Literature DB >> 25296024

Early patterning and specification of cardiac progenitors in gastrulating mesoderm.

W Patrick Devine1, Joshua D Wythe1, Matthew George1, Kazuko Koshiba-Takeuchi1, Benoit G Bruneau1.   

Abstract

Mammalian heart development requires precise allocation of cardiac progenitors. The existence of a multipotent progenitor for all anatomic and cellular components of the heart has been predicted but its identity and contribution to the two cardiac progenitor 'fields' has remained undefined. Here we show, using clonal genetic fate mapping, that Mesp1+ cells in gastrulating mesoderm are rapidly specified into committed cardiac precursors fated for distinct anatomic regions of the heart. We identify Smarcd3 as a marker of early specified cardiac precursors and identify within these precursors a compartment boundary at the future junction of the left and right ventricles that arises prior to morphogenesis. Our studies define the timing and hierarchy of cardiac progenitor specification and demonstrate that the cellular and anatomical fate of mesoderm-derived cardiac cells is specified very early. These findings will be important to understand the basis of congenital heart defects and to derive cardiac regeneration strategies.

Entities:  

Keywords:  developmental biology; embryo; heart; lineages; mesoderm; mouse; stem cells

Mesh:

Substances:

Year:  2014        PMID: 25296024      PMCID: PMC4356145          DOI: 10.7554/eLife.03848

Source DB:  PubMed          Journal:  Elife        ISSN: 2050-084X            Impact factor:   8.140


Introduction

Mammalian heart development involves the allocation of cardiac progenitors in a discrete spatial and temporal order (Evans et al., 2010; Bruneau, 2013). Understanding the identity and regulation of these progenitors is critical to understanding the origins of congenital heart defects and may lead to novel cell-based regenerative therapies for heart disease (Bruneau, 2008; Xin et al., 2013). The existence of an early and specific multipotent progenitor for all anatomic and cellular components of the heart has been predicted (Parameswaran and Tam 1995; Tam et al., 1997; Meilhac et al., 2004b; Kinder et al., 2001), but the identity of this progenitor and when it arises in embryonic development has remained undefined. At least two sets of molecularly and morphologically distinct cardiac precursors have been identified in the mammalian embryo, referred to as the first and second heart fields; these populations contribute to distinct anatomical structures within the heart (Evans et al., 2010; Buckingham et al., 2005). Separation of the left and right ventricles is dependent on a single structure, the interventricular septum (IVS) and it has been postulated that the IVS myocardium has a dual contribution from these two heart fields (Bruneau et al., 1999; Takeuchi et al., 2003). The existence of these two cardiac progenitor ‘fields’ raises the question of when cardiac precursors are allocated to these populations and their contributions to mature structures in the heart, such as the IVS. Previous studies have suggested that a population of early mesoderm expressing the transcription factor Mesp1 precedes the establishment of the anatomically and molecularly distinct ‘heart fields’ (Saga et al., 1996, 1999; Bondue et al., 2008; Lindsley et al., 2008) that ultimately will differentially populate the great vessels, RV and atria or the LV and atria. However it is clear that Mesp1+ cells can also contribute to a broad range of mesodermal derivatives that include, but are not restricted to, the developing heart (Chan et al., 2013; Yoshida et al., 2008). A population of mesoderm labeled by Eomesodermin has also been shown to contribute to the developing heart, but again these cells have broad contributions in the embryo (Arnold and Robertson, 2009). Retrospective lineage analysis supports the distinct origins of segments of the heart from individual precursor pools (Meilhac et al., 2003; Buckingham et al., 2005; Meilhac et al., 2004b), but several questions remain regarding the timing and molecular progression of cardiac specification (Meilhac et al., 2004b). For example, do early mesodermal cells become ‘locked into’ a cardiac fate early on and when do they become ‘assigned’ to an anatomical location? Is there a multipotent, specified cardiac progenitor that anticipates the currently understood heart fields? Here we show that early cardiac progenitors are assigned to a specific developmental path prior to or shortly after the initiation of gastrulation. We identify a population of specified cardiac precursors arising from these mesodermal progenitors that express the chromatin remodeling factor Smarcd3 prior to the onset of expression of known cardiac progenitor markers (Nkx2-5, Isl1, and Tbx5). Clonal labeling of early cardiac precursors highlights the heterogeneity among Mesp1+ progenitors, including the existence of precursors that are restricted in their anatomical contribution, especially to distinct ventricular chambers. Finally, inducible genetic marking of early Tbx5+ and Mef2c-AHF + populations highlights this early segregation of cardiac progenitors and suggests that the compartment boundary that exists between the right and left ventricles arises from an early clonal boundary, prior to the onset of septum morphogenesis. Overall our findings delineate the progression and molecular identity of cardiac precursors in the early mouse embryo.

