast regions, 28 and 7 individuals were identical with E. japonica and E. prinoides, respectively.
CONCLUSIONS: Our study provides compelling evidence for a hybrid status for E. prinoides var. daduheensis. Most hybrid individuals are later-generation hybrids. Both E. japonica and E. prinoides can serve as female parent. Differential adaptation might maintain the species boundary of E. prinoides and E. japonica in the face of hybridization and potential introgression.

Entities:  

Mesh:

Year:  2014        PMID: 25300306      PMCID: PMC4196008          DOI: 10.1186/s12870-014-0275-6

Source DB:  PubMed          Journal:  BMC Plant Biol        ISSN: 1471-2229            Impact factor:   4.215


Background

Interspecific hybridization has long been recognized as a pivotal process in plant evolution and speciation [1-3]. The understanding of the process of natural hybridization could not only help to clarify taxonomic uncertainty, but also contribute to illuminate the origin of many adaptations, the maintenance of plant diversity and the process of speciation [2]. Natural hybridization occurs fairly commonly among and within genera of the subtribe Pyrinae (formerly the Maloideae, Rosaceae), which contains many economically important fruits, such as apple, pawpaw, pear and loquat [4]. Intergeneric hybridization has been observed in 16 genera of Pyrinae [5], while intrageneric hybridization is expected to be even more frequent and has been found in many genera of Pyrinae, including Amelanchier [6], Crataegus [7-9], and Sorbus [10,11]. The prevalence of natural hybridization among and within the genera of Pyrinae indicates that hybridization may play important roles in the evolution of Pyrinae [4], and provides enormous opportunities to breed new cultivars of fruits. The genus Eriobotrya Lindl., a small genus of Pyrinae consisting of approximately 26 species, is distributed in Himalaya, eastern Asia and western Malesia [12]. Eriobotrya japonica (Thunb.) Lindl., commonly known as loquat, is an important fruit tree cultivated throughout Southeastern Asia [13,14], while wild loquat is only distributed in Yunnan, Sichuan, Hubei, Guangxi and Guangdong of China [15]. Of the 21 Eriobotrya species found in China, there are three Eriobotrya species flowering in autumn except for loquat, including E. prinoides, E. prinoides var. daduheensis and E. malipoensis: E. prinoides Rehd. et Wils. occurs naturally in Sichuan and Yunnan, E. prinoides var. daduheensis H. Z. Zhang is distributed in two counties of Sichuan, Hanyuan and Shimian, while E. malipoensis occurs only in Malipo, Yunnan [15]. E. prinoides var. daduheensis has many intermediate morphological characteristics of E. japonica and E. prinoides as well as a unique pollen shape and peroxidase isozyme pattern [16]. It was later considered to be an interspecific hybrid between E. japonica and E. prinoides based on karyotype and peroxidase isozyme data [17]. In that study, all three taxa were reported as diploids with identical chromosomes (2n = 2x = 34). Additionally, the karyotype of E. prinoides var. daduheensis was either the 3A type (identical with E. japonica) or the 2A type (identical with E. prinoides), and E. prinoides var. daduheensis displayed some additivity in the peroxidase allozyme between E. japonica and E. prinoides. Further karyotype analysis by Liang et al. obtained different results in which all three taxa were the 2A type. Thus, they reconsidered E. prinoides var. daduheensis as a distinct variety of E. japonica [18]. These controversial results were based mostly on conventional approaches such as morphological analysis, karyotype and allozyme assay, which are far enough to provide convincing conclusions for many species showing a high degree of morphological plasticity or intermediate morphological characters arising from forces other than hybridization [19]. For most species in the subtribe Pyrinae, the frequent occurrence of polyploidization, apomixis and hybridization makes identification of hybridization events even more difficult based on these conventional approaches. Recently, single or low-copy nuclear genes have been used successfully for identifying hybridization in plants [19-21]. The completion of the apple genome sequence provides ample ESTs for the development of exon-primed and intron-crossing (EPIC) primers to detect DNA sequence variations in the members of the subtribe Pyrinae [22-24]. In this study, more than 20 individuals of each of the three taxa (E. prinoides var. daduheensis, E. japonica and E. prinoides) were sampled from two locations (Hanyuan and Shimian), and four low-copy nuclear genes and two chloroplast DNA fragments were sequenced to address the following two questions: 1) Is E. prinoides var. daduheensis an interspecific hybrid? 2) If so, what is the extent of hybridization? Are these hybrid individuals F1s or later generation hybrids, or both? Through these efforts, we further discussed factors that may contribute to the occurrence of hybridization, the effect of hybridization on their parent species, and the possible mechanism of species integrity in the face of gene flow.

