Molecular evidence for asymmetric hybridization in three closely related sympatric species.

Natural hybridization is common in plants and results in different evolutionary consequences to hybridizing species. Pre- and post-zygotic reproductive isolating barriers can impede hybridization between closely related species to maintain their species integrity. In Northwest Yunnan, three Ligularia species (Ligularia cyathiceps, L. duciformis and L. yunnanensis) and four types of morphologically intermediate individuals were discovered growing together in an area subject to human disturbance. In this study, we used three low-copy nuclear loci to test the natural hybridization hypothesis and the hybridization direction was ascertained by three chloroplast DNA fragments. The results indicated there were two hybridization groups at the study site, L. cyathiceps × L. duciformis and L. duciformis × L. yunnanensis, and two types of morphologically intermediate individuals were produced by L. cyathiceps and L. duciformis, and another two types were produced by L. duciformis and L. yunnanensis, while no hybrids between L. cyathiceps and L. yunnanensis were observed. Both hybridizing groups showed bidirectional but asymmetric hybridization and the factors influencing the symmetry are discussed. Most hybrids produced by the two hybridization groups seemed to be F1 generation. Hybrids with different morphologies within the same hybridization group showed similar genetic components. The results suggest that although human disturbance may promote natural hybridization among the three Ligularia species bringing them together, hybrids are limited to F1s and therefore species boundaries might be maintained.

Introduction

Natural hybridization is common across plants, particularly in rapidly radiating groups (Mallet 2005), and can result in both positive and negative evolutionary outcomes (Barton 2001). Hybridization can generate new taxa through homoploid or allopolyploid hybrid speciation; however, it can also reduce the species diversity by blurring species boundaries, especially if introgression occurs (Wang ; Ramsey and Schemske 2002; Mallet 2007; Schneider ; Beatty ). Species integrity is maintained by pre- and post-zygotic reproductive isolating barriers preventing hybridization (Dickinson ). However, human disturbance is regarded as an important promoter of hybridization (Anderson 1948; Bleeker and Hurka 2001), and previously isolated species may come into contact and hybridize due to human alterations to the environment (Rhymer and Simberloff 1996; Seehausen ; Crispo ; Bohling ). Human disturbance has been proved to increase hybridization rates in some plants, such as breaking geographical barriers and promoting biological invasions (Thompson ), changing fire regimes (Ortego ) or even changing biological attributes as phenology (Lamont ). When hybridization happens, the direction of hybridization is affected by both pre- and post-zygotic barriers and asymmetric hybridization frequently occurs in plants as a result of differences in the strength of reproductive barriers between hybridizing species (Bacilieri ; Arnold 1997; Ma ; Zhang ).

Ligularia, a highly diversified genus belonging to Senecioneae (Asteraceae), is comprised of about 140 species distributing in Asia and Europe (Liu and Illarionova 2011) and its major distribution centre is located in Hengduan Mountains (Liu ). Natural hybridization is frequent in Ligularia and natural hybrids are commonly found in areas of sympatry (Liu ). Pan firstly reported Ligularia × maoniushanensis was a natural hybrid produced by Ligularia paradoxa and Ligularia duciformis in Yunnan, China. Yu 2014a, b) proved natural hybridization of Ligularia nelumbifolia and Ligularia subspicata, Ligularia vellerea and L. subspicata and between Ligularia cymbulifera and Ligularia tongolensis by using the internal transcribed spacer (ITS) region of the nuclear ribosomal DNA and chloroplast DNA (cpDNA) fragments. Moreover, studies on chemical compounds combined with nuclear ribosome ITS sequence also confirmed natural hybridization of L. nelumbifolia and L. subspicata, and of L. cymbulifera and L. tongolensis (Hanai ; Shimizu ). In all the cases described above, natural hybridization usually forms complex hybrid swarms and gene introgression between parental species, which may blur species boundaries between hybridizing species.

During the field investigation in Tianchi (Shangri-La, Yunnan), a place severely disturbed by farming, deforestation and tourism, three Ligularia species (Ligularia cyathiceps, L. duciformis and L. yunnanensis) were found growing together and four types of morphologically intermediate individuals (Type A, B, C and D) were discovered. According to morphological distinction, it is assumed that there are two hybridization groups, i.e. Type A and B individuals are presumed to be hybrids of L. cyathiceps and L. duciformis, while Type C and D individuals are supposed to be hybrids of L. duciformis and L. yunnanensis. In spite of frequently reported studies on natural hybridization of Ligularia in recent years, there is no report on the complicated relationships at the morphologically diverse hybrid zone described above involving three putative parents.