Results

In reassessing the in vivo differentiation potential of Mesp1+ cells, we find that this population contributes broadly to several mesodermal derivatives, (Figure 1A), consistent with other reports (Yoshida et al., 2008). We reasoned that among this diverse mesodermal population, a more specific population destined for the cardiac lineage exists. To test this model, we performed in vivo clonal analysis by generating mosaic mice in which very few Mesp1+ cells were labeled at isolated clonal density via the mosaic analysis with double markers (MADM) system (Zong et al., 2005; Hippenmeyer et al., 2010) (Figure 1B–C). This approach is particularly advantageous because labeling events are rare, labeling is permanent, and one can identify labeled daughter cells (twin spots) based on color (Figure 1—figure supplement 1A). We analyzed in fetuses (E12.5-E14.5) the anatomic distribution and cellular constituents of clones induced by Mesp1 (which is active in mesoderm from ∼E6.0 to E7.5) (Saga et al., 1999). While we did not use a conditional Cre allele to control the timing of Cre activity, we confirmed the timing of Cre expression by in situ hybridization (Figure 1—figure supplement 1B). By the late head fold stage (LHF), we see a downregulation of Cre mRNA and localization to the base of the allantois. We see no expression in the area of forming cardiogenic mesoderm. In addition, we counted the number of labeling events in embryos at E8.5 and E14.5 (Figure 1—figure supplement 1D–E and Statistical Analysis) and saw no change in the distribution of labeled clusters, suggesting that no additional recombination events have occurred over this time interval. Finally, a complementary lineage labeling approach using a Mesp1-rtTA transgenic allele (Lescroart et al., 2014) defines a functional window of Mesp1 activity based on the timing of doxycycline administration between E6.25-E7.5, again supporting the narrow timing of Mesp1 activity.
Figure 1.

The first and second heart fields diverge early in gastrulating mesoderm.

(A) Genetic lineage tracing of Mesp1;ROSAR26R mice reveals widespread labeling of mesodermal derivatives at E10.5, including forelimb (dotted outline). (B) Schematic of experimental protocol. Single cells are labeled early in gastrulating mesoderm and progeny of labeled cells observed later in development. (C) Example of clonal labeling in E9.5 embryo. Four distinct, scattered, clusters of labeled cells are present throughout trunk and neck, including a single yellow clone in ventricle (1, arrowhead). (D) Ventral view of a second heart field progenitor clone (red and green twin spots) with an additional yellow clone in the septal region (embryo ID MM2). (E) Whole mount view revealing an absence of non-cardiac clones elsewhere in the same embryo. (F) Ventral view of left ventricle clone (embryo ID MM15). Red and green twin spots are adjacent to each other. (G) Section through red-boxed area of embryo MM15 showing intermingling of red and green twin spots. (H) Ventral view of large, yellow septal clone (embryo ID MM34). (I) Whole-mount ventral view of red and green twin-spots in right ventricle (embryo ID MM27). Boxed regions indicate areas shown in higher magnification sections. (J) Section through clone in embryo MM27 reveals green labeled cardiomyocyte (asterisk) and red endocardial twin spot (arrows). Note overlap of red clonal labeling with blue PECAM staining. (K) Additional section through clone in embryo MM27. Green twin spot contributes to both cardiomyocytes (asterisk) as well as PECAM stained endocardial cells (arrows). (L) Whole-mount ventral view and (M) section of heart at E14.5 with a left ventricle-atria clone (embryo ID MM26). Note red and green twin spots (in LV and RA) in whole-mount view. Sectioning reveals a subset of the green twin spot has remained in the top of the left ventricle (asterisk). (N) Whole-mount ventral view of red and green twin spots in out-flow tract from embryo MM24. (O) Section through outflow-tract region reveals red twin spot contributing predominantly to pulmonary artery. Green twin spot contributes to both pulmonary artery and aorta. In addition, green twin spot appears to contribute to both endothelial lining of aorta (arrows) as well as cardiomyocytes (asterisk) at base of aorta. In (G, J–K) white: DAPI stained nuclei. In (J–K) blue: PECAM stained endothelial cells. In (M and O) blue: phalloidin stained actin. A, anterior; LA, left atrium; LV, left ventricle; OFT, out-flow tract; P, posterior; RA, right atrium; RV, right ventricle. Scale bars: (G and J–K), 100 µm (D, F, H, I, L, N), 200 µm.