Results

At these four nuclear genes and two chloroplast regions, E. japonica and E. prinoides showed fixed nucleotide substitutions. There were two fixed nucleotide substitutions at TPP2, five nucleotide substitutions and one 1-bp indel at GDSL1, four nucleotide substitutions at GDSL2, three nucleotide substitutions and one 90-bp indel at WD, and three nucleotide substitutions in the rbcL + psbB region (Table 1; Figure 1).
Table 1

Fixed nucleotide substitutions and gaps between and in the four nuclear genes (TPP2, GDSL1, GDSL2 and WD) and the two chloroplast genes ( B and rbcL)

Gene GDSL1 GDSL2
Site21229243292293595216238264562
E. japonica AAGG-ATCCA
E. prinoides GCTAATGGGT
GeneTPP2WD psbBrbcL
Site3611735270–35936550591101154
E. japonica CCT-GAGCT
E. prinoides TTGACA…CTAAG
Figure 1

Haplotype networks of the six investigated genes for , , and their putative hybrid. Mutational steps are shown by the length of the connecting lines, indels with more than one nucleotide were considered as one mutation, and node size is proportional to the number of haplotypes possessed by all the investigated individuals.

Fixed nucleotide substitutions and gaps between and in the four nuclear genes (TPP2, GDSL1, GDSL2 and WD) and the two chloroplast genes ( B and rbcL) Haplotype networks of the six investigated genes for , , and their putative hybrid. Mutational steps are shown by the length of the connecting lines, indels with more than one nucleotide were considered as one mutation, and node size is proportional to the number of haplotypes possessed by all the investigated individuals. We next focused on the sites that exhibited fixed differences between E. japonica and E. prinoides for sequence analysis in E. prinoides var. daduheensis. For convenience, we designated the sequence type for each individual of E. prinoides var. daduheensis as H, J and P types if its sequence chromatogram was additive of E. japonica and E. prinoides, identical with E. japonica, and identical with E. prinoides, respectively. Of the 35 individuals of E. prinoides var. daduheensis, 33 showed nucleotide additivity of E. japonica and E. prinoides (H type) in at least at one nuclear gene (Table 2).
Table 2

Sequence type of the six investigated genes in each putative hybrid

ID b Location TPP2 GDSL1 GDSL2 WD psb B + rbcL
D1HanyuanHPHHJ
D2HanyuanHHHHJ
D3HanyuanHHHHP
D4HanyuanJPHHJ
D5HanyuanJHHHJ
D6HanyuanHHHHJ
D7HanyuanHHHHJ
D8HanyuanJPHPJ
D9HanyuanPPHHP
D10HanyuanPHJHP
D11HanyuanHHHHP
D12HanyuanHPHHP
D13SimianHPHHJ
D14SimianHPHPJ
D15SimianHHHHJ
D15SimianHHHHJ
D17SimianHPHHJ
D18SimianHPHHJ
D19SimianHPHHJ
D20SimianHHHHJ
D21SimianHHHHJ
DP1HanyuanHPHPJ
DP2HanyuanPPHPP
DP3HanyuanHHHHP
DP4SimianPPHHJ
DP5SimianHPPPJ
DP6SimianPPPPJ
DP7SimianHPPPJ
DP8SimianPJJPJ
DP9SimianPPHPJ
DJ1SimianHPHHJ
DJ2SimianHJHJJ
DJ3SimianPHHHJ
DJ4SimianHHPHJ
DJ5SimianHPHHJ

aAccording to fixed nucleotide substitutions between E. japonica and E. prinoides, sequences are same with those of E. japonica are defined as type “J”, sequences are same with those of E. prinoides are defined as type “P”, and sequences are the nucleotide additivity of both are defined as type “H”.

bD1-21: individual identified as typical E. prinoides var. daduheensis; DP1-9: individual with characters between E. prinoides var. daduheensis and E. prinoides; DJ1-5: individual with characters between E. prinoides var. daduheensis and E. japonica.