Natural hybrids can show various morphological characteristics, such as parental-like, intermediate or novel traits, and morphological evidence alone is inadequate in the identification of hybrids (Schneider ). Molecular techniques can provide more powerful evidence for natural hybridization, and low-copy nuclear genes have been proved to be efficient in solving problems of natural hybridization (Zhang ; Fan ; Liao ). Particularly, the utility of nuclear genes in previous studies is limited to nuclear ribosome ITS region, which have showed disadvantages such as not always tracking both parents’ genomes in hybrids (Jupe and Zimmer 1993) and amplifying pseudogenes or fungal ITS spacers (Buckler and Holtsford 1996; Muir ; Song ). In this study, three low-copy nuclear loci (A12, B14 and D30) and three chloroplast intergenic spacers (psbA–trnH, trnL–rpl32 and trnQ–5′rps16) were used to explore the relationships among L. cyathiceps, L. duciformis, L. yunnanensis and all the morphologically intermediate individuals observed in the contact zone. Our aims were to (i) identify if morphologically intermediate individuals are produced by hybridization between the three coexisting species and decouple the occurrence of two natural hybridization groups suggested by the morphologically intermediate individuals between L. cyathiceps and L. duciformis by one side and between L. duciformis and L. yunnanensis by the other side; (ii) if hybridization is confirmed, assess the direction of natural hybridization; and (iii) compare the consequences of two putative hybridization groups and their influence to three putative parental species.

Methods

Study species and plant sampling

The study site is located in Tianchi, Shangri-La, Yunnan, China (27°37.339′N, 99°38.151′E, 3901 m a.s.l.), where L. cyathiceps, L. duciformis and L. duciformis distribute sympatrically. Ligularia cyathiceps and Ligularia yunnanensis are two alpine species endemic to Northwest Yunnan with altitudes from 3000 m to 4000 m a.s.l. (Liu and Illarionova 2011). Ligularia duciformis distributes widely in West China and grows at altitudes varying from 1900 m to 4300 m a.s.l. (Liu and Illarionova 2011). Ligularia duciformis and L. yunnanensis belong to the series Retuase, section Corymbosae, and L. cyathiceps is a member of series Ligularia, section Ligularia (Liu 1989). These three species are all diploids with somatic chromosome number 2n = 58 (Pan , 2008).

According to the morphological descriptions in Flora of China (Liu and Illarionova 2011), L. cyathiceps and L. duciformis mainly differ in leaf size, dentate leaf margin, capitula arrangement and presence or absence of ray florets, while L. duciformis and L. yunnanensis have major differences in leaf size, dentate leaf margin, inflorescence branches and indumentum. The diagnostic morphological traits used to identify the species are presented in Table 1 and illustrated in Fig. 1, including the four morphologically intermediate types (Type A, B, C and D) that do not fit in the description of any of the species. Moreover, L. cyathiceps, L. duciformis and all putative hybrids prefer open and sunny habitats and occupy disturbed hillsides and roadsides, whereas L. yunnanensis likes shady and humid environment and is found at intact habitats below the canopy of trees.

Table 1.

Sampling details and morphologically diagnosic characteristics for L. cyathiceps, L. duciformis, L. yunnanensis and putative hybrids.

Taxon	No. of individuals (ID)	Voucher	Leaf size	Leaf blade margin	Inflorescence
L. cyathiceps (Lc)	20 (C1–20)	PG140805	8.5–13 × 10.5–22 cm	Coarsely dentate, apex rounded	Racemose, tubular florets, with several ray florets
Type A	15 (F1–15)	PG140816	Intermediate between Lc and Ld	Coarsely dentate, apex rounded	Compound corymb, tubular florets, with several ray florets
Type B	9 (T1–9)	PG140808	Intermediate between Lc and Ld	Coarsely dentate, apex rounded	Compound corymb, all tubular florets
L. duciformis (Ld)	20 (D1–20)	PG140813	5–16 × 7–50 cm	Denticulate, apex retuse	Compound corymb, all tubular florets, branches spreading, pubescent
Type C	30 (H1–30)	PG140814	Intermediate between Ld and Ly	Denticulate, apex retuse	Compound corymb, branches spreading relatively, shortly brown pilose
Type D	34 (S1–34)	PG140819	Intermediate between Ld and Ly	Denticulate, apex retuse	Compound corymb, branches spreading relatively, pubescent
L. yunnanensis (Ly)	20 (Y1–20)	PG140802	3–6.5 × 7–11 cm	Coarsely triangular-dentate, apex rounded	Corymb, branches shorter, fasciated, shortly brown pilose

Figure 1.