DOI: http://dx.doi.org/10.7554/eLife.03848.003

(A) Prior to expression of Cre-recombinase, GFP and Tomato fluorophores are inactive. Interchromosomal recombination is induced by Cre recominase, thus restoring activity of GFP and Tomato. Recombination occurring in post-mitotic cells (G0) or in G1 phase of cell cycle generates red and green positive (yellow) cells. Recombination occurring after DNA replication (G2 phase of cell cycle) generates daughter cells that are uniquely labeled. So-called X-segregation generates daughter cells that are Red and Green and Z-segregation generates daughter cells that are colorless or yellow. (B) In situ hybridization for Cre mRNA in a Mesp1 embryo at the late head fold stage (LHF). Note expression in allantois (asterisk) as well as the allantoic membrane (arrowheads). Expression in the area of the forming cardiogenic mesoderm (dotted circle) is largely absent. (C) The total number of Mesp1-derived cells was empirically determined by FACS analysis. Five independent Mesp1; Rosa embryos at E7.5 were collected, dissociated, and stained for cardiac-Troponin (cTNT) and DAPI. The total number of cells as well as TdTomato and cTNT positive cells were counted and plotted. On average, 1/3 of the total number of cells are Mesp1-derived. No cTNT positive cells were seen at this time point. (D–E) Counting the number of labeled clones at two different developmental time-points (E8.5 and E14.5) reveals a similar distribution of labeling frequency. A stable distribution of clonal labeling between the early and late time points argues against loss of twin spots over time due to apoptosis or ectopic induction after the initial Mesp1 induced clonal labeling. (F) Ventral view of heart with no clones (embryo ID MM21). (G) Lung and attached esophagus from same specimen with clones in mesenchyme surrounding esophagus and trachea (arrow) in mesenchyme of lung parenchyma (arrowhead). E, esophagus; LA, left atrium; LV, left ventricle; OFT, out-flow tract; RA, right atrium; RV, right ventricle. Scale bar: (B) 100 µm.

DOI: http://dx.doi.org/10.7554/eLife.03848.004

(A–B) The epiblast-specific Cre line, Sox2::Cre, is active in epiblast cells at E6.5 with little or no activity in extraembryonic tissues when passed through the male germline. Crossing male Cre-containing mice with ROSAAi14 results in broad reporter activity throughout the embryo proper at E10.5. (C–D) Left lateral views of E9.5 embryos of the indicated genotype reveals many yellow clones through the embryo, including the heart (asterisk) (E–G) Ventral view of isolated heart from an epiblast-induced MADM clone. A large, dispersed, yellow clone consisting of ∼75–100 cells extends from the OFT through the RV into the LV. Because of the dispersive nature and single color labeling of this particular example, it is unclear if this represents a single recombination event or multiple events. LV, left ventricle; OFT, outflow tract; RV, right ventricle.

DOI: http://dx.doi.org/10.7554/eLife.03848.005

(A) Dorsal view of left ventricle progenitor clone in embryo MM15 with both twin spots in the left ventricle. (B) Dorsal view of heart from embryo MM35. Note red twin spot in left ventricle and corresponding green twin spot in right atrium. (C) Dorsal view of heart from embryo MM36. Note red and green twin spots in right ventricle. Additional green labeling is present in the right atrium. (D) Ventral view of heart from embryo MM11 reveals red and green twin spots within the right ventricle. Because multiple twin spots are adjacent to one another, it is unclear if clones represent a single progenitor labeling event or more than one progenitor labeling events. (E) Ventral view of heart from MM3 showing an isolated yellow clone in ventral part of outflow-tract. (F) Ventral view of heart from MM4 showing red and green twin spots on outflow-tract. (G–H) Ventral views of hearts from MM38 (G) and MM6 (H) show red a green twin spots in left and right atria. (I) Ventral view of heart from MM1. Two separate clones are seen in this particular example. The first clone is clearly identifiable as an out flow tract clone and consists of a band of green cells around the ventral part of the outflow-tract and a red twin spot (not shown) on dorsal surface of outflow-tract. In addition, a large yellow clone is seen in the left atrium. (J) Ventral view of right ventricle clone (embryo ID MM9). Red and green twin spots are adjacent to each other. (K) Section through red-boxed area of embryo MM9 reveals red labeled cardiomyocytes (asterisks) and green labeled endocardial cells arrows). In (K) blue: phalloidin stained actin. (L) Section through right ventricle of embryo MM33. A single green twin spot is present within the right ventricle (stained with GFP). Endothelial cells have been labeled with anti-PECAM (red) and cardiomyoctes have been labeled with anti-tropomyosin (blue). Note that cells from this twin spot contribute to both PECAM-positive endocardial cells (arrows) as well as tropomyosin positive cardiomyocytes (asterisks). LA, left atrium; LV, left ventricle; OFT, out-flow tract; RA, right atrium; RV, right ventricle.

DOI: http://dx.doi.org/10.7554/eLife.03848.006

Figure 1—figure supplement 1.

Overview of MADM clonal analysis and twin spot labeling.