Sequence type of the six investigated genes in each putative hybrid aAccording to fixed nucleotide substitutions between E. japonica and E. prinoides, sequences are same with those of E. japonica are defined as type “J”, sequences are same with those of E. prinoides are defined as type “P”, and sequences are the nucleotide additivity of both are defined as type “H”. bD1-21: individual identified as typical E. prinoides var. daduheensis; DP1-9: individual with characters between E. prinoides var. daduheensis and E. prinoides; DJ1-5: individual with characters between E. prinoides var. daduheensis and E. japonica. Among the 35 individuals of E. prinoides var. daduheensis, ten individuals were observed with H type at all four nuclear genes and 23 individuals harbored H type in at least one nuclear gene (Table 2). For the remaining two individuals, one (DP6) was P type at all four nuclear genes, and the other (DP8) was either P type or J type at the four nuclear genes. Nine of the 21 individuals with typical E. prinoides var. daduheensis characteristics (D1-D21) were observed with a H type at all four nuclear genes, while only one individual exhibited a H type at all four nuclear genes for those atypical individuals of E. prinoides var. daduheensis (DP1-DP9 and DJ1-DJ5: morphologically intermediate between E. prinoides var. daduheensis and either E. prinoides or E. japonica). At these nuclear genes, only two of these atypical individuals had a J type in two nuclear genes (Table 2). At the two chloroplast regions, J and P types were observed in 28 and 7 individuals of E. prinoides var. daduheensis, respectively. Although DP6 was observed with P type at all four nuclear genes, it exhibited a J type at the chloroplast regions. Of the 10 individuals detected with a H type at all four nuclear genes, J and P types were observed in 7 and 3 individuals, respectively (Table 2). For the haplotype analysis, E. japonica harbored a higher level of diversity than E. prinoides at the genes TPP2, GDSL1 and GDSL2 (2, 6 and 4 haplotypes, respectively in E. japonica, and 1, 2 and 1 haplotypes, respectively in E. prinoides). This situation is reversed at the gene WD, where E. japonica had only one haplotype and E. prinoides had three. At the chloroplast regions, no within-species variation was observed. None of these haplotypes were shared by E. japonica and E. prinoides at all four nuclear genes and two chloroplast regions. For E. prinoides var. daduheensis, most haplotypes (18/25) were the same as those of E. japonica or E. prinoides (Figure 1). There were also seven haplotypes unique to E. prinoides var. daduheensis and only one mutational step existed between the six of them and the haplotypes of E. japonica or E. prinoides.

Discussion

Molecular evidence for the hybrid origin of E. prinoides var. daduheensis

The taxonomic status of E. prinoides var. daduheensis has been controversial. It was recognized as either a variety of E. prinoides [16], a natural hybrid between E. prinoides and E. japonica [17], or a variety of E. japonica [18]. However, due to very limited sampling, there has been no convincing conclusion regarding its status. In this study, we aimed to characterize its status by sequencing four nuclear genes and two chloroplast regions for sufficient samples of the three taxa of Eriobotrya in two locations. Our results showed that there were a few fixed nucleotide substitutions between E. japonica and E. prinoides in all four nuclear genes and two chloroplast regions, indicating that the two species are well separated. Most individuals of E. prinoides var. daduheensis (33 of 35) showed nucleotide additivity of E. japonica and E. prinoides in at least one nuclear gene, providing direct evidence that they are hybrids between E. japonica and E. prinoides. The remaining two individuals, DP6 and DP8, are also hybrids because DP6 is P type at all four nuclear genes and J type at the chloroplast regions and DP8 is P type at two nuclear genes and J type at the two other nuclear genes. In the ten individuals of E. prinoides var. daduheensis, nucleotide additivity of E. japonica and E. prinoides was observed at all of the four randomly selected nuclear genes, suggesting that they might be F1 hybrids. Other individuals of E. prinoides var. daduheensis must be later-generation hybrids. Of the 10 putative F1 hybrids, J and P types were observed in 7 and 3 individuals, respectively, at the two chloroplast loci, indicating that both species could serve as female parent. In this study, seven haplotypes from 3 nuclear genes were unique to E. prinoides var. daduheensis (Figure 1). These may be due to unsampled polymorphisms from the parental species, or new mutations in the hybrids. Molecular analyses show that 9 of 21 individuals of typical E. prinoides var. daduheensis are likely F1 hybrids, while there is only one out of 14 individuals of atypical E. prinoides var. daduheensis. These results suggest that typical E. prinoides var. daduheensis contains many F1 hybrids, whereas most atypical E. prinoides var. daduheensis are later-generation hybrids. The four nuclear genes developed from apple, which is a Pyrinae species distantly related to Eriobotrya, were also successfully applied in Eriobotrya and Rhaphiolepis in this study, and other genera of Pyrinae, such as Cotoneaster and Sorbus (Chen et al. unpublished data). This indicates that the four nuclear genes can be widely applied as universal nuclear markers for hybrid identification and phylogenetic analyses in species of Pyrinae.