Morphological illustrations for the investigated individuals at the study site. (A and B) Ligularia cyathiceps; (C and D) Type A; (E and F) Type B; (G and H) Ligularia duciformis; (I and J) Type C; (K and L) Type D; (M and N) Ligularia yunnanensis; (O) the pollinator on Type D; (P) habitat.

A total of 148 individuals were sampled for molecular analysis. For three species L. cyathiceps, L. duciformis and L. yunnanensis, each of 20 individuals were collected. For four morphologically intermediate types, we sampled all the individuals with intermediate morphology and number of sampled individuals was detailed in Table 1. Healthy leaves from each individual were collected and stored in plastic bags with silica gel until DNA extraction. Voucher specimens were deposited in the Herbarium of Kunming Institute of Botany, Chinese Academy of Sciences (KUN) and voucher numbers are detailed in Table 1.

DNA extraction, PCR amplification and sequencing of DNA sequences

Total genomic DNA was extracted from dried leaves using the modified CTAB method (Doyle 1991). We amplified nearly all the universal markers applied to Asteraceae family (Chapman ) and finally obtained three low-copy nuclear loci A12, B14 and D30, which could be amplified and sequenced successfully with variable sites in the investigated individuals. Primers for A12, B14 and D30 developed by Chapman were used in the present study. For B14 and D30 loci, internal primers were designed to obtain complete sequences of some individuals. Designed primers for B14 and D30 were LB14F: 5′ AACGCRTACCTTTCCAACG 3′, LB14R: 5′ TCYGTCGCATTCTCCCTTC 3′ and LD30F: 5′ AATGTTCAGATTTTGGTTAT 3′, LD30R: 5′ CTTAGGTGAATCTGTTGC 3′, respectively. PCR conditions followed Chapman . Some individuals, especially from putative hybrids, had superimposed chromatograms at multiple sites and cloning sequencing was used to phase the haplotypes. Ligations were conducted using the pMD19-T Vector cloning kit (Takara, Dalian, China). Two to eight positive clones for each individual were selected for sequencing.

Three chloroplast intergenic spacers psbA–trnH, trnL–rpl32 and trnQ–5′rps16 were amplified using universal primers (Sang ; Shaw ). The PCR amplification was carried out in 20 μL reaction volume, containing 20 ng genomic DNA, 2.0 μL 10× PCR buffer, 1.0 μL MgCl2 (25 mM), 1.0 μL dNTPs (10 mM), 1.0 μL BSA (20 g/L), 0.2 μL Taq DNA polymerase (5 U/μL) (Takara, Shiga, Japan), 0.5 μL of each primer and 12.3 μL double-distilled water. PCR was conducted in a thermocycler with the following conditions: an initial 5 min denaturation at 80 °C, followed by 30 cycles of 45 s at 94 °C, 45 s annealing at 53 °C, 50 s extension at 65 °C and a final extension for 7 min at 65 °C. All PCR products were purified by electrophoresis with a 1.2 % agarose gel and then a Pearl Gel Extraction Kit (Pearl Biotech, Guangzhou, China) was used. Then, they were sequenced in both directions with the amplification primers using an ABI 3730 DNA automated sequencer with the BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems, Foster City, CA, USA).

Data analysis

All sequences were edited and assembled in SeqMan™ (DNASTAR, Madison, WI, USA). Multiple alignments were performed manually with Geneious Pro version 4.8.2 (Biomatters Ltd, Auckland, New Zealand). For three low-copy nuclear loci, haplotype inference was implemented with PHASE in DnaSP version 5.0 (Rozas ). A congruency test for three combined cpDNA intergenic spacers showed a significant rate of homogeneity (P > 0.5) by PAUP*4.0b10 (Swofford 2002), indicating a high degree of homogeneity. Haplotypes of the combined chloroplast sequences were inferred using DnaSP 5.0. Haplotype network was constructed for each nuclear locus and combined cpDNA region using Network version 5.0.0.0 (Forster ) with the median-joining algorithm (Bandelt ). Indels were treated as single mutational events in network analysis.

Results

Sequence analysis of nuclear loci—A12 locus

The aligned A12 region was 257 bp in length for all the investigated individuals (for variation sites, see). A total of six haplotypes were derived, and low levels of haplotype polymorphism were observed in L. cyathiceps, L. duciformis and L. yunnanensis which had two (cA1–2), two (dA1–2) and two (yA1) haplotypes, respectively (Table 2; Fig. 2A). Haplotypes of L. cyathiceps, L. duciformis and L. yunnanensis generated three clusters (cluster I, II and III) in haplotype network analysis, in which L. cyathiceps (cluster I) and L. duciformis (cluster II) were separated by six nucleotide substitutions and L. duciformis (cluster II) and L. yunnanensis (cluster III) were separated by five nucleotide substitutions (Fig. 2A).