(A) Prior to expression of Cre-recombinase, GFP and Tomato fluorophores are inactive. Interchromosomal recombination is induced by Cre recominase, thus restoring activity of GFP and Tomato. Recombination occurring in post-mitotic cells (G0) or in G1 phase of cell cycle generates red and green positive (yellow) cells. Recombination occurring after DNA replication (G2 phase of cell cycle) generates daughter cells that are uniquely labeled. So-called X-segregation generates daughter cells that are Red and Green and Z-segregation generates daughter cells that are colorless or yellow. (B) In situ hybridization for Cre mRNA in a Mesp1 embryo at the late head fold stage (LHF). Note expression in allantois (asterisk) as well as the allantoic membrane (arrowheads). Expression in the area of the forming cardiogenic mesoderm (dotted circle) is largely absent. (C) The total number of Mesp1-derived cells was empirically determined by FACS analysis. Five independent Mesp1; Rosa embryos at E7.5 were collected, dissociated, and stained for cardiac-Troponin (cTNT) and DAPI. The total number of cells as well as TdTomato and cTNT positive cells were counted and plotted. On average, 1/3 of the total number of cells are Mesp1-derived. No cTNT positive cells were seen at this time point. (D–E) Counting the number of labeled clones at two different developmental time-points (E8.5 and E14.5) reveals a similar distribution of labeling frequency. A stable distribution of clonal labeling between the early and late time points argues against loss of twin spots over time due to apoptosis or ectopic induction after the initial Mesp1 induced clonal labeling. (F) Ventral view of heart with no clones (embryo ID MM21). (G) Lung and attached esophagus from same specimen with clones in mesenchyme surrounding esophagus and trachea (arrow) in mesenchyme of lung parenchyma (arrowhead). E, esophagus; LA, left atrium; LV, left ventricle; OFT, out-flow tract; RA, right atrium; RV, right ventricle. Scale bar: (B) 100 µm.

DOI: http://dx.doi.org/10.7554/eLife.03848.004

The first and second heart fields diverge early in gastrulating mesoderm.

(A) Genetic lineage tracing of Mesp1;ROSAR26R mice reveals widespread labeling of mesodermal derivatives at E10.5, including forelimb (dotted outline). (B) Schematic of experimental protocol. Single cells are labeled early in gastrulating mesoderm and progeny of labeled cells observed later in development. (C) Example of clonal labeling in E9.5 embryo. Four distinct, scattered, clusters of labeled cells are present throughout trunk and neck, including a single yellow clone in ventricle (1, arrowhead). (D) Ventral view of a second heart field progenitor clone (red and green twin spots) with an additional yellow clone in the septal region (embryo ID MM2). (E) Whole mount view revealing an absence of non-cardiac clones elsewhere in the same embryo. (F) Ventral view of left ventricle clone (embryo ID MM15). Red and green twin spots are adjacent to each other. (G) Section through red-boxed area of embryo MM15 showing intermingling of red and green twin spots. (H) Ventral view of large, yellow septal clone (embryo ID MM34). (I) Whole-mount ventral view of red and green twin-spots in right ventricle (embryo ID MM27). Boxed regions indicate areas shown in higher magnification sections. (J) Section through clone in embryo MM27 reveals green labeled cardiomyocyte (asterisk) and red endocardial twin spot (arrows). Note overlap of red clonal labeling with blue PECAM staining. (K) Additional section through clone in embryo MM27. Green twin spot contributes to both cardiomyocytes (asterisk) as well as PECAM stained endocardial cells (arrows). (L) Whole-mount ventral view and (M) section of heart at E14.5 with a left ventricle-atria clone (embryo ID MM26). Note red and green twin spots (in LV and RA) in whole-mount view. Sectioning reveals a subset of the green twin spot has remained in the top of the left ventricle (asterisk). (N) Whole-mount ventral view of red and green twin spots in out-flow tract from embryo MM24. (O) Section through outflow-tract region reveals red twin spot contributing predominantly to pulmonary artery. Green twin spot contributes to both pulmonary artery and aorta. In addition, green twin spot appears to contribute to both endothelial lining of aorta (arrows) as well as cardiomyocytes (asterisk) at base of aorta. In (G, J–K) white: DAPI stained nuclei. In (J–K) blue: PECAM stained endothelial cells. In (M and O) blue: phalloidin stained actin. A, anterior; LA, left atrium; LV, left ventricle; OFT, out-flow tract; P, posterior; RA, right atrium; RV, right ventricle. Scale bars: (G and J–K), 100 µm (D, F, H, I, L, N), 200 µm. DOI: http://dx.doi.org/10.7554/eLife.03848.003

Overview of MADM clonal analysis and twin spot labeling.

(A) Prior to expression of Cre-recombinase, GFP and