Factors contributing to the natural hybridization between E. japonica and E. prinoides

The geographic distribution, flower morphology, and blooming periods of E. japonica and E. prinoides may provide ample opportunities for hybridization between these species. The two species are found in Simian and Hanyuan, Sichuan, China [15] and are partially sympatric in habitat; however, E. japonica prefers higher elevations and E. prinoides prefers lower elevations. The flowering periods of E. japonica and E. prinoides also overlap: both species flowers from October to February [16]. During our field investigations in December, 2007, we found that E. japonica, E. prinoides and E. prinoides var. daduheensis were blooming at the same time. The overall flower morphology of the two species is quite similar, except for the size of inflorescence and the number of style [16], and bees in the autumn and passerine birds in the winter are shared pollinators for them [25]. In short, E. japonica and E. prinoides have ample opportunities to hybridize with each other naturally in places where they occur together.

Consequences of hybridization between loquat and E. prinoides

In this study, 25 of the 35 investigated individuals were confirmed to be later-generation hybrids, suggesting that F1 hybrids can backcross with parental species and introgression may take place. During our field investigations, hundreds of E. prinoides var. daduheensis individuals were found, so the potential for introgression is great. Although no signals of introgression were observed in the sampled individuals of either E. japonica or E. prinoides, the possibility cannot be excluded because only four nuclear genes and chloroplast DNA were analyzed. E. japonica and E. prinoides occupy differential altitude range with slight overlap. Differential adaptation might maintain species integrity of E. japonica and E. prinoides in the presence of hybridization and potential introgression. Introgressive hybridization between E. japonica and E. prinoides may help to increase the genetic diversity of their wild populations, which might be advantageous for their long-term survival in the context of rapid global climate changes. Meanwhile, local people can use natural hybrid individuals to select new cultivars of loquat. Wild individuals of the two Eriobotrya species are widely used as rootstock to graft loquat cultivars, so many wild populations have been destroyed (Fan et al. personal observation). The current status of these Eriobotrya species calls for effective conservation.

Conclusions

Based on sequence data of four low-copy nuclear genes and two chloroplast regions, we provided convincing evidence for the hybrid origin of E. prinoides var. daduheensis, and found that most hybrid individuals could be later generation hybrids. Our study demonstrated a successful application of low-copy nuclear genes in the identification of hybrids in the subtribe Pyrinae, and primers developed in this study could be applied in other genera of Pyrinae.

Methods

Plant sampling

In December 2007 (when the three Eriobotrya taxa were blooming) and in April 2008 (when the fruits of these Eriobotrya taxa were ripening), we conducted field surveys of the three Eriobotrya taxa in Hanyuan and Simian, Sichuan, China. Based on their morphological characteristics [13,16,26] and our own observations, seven diagnostic morphological characteristics were used to identify E. japonica, E. prinoides and E. prinoides var. daduheensis (Table 3). At both sampling sites, only E. prinoides can be found at an elevation below 800 m, whereas only E. japonica can be found at elevations above 1200 m. At an elevation between 800–1200 m, all three taxa can be found. In addition, some individuals exhibit an intermediate morphology of E. prinoides var. daduheensis and either E. japonica or E. prinoides (We provisionally treated them as E. prinoides var. daduheensis). In this study, we sampled 28 individuals of E. prinoides below 800 m, 26 individuals of E. japonica above 1200 m, and 35 individuals of E. prinoides var. daduheensis between 800 and 1200 m (including 21 individuals of typical E. prinoides var. daduheensis, 5 individuals with an intermediate morphology of E. japonica and E. prinoides var. daduheensis, and 9 individuals with an intermediate morphology of E. prinoides and E. prinoides var. daduheensis). In addition, one congeneric species (E. tengyuehensis) and one species of a closely related genus, Rhaphiolepis indica, were sampled and used as outgroups (Table 4). For the psbB gene, a sequence from Neillia thibetica (Rosaceae) was downloaded from NCBI website and set as outgroup (Accession number: JF317470). All of the leaves for DNA extraction were collected and stored in silica gel in zip-lock plastic bags until use. Voucher specimens were deposited in the Herbarium of Sun Yat-sen University (SYS).
Table 3

Morphological characters of , and typical var.