Table 2.

Haplotypes for three Ligularia species and putative hybrids of three nuclear loci and combined cpDNA fragments.

Taxon	A12	B14	D30	cpDNA
L. cyathiceps	cA1, cA2	cB1, cB2, cB3, cB4, cB5, cB6, cB7	cD1, cD2, cD3, cD4	cP1, cP2, cP3
Type A	cA1, cA2, dA1	cB1, cB2, cB3, cB4, dB1	cD1, cD2, cD3, cD4, dD1, UN1, UN2, UN3	cP2, dP1, UN1
Type B	cA1, dA1, UN	cB1, cB2, cB3, cB4, dB1, UN1, UN2	cD1, cD3, dD1, UN2	cP1, cP2, cP3, dP1
L. duciformis	dA1, dA2	dB1	dD1	dP1
Type C	dA1, dA2, yA1	dB1, yB1, yB2, UN3, UN5, UN9	dD1, yD1	yP1, UN2
Type D	dA1, dA2, yA1	dB1, yB1, yB2, UN4, UN5, UN6, UN7, UN8	dD1, yD1	dP1, yP1, UN2
L. yunnanensis	yA1	yB1, yB2, yB3, yB4	yD1	yP1, yP2, yP3
Total haplotype number	6	21	9	9

Figure 2.

Haplotype networks for nuclear loci A12 (A), B14 (B), D30 (C) and three combined cpDNA fragments (D). Mutation steps are shown by numbers on the line, and node size is proportional to the frequency of each haplotype. For the haplotype names of three putative parental species, c, d and y represent L. cyathiceps, L. duciformis and L. yunnanensis, respectively.

For the putative hybrids of L. cyathiceps and L. duciformis (Type A and B), all individuals but one (T7) showed two divergent haplotypes (cA1/dA1 and cA2/dA1) originated from L. cyathiceps and L. duciformis, and the haplotype of individual T7 was a combination of two haplotypes (cA1/UN1) found in L. cyathiceps cluster (Table 3). For the putative hybrids of L. duciformis and L. yunnanensis (Type C and D), all individuals but six (H12, S1, S4, S8, S16 and S32) had combined haplotypes (dA1/yA1 and dA2/yA1) nested in clusters of L. duciformis and L. yunnanensis (Table 3). Individuals S8 and S16 were homozygous for a L. duciformis haplotype (dA1/dA1), while the other four individuals H12, S1, S4 and S32 were homozygous for a L. yunnanensis haplotype (yA1/yA1).

Table 3.

Haplotype combination for the putative hybrids of three nuclear loci and combined chloroplast fragments. UN means unique haplotype to the putative hybrids and haplotype names is in concordance with those in Fig. 2.

Locus	Haplotype combination	Number of individuals of the putative hybrids		Haplotype combination	Number of individuals of the putative hybrids
		Type A	Type B		Type C	Type D
A12	cA1/dA1	14	8	dA1/yA1	26	27
	cA2/dA1	1	0	dA2/yA1	3	2
	cA1/UN1	0	1	dA1/dA1	0	2
	–	–	–	yA1/yA1	1	3
B14	cB1/dB1	1	3	dB1/yB1	18	19
	cB2/dB1	2	1	dB1/yB2	0	1
	cB3/dB1	6	2	dB1/UN7	0	1
	cB4/dB1	5	1	dB1/UN8	0	1
	dB1/UN2	0	1	dB1/UN9	1	0
	cB3/UN1	0	1	yB1/UN3	1	0
	dB1/dB1	1	0	yB1/UN4	0	1
	–	–	–	yB1/UN5	2	3
	–	–	–	UN5/UN6	0	1
	–	–	–	dB1/dB1	5	3
	–	–	–	yB1/yB1	1	4
	–	–	–	yB1/yB2	1	0
	–	–	–	yB2/yB2	1	0
D30	cD1/dD1	9	3	dD1/yD1	27	30
	cD2/dD1	1	0	dD1/dD1	1	2
	cD3/dD1	1	4	yD1/yD1	2	2
	cD4/dD1	1	0	–	–	–
	dD1/UN1	1	0	–	–	–
	dD1/UN2	1	2	–	–	–
	dD1/UN3	1	0	–	–	–
cpDNA	dP1	12	5	yP1	25	28
	cP1	0	2	dP1	2	3
	cP2	2	1	UN2	3	3
	cP3	0	1	–	–	–
	UN1	1	0	–	–	–

Sequence analysis of nuclear loci—B14 locus

The length of aligned B14 fragment was 466 bp with one 2-bp indel distinguishing L. duciformis from L. yunnanensis (for variation sites, see). There were 21 haplotypes detected in total, of which 7 (cB1–7), 1 (dB1) and 4 (yB1–4) haplotypes were from L. cyathiceps, L. duciformis and L. yunnanensis, respectively (Table 2; Fig. 2B). Three clusters (cluster I, II and III) formed by haplotypes of L. cyathiceps, L. duciformis and L. yunnanensis were identified in haplotype network analysis, in which L. cyathiceps (cluster I) and L. duciformis (cluster II) were separated by six nucleotide substitutions and L. duciformis (cluster II) and L. yunnanensis (cluster III) were separated by three nucleotide substitutions (Fig. 2B).

For the putative hybrids of L. cyathiceps and L. duciformis (Type A and B), all individuals but one (F14) had two divergent haplotypes (cB1/dB1, cB2/dB1, cB3/dB1, cB4/dB1, dB1/UN2 and cB3/UN1) identified from L. duciformis and L. cyathiceps clusters, respectively (Table 3). Individual F14 is homozygous with the same haplotype of L. duciformis (dB1/dB1). Haplotypes for the putative hybrids of L. duciformis and L. yunnanensis (Type C and D) showed higher polymorphism with four types of haplotype composition as follows (Table 3): (i) The majority of individuals possessed two divergent haplotypes (dB1/yB1, dB1/yB2, dB1/UN7, dB1/UN8 and dB1/UN9), each nested in clusters of L. duciformis and L. yunnanensis, respectively. (ii) Eight individuals (H1, H4, H11, H13, H18, S16, S31 and S34) were homozygous for a L. duciformis haplotype (dB1/dB1). (iii) Six individuals (H16, H17, S1, S4, S21 and S32) were homozygous for one of L. yunnanensis haplotypes (yB1/yB1 and yB2/yB2). (iv) Nine individuals (H8, H12, H28, H30, S8, S11, S12, S14 and S33) showed mixed haplotypes (yB1/yB2, yB1/UN3, yB1/UN4, yB1/UN5 and UN5/UN6) originated from L. yunnanensis cluster.

Sequence analysis of nuclear loci—D30 locus

The fragment D30 was 504 bp long after sequence alignment with one 1-bp indel distinguishing L. cyathiceps from L. duciformis and one 2-bp indel differing L. duciformis from L. yunnanensis (for variation sites, see). There were nine haplotypes identified in all individuals, of which four (cD1–4), one (dD1) and one (yD1) haplotypes were from L. cyathiceps, L. duciformis and L. yunnanensis, respectively (Table 2; Fig. 2C). In haplotype network analysis, three clusters (cluster I, II and III) were generated evidently by haplotypes of L. cyathiceps, L. duciformis and L. yunnanensis, respectively, in which L. cyathiceps (cluster I) and L. duciformis (cluster II) were separated by seven nucleotide substitutions and L. duciformis (cluster II) and L. yunnanensis (cluster III) were separated by 13 nucleotide substitutions (Fig. 2C).

For the putative hybrids of L. cyathiceps and L. duciformis (Type A and B), all individuals had two divergent haplotypes (cD1/dD1, cD2/dD1, cD3/dD1, cD4/dD1, dD1/UN1, dD1/UN2 and dD1/UN3) identified from L. cyathiceps and L. duciformis clusters, respectively (Table 3). For the putative hybrids of L. duciformis and L. yunnanensis (Type C and D), all individuals but seven (H12, H13, H26, S1, S8, S16 and S32) possessed combined haplotypes of L. duciformis and L. yunnanensis (dD1/yD1) (Table 3). Individuals H26, S8 and S16 were homozygous for the L. duciformis haplotype (dD1/dD1), whereas individuals H12, H13, S1 and S32 were homozygous for the L. yunnanensis haplotype (yD1/yD1).

Sequence analysis of cpDNA fragments

The combined length of aligned cpDNA fragments (psbA–trnH, trnL–rpl32 and trnQ–5′rps16) was 2214 bp with 27 polymorphic sites and seven indels [see]. Nine haplotypes were inferred in total, of which three (cP1–3), one (dP1) and three (yP1–3) haplotypes were from L. cyathiceps, L. duciformis and L. yunnanensis, respectively (Table 2; Fig. 2D). Haplotype network analysis indicated all three L. cyathiceps haplotypes (cP1–3) grouped into one cluster (cluster I), whereas two L. yunnanensis haplotypes (yP2–3) and the L. duciformis haplotype (dP1) formed into another cluster (cluster II) and another L. yunnanensis haplotype (yP1) was in the third cluster (cluster III) (Fig. 2D). Clusters I and II were separated by 23 nucleotide substitutions and clusters II and III were separated by 15 nucleotide substitutions.