Character E. japonica E. prinoides E. prinoides var. daduheensis
Leaf marginSerrateUndulateSerrate
Upper surface of leafRugoseSmoothSmooth
Leaf size (cm)12–30 × 5–107–15 × 3.5–7.510–24 × 4.5–9
Petiole length (cm)0.2–0.81.5–31–2.5
Stipule shapeSubulateOvateSubulate
Inflorescence length (cm)10–20.56–108–12
Number of styles52, rarely 33–4
Table 4

Sample locations of , , var. and outgroups used in this study

E. japoncina (J), E. prinoides (P), and E. prinoides var. Daduheensis (H)
J P H
Shimian County, Sichuan, China29°14′N, 102°19′E131320
Hanyuan County, Sichuan, China29°17′N, 102°39′E131515
Other species used as outgroup
Gongshan, Yunnan, China27°43′N, 98°40′E E. tengyueensis
Guangzhou, Guangdong, China23°6′N, 113°18′E Rhaphiolepis indica
Morphological characters of , and typical var. Sample locations of , , var. and outgroups used in this study

DNA extraction, primer design, PCR and sequencing

Genomic DNA was isolated using the CTAB method [27]. Based on them, specific EPIC primers were designed using Primer Premier 6.0 (PREMIER Biosoft International, Palo Alto, CA, USA). These cDNAs encode tripeptidyl peptidase II (TPP2), GDSL esterase/lipase APG-like proteins (GDSL), and WD repeat-containing protein (WD). One bright band was amplified for the TPP2 and WD primers, and two bright bands were amplified using the GDSL primers (we designated them as GDSL1 and GDSL2). The chloroplast rbcL region was amplified using universal primers [28], while a partial psbB region was amplified using specific primers based on the sequences of some individuals of Eriobotrya, which were obtained from the universal primers psbB1-F and psbB2-R [29]. All of the primer sequences are listed in Table 5.
Table 5

Primers of the four nuclear genes designed from a coding sequence database of ×

Locus Primer sequences (5′-3′) The aligned length (bp) ID for apple coding sequence
TPP2F: GCTGGTTTTGTTCATCGA389MDP0000193152
R: ACCGCTCAGAAACAGGCT
GDSL1F: GTCTTCCAAGGCTTCGTT661MDP0000137339
R: ACAATTCCCGTTCCACAG
GDSL2F: identical with GDSL1591identical with GDSL1
R: identical with GDSL1
WDF: GTTCCTCTATCATCACCAGTT736MDP0000283138
R: ACCAGTGCCAAGTCTATTC
rbcL724F: GCTACTGCAGGTACATG754
1352R: CTTCACAAGCAGCAGCTAGTTC
psbBF:AACGAGTGGGACCAAATA317
R:TTTCTATTCAGGGGTGGC
Primers of the four nuclear genes designed from a coding sequence database of × PCR amplifications were performed in 20 μL reaction volumes, containing 25 ng of genomic DNA, 2 μL of 10 × buffer (with Mg2+), 0.25 mM of dNTPs, 0.2 μM of each primer, and 1 U of Easy-Taq DNA polymerase (TransGen Biotech Co., Ltd, Beijing, China). The PCR reactions were conducted with the following conditions: initial denaturing at 94°C for 2.5 min, followed by 35 cycles of 94°C for 30 s, a corresponding annealing temperature (50°C for TPP2, WD, and rbcL, and 55°C for GDSL and psbB) for 30 s, 72°C for 1 min, and a final extension at 72°C for 5 min. The PCR products were purified by electrophoresis with a 1.2% agarose gel followed by the use of a Pearl Gel Extraction Kit (Pearl Biotech, Guangzhou, China). Following purification, they were sequenced on an ABI 3730 DNA automated sequencer with the BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems, Foster City, CA). All sequences were deposited in GenBank under accession numbers KF699531-KF699842, KJ735102-KJ735383, and KM246943-KM246944.