For the putative hybrids of L. cyathiceps and L. duciformis (Type A and B), most (17 of 24) individuals had the same L. duciformis haplotype (dP1), and six individuals (F3, F11, T2, T3, T4 and T7) had haplotypes consistent with L. cyathiceps (cP1, cP2 and cP3) (Table 3). Individual F15 had a unique haplotype (UN1) with two nucleotide substitutions differed from the common L. cyathiceps haplotypes (cP1 and cP2). For the putative hybrids of L. duciformis and L. yunnanensis (Type C and D), most (53 of 64) individuals possessed haplotypes of L. yunnanensis (yP1) and five individuals (H3, H15, S6, S16 and S26) had haplotypes of L. duciformis (dP1) (Table 3). The other six individuals (H13, H22, H26, S24, S25 and S30) had a unique haplotype (UN2) differed from the haplotype of L. yunnanensis (yP1) with one mutation step. Genotypes at three low-copy nuclear loci and combined cpDNA fragments for all the investigated individuals are listed in .

Discussion

Natural hybridization among L. cyathiceps, L. duciformis and L. yunnanensis from molecular evidence

In this study, we sequenced three low-copy nuclear loci and three cpDNA fragments to assess natural hybridization between L. cyathiceps, L. duciformis and L. yunnanensis in an area of contact in Tianchi, Shangri-La, Yunnan where the three species occur together. Our results suggested that the endemic L. cyathiceps showed relatively higher haplotype diversity than widely distributing L. duciformis, indicating high genetic diversity of L. cyathiceps at the study site. In addition, L. duciformis and L. yunnanensis showed closer genetic distance in two nuclear loci (A12 and B14) and combined cpDNA data, particularly in cpDNA data where two L. yunnanensis haplotypes grouped with the L. duciformis haplotype. These observations are consistent with the morphological classification (Liu 1989) and preliminary molecular phylogenetic results (W.-Y. He and Y.-Z. Pan, Kunming Institute of Botany, Chinese Academy of Sciences, unpubl. data). Nevertheless, L. cyathiceps, L. duciformis and L. yunnanensis remained well separated in the haplotype network analysis, indicating their clear divergence from each other. In general, morphologically intermediate individuals Type A and B showed chromatogram additivity for L. cyathiceps and L. duciformis at most nuclear loci, while most Type C and D individuals for L. duciformis and L. yunnanensis, providing strong evidence for natural hybridization hypotheses above and for lack of hybridization between L. cyathiceps and L. yunnanensis. Additionally, the occurrence of unique haplotypes in putative hybrids of two hybridization groups may be intragenic recombination between haplotypes or caused by unsampled polymorphisms in parental individuals.

Pre- and post-zygotic barriers among L. cyathiceps, L. duciformis and L. yunnanensis

Different pre- and post-zygotic barriers can reduce potential cross-breeding and result in reproductive isolation between species pairs (Dobzhansky 1937; Grant 1981; Stace 1991; Field ; Ma ). Meanwhile, natural hybridization may occur between closely related species with incomplete pre- and post-zygotic barriers. Natural hybridization is often associated with disturbed habitats as human disturbance can disrupt ecological barriers and promote natural hybridization (Anderson 1948; Rieseberg and Carney 1998; Ma ). Human disturbance can create intermediate habitat suitable for hybrids, promoting the maintenance of hybrid swarms in these habitats (Anderson 1948; Ellstrand and Schierenbeck 2000). In previous hybridization studies of Ligularia, hybrid zones often locate at roadsides, mountain slopes destroyed by fire and other areas subjected to human disturbance, suggesting that hybridization in Ligularia may be promoted by human activities (Pan ; Yu , 2014a, b). In this study, once again, the hybrid zone is located in an area severely disturbed by human activities such as tree felling and grazing, supporting the observation of previous studies.

But, could pre- and post-zygotic barriers explain the hybridization patterns observed in this contact zone? The overlap of blooming periods provides the first condition for hybridization since it enables pollen movement by pollinator vectors. In the present study, both L. duciformis and L. cyathiceps flower from July to August, while L. yunnanensis flowers from May to August (Liu and Illarionova 2011). Moreover, Ligularia plants have generalized pollination system and about 10 insects belonging to three orders (Diptera, Lepidoptera and Hymenoptera) are the major pollinators (Liu 2002; Cao ). Generalized pollinators shared between species offer opportunities for the pollen transfer. Thus, incomplete pre-zygotic barriers such as the overlap of blooming periods and generalized pollinators will largely contribute for natural hybridization of L. cyathiceps × L. duciformis and L. duciformis × L. yunnanensis.

Similar inflorescence arrangement may be another factor significantly contributing for the hybridization between L. duciformis and L. yunnanensis. These two species present similar arrangement of the capitula in corymb inflorescences. The generalized pollinators may tend to visit inflorescences with similar morphologies, thus promoting pollen transfer between these two species. Indeed, pollen transfer between species with similar inflorescence arrangement has been observed in natural hybrid zones of Ligularia (Pan ; Yu ).

In addition, close relationship between L. duciformis and L. yunnanensis may also work as a less effective post-zygotic barrier to hybridization in closely related species. In previous studies, hybridization has been detected in Ligularia species pairs that are closely related, such as L. paradoxa and L. duciformis (Pan ) and L. cymbulifera and L. tongolensis (Yu ). In the present study, L. duciformis and L. yunnanensis both belong to Series Retusae, Section Corymbosae (Liu 1989) and are closely related according to haplotype analysis (Results section in this study) and preliminary molecular phylogenetic study (W.-Y. He and Y.-Z. Pan, Kunming Institute of Botany, Chinese Academy of Sciences, unpubl. data).

Since L. cyathiceps and L. yunnanensis also possess the overlapping blooming periods and generalized pollinators, it seems that there are no pre-zygotic barriers reducing pollen transfer between them. The lack of hybrids between L. cyathiceps and L. yunnanensis may be attributed to post-zygotic barriers. Actually, sympatric species in Ligularia could coexist without hybridization, if they have undergone long isolation and accumulated enough mutations, as indicated by species in the Ligularia-Cremanthodium-Parasenecio (L-C-P) complex (Liu ). In the network analysis of three low-copy nuclear loci and combined cpDNA fragments, L. cyathiceps and L. yunnanensis showed relatively higher genetic distance than each of them with L. duciformis. Although the genetic difference shown in the network analysis is limited, it may be caused by the restricted loci used in this study. Therefore, the accumulation of mutations between L. cyathiceps and L. yunnanensis may drive the species divergence, reduce interspecies crossability and/or lower fitness of possible hybrids. Post-zygotic barriers resulting in the aborted seeds or reduction of fitness for hybrids in seedling stages, which have been observed in many plants, such as Chamaecrista (Costa ), Rhododendron (Ma ) and Silene (Zhang ), may lead to the lack of hybrids between L. cyathiceps and L. yunnanensis.

Asymmetric hybridization of L. cyathiceps × L. duciformis and L. duciformis × L. yunnanensis

As Ligularia was proved to be chloroplast maternally inherited (Zhang ), combined cpDNA fragments would predict the direction of natural hybridization. For the hybridization L. cyathiceps × L. duciformis, cpDNA data indicate L. duciformis is the maternal parent of most (70.83 %) putative hybrids, thus natural hybridization between L. cyathiceps and L. duciformis is bidirectional but asymmetric, and L. duciformis is the primary maternal parent. However, for the hybridization L. duciformis × L. yunnanensis, cpDNA results suggest that L. yunnanensis is the maternal parent of most (82.81 %) putative hybrids. Two hybridization groups show distinctive asymmetry in natural hybridization and different factors may be responsible for their asymmetry.

Differences in floral traits could drive differences in floral preferences and floral constancy of pollinators, which may affect the levels and direction of hybridization (Aldridge and Campbell 2007; Castro ). This could be occurring, for example, between L. duciformis and L. cyathiceps. Ligularia duciformis have larger compound corymb inflorescences than the racemose inflorescences of L. cyathiceps; therefore, it would be likely that L. duciformis is more attractive to pollinators and acts as the maternal parent to accept pollen transferred from L. cyathiceps.

Contrarily, for L. duciformis and L. yunnanensis, having similar inflorescence traits, the asymmetric hybridization may be associated to the relative abundance of parental species. The prediction that the rare species, undergoing ‘pollen swamping’ by more abundant congeners, usually acts as the maternal parent, is confirmed by many examples in plants and animals (Arnold ; Rieseberg 1995; Levin ; Wirtz 1999; Lepais ). At the present study site, L. duciformis occupies more widely habitat than L. yunnanensis occurring in intact habitat, and L. duciformis plants greatly outnumber L. yunnanensis plants, thus L. yunnanensis would be more likely the maternal parent.