Sequences analysis

The sequences were assembled and edited with SeqMan™ II (DNASTAR, Inc., Madison, WI), and then subjected to a BLASTN search against the genome sequence of apple (http://www.rosaceae.org/species/malus/malus_x_domestica/genome_v1.0) to determine their possible copy number in the genome, setting an E-value cut-off of 1e-6 and a minimum score of 100 bits. The results showed that no more than three hits were obtained for each of the four investigated genes, indicating that they are low-copy ones in the genome. For each of the four nuclear genes, we also designed 2–3 pairs of primers anchoring different locations (data not shown). Sequencing for their PCR products produced identical sequences at the target regions, supporting that they are very likely orthologous in Eriobotrya. Polymorphisms at variable sites were identified as superimposed nucleotide additivity patterns from chromatograms of direct sequencing [30], and indels were identified by reading the sequence chromatogram from both sides. The haplotype inference of the four nuclear genes was implemented with PHASE v2.1 [31,32]. The haplotype network was constructed for each gene using Network 4.6.1.2 (www.fluxus-engineering.com) with the median-joining algorithm [33].
  16 in total

1.  Median-joining networks for inferring intraspecific phylogenies.

Authors:  H J Bandelt; P Forster; A Röhl
Journal:  Mol Biol Evol       Date:  1999-01       Impact factor: 16.240

Review 2.  Genome-enabled development of DNA markers for ecology, evolution and conservation.

Authors:  Robert C Thomson; Ian J Wang; Jarrett R Johnson
Journal:  Mol Ecol       Date:  2010-05-10       Impact factor: 6.185

3.  Hybridization and polyploidy as drivers of continuing evolution and speciation in Sorbus.

Authors:  Ashley Robertson; Timothy C G Rich; Alexandra M Allen; Libby Houston; Cat Roberts; Jon R Bridle; Stephen A Harris; Simon J Hiscock
Journal:  Mol Ecol       Date:  2010-03-12       Impact factor: 6.185

4.  Population genetics of speciation in nonmodel organisms: I. Ancestral polymorphism in mangroves.

Authors:  Renchao Zhou; Kai Zeng; Wei Wu; Xiaoshu Chen; Ziheng Yang; Suhua Shi; Chung-I Wu
Journal:  Mol Biol Evol       Date:  2007-09-28       Impact factor: 16.240

Review 5.  The role of hybridization in plant speciation.

Authors:  Pamela S Soltis; Douglas E Soltis
Journal:  Annu Rev Plant Biol       Date:  2009       Impact factor: 26.379

Review 6.  Hybrid speciation in plants: new insights from molecular studies.

Authors:  Matthew J Hegarty; Simon J Hiscock
Journal:  New Phytol       Date:  2005-02       Impact factor: 10.151

7.  Asymmetric hybridization in Rhododendron agastum: a hybrid taxon comprising mainly F1s in Yunnan, China.

Authors:  Hong-Guang Zha; Richard I Milne; Hang Sun
Journal:  Ann Bot       Date:  2010-01       Impact factor: 4.357

8.  Molecular evidence for natural intergeneric hybridization between Liquidambar and Altingia.

Authors:  Wei Wu; Renchao Zhou; Yelin Huang; David E Boufford; Suhua Shi
Journal:  J Plant Res       Date:  2009-11-26       Impact factor: 2.629

9.  A database of PCR primers for the chloroplast genomes of higher plants.

Authors:  Berthold Heinze
Journal:  Plant Methods       Date:  2007-02-27       Impact factor: 4.993

10.  Molecular evidence for natural hybridization in the mangrove fern genus Acrostichum.

Authors:  Rongshu Zhang; Ting Liu; Wei Wu; Yunqin Li; Lifang Chao; Lishi Huang; Yelin Huang; Suhua Shi; Renchao Zhou
Journal:  BMC Plant Biol       Date:  2013-05-01       Impact factor: 4.215

View more
  3 in total

1.  Molecular evidence for asymmetric hybridization in three closely related sympatric species.

Authors:  Ning-Ning Zhang; Jiao-Jun Yu; Yue-Hua Wang; Xun Gong
Journal:  AoB Plants       Date:  2018-02-09       Impact factor: 3.276

2.  Molecular Evidence for Natural Hybridization between Cotoneaster dielsianus and C. glaucophyllus.

Authors:  Mingwan Li; Sufang Chen; Renchao Zhou; Qiang Fan; Feifei Li; Wenbo Liao
Journal:  Front Plant Sci       Date:  2017-05-09       Impact factor: 5.753

3.  Molecular evidence for natural hybridization between Rumex crispus and R. obtusifolius (Polygonaceae) in Korea.

Authors:  Gauri Shankar Bhandari; Chong-Wook Park
Journal:  Sci Rep       Date:  2022-03-31       Impact factor: 4.379

  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.