Consequences of natural hybridization among L. cyathiceps, L. duciformis and L. yunnanensis

In the present study, most putative hybrid individuals in two hybridization groups show chromatogram additivity at all of three randomly selected nuclear loci, suggesting they might be F1s. Hybrids restricted to F1 generation can impede gene flow between species and keep hybridizing species pairs reproductively isolated from each other (Milne ; Milne and Abbott 2008; Twyford ). Four morphologically intermediate individuals S16 and H12, S1, S32 are pure with haplotypes of L. duciformis and L. yunnanensis, respectively, at three nuclear loci. It might be unlikely that these homozygous individuals are caused by repetitive backcrossing with corresponding parents, since there is no occurrence of later-generation individuals. They may result from sampling confusion mistakes between hybrids and pure parents, indicating further morphological studies are needed in this area of contact. There are two morphology-differential types of hybrids produced by two hybridization groups, especially in the L. cyathiceps and L. duciformis hybridization group where Type A and Type B differ in the presence/absence of ray floret. Nevertheless, it is noteworthy that different types in these two hybridization groups show similar intra-group nuclear and chloroplast haplotype composition.

In previous reports on natural hybridization of Ligularia, hybrid swarms are common and introgression occurs between parental species (Yu , 2014a, b). Being a genus with high species diversity formed by rapid radiation (Liu ), species in Ligularia may not be completely isolated reproductively and sympatric hybridization is expected to be frequent. However, the existence of F1 hybrids without later-generation individuals prevents introgression and facilitates reproductive isolation among sympatric species. Moreover, the lack of later-generation hybrids seems to be the result of a fitness disadvantage of the hybrids produced by L. cyathiceps × L. duciformis and L. duciformis × L. yunnanensis, which is also a barrier to hybridization at a more advanced stage. Unlike the F1-dominated hybrid zone in Rhododendron descripted by Milne , hybridization in this study might be promoted by human disturbance such as tree felling and grazing; however, post-zygotic barriers such as the sterility of F1s may contribute for no later-generation hybrids. Human disturbance can bring species into contact and trigger natural hybridization (Anderson 1948), and can furtherly promote hybridization through increasing opportunities for gene flow (Lamont ; Zha ; Thompson ; Ortego ). In the present study, although human disturbance might influence or promote the hybridization among the three Ligularia species studied, they may still keep their species distinctiveness and maintain reproductive isolation under the circumstance that hybridization takes place. Nevertheless, in the future studies, experiments such as controlled pollination crosses, seed germination and hybrid fitness examination need to be conducted to furtherly reveal the asymmetric hybridization and pre- and post-zygotic isolating barriers among three Ligularia species in this hybrid zone in the hotspot area of Northwest Yunnan.

Conclusions

The natural hybridization of L. cyathiceps × L. duciformis and L. duciformis × L. yunnanensis was confirmed based on three low-copy nuclear loci and three cpDNA fragments. In the two hybridization groups, most hybrids seem to be F1s, which suggests the maintenance of species boundaries between hybridizing species. There were no hybrids between L. cyathiceps and L. yunnanensis, which may be attributed to post-zygotic reproductive barriers such as hybrid inviability and sterility. Chloroplast DNA data indicated asymmetric hybridization, with L. duciformis as primary maternal parent in the L. cyathiceps × L. duciformis hybridization group, and L. yunnanensis for the L. duciformis × L. yunnanensis hybridization group. Pollinator preferences and the relative abundance of parental species may lead to asymmetric hybridization. Still, the three Ligularia species seem to maintain the species integrity in the studied sympatric area.

Accession Numbers

The data set of DNA sequencing data have been deposited in GenBank under accession numbers KX779147–KX779271.

Sources of Funding

This research was supported by the National Natural Science Foundation of China (grant no. 31600178 to J.-J.Y.).

Contributions by the Authors

X.G. and Y.-H.W. conceived and designed the experiments. X.G. and J.-J.Y. collected plant materials. N.-N.Z. performed the experiments, analysed the data and wrote the manuscript. X.G. and J.-J.Y. revised the manuscript. All authors read and approved the final manuscript.

Conflict of Interest

None declared.

Supporting Information

The following additional information is available in the online version of this article—

Table S1. Variation sites of A12 locus for six haplotypes in all investigated individuals.

Table S2. Variation sites and indels of B14 locus for 21 haplotypes in all investigated individuals.

Table S3. Variation sites and indels of D30 locus for nine haplotypes in all investigated individuals.

Table S4. Variation sites and indels of three chloroplast fragments for nine haplotypes in all investigated individuals.

Table S5. Genotypes at three low-copy nuclear loci and combined cpDNA fragments for all the investigated individuals.

Click here for additional data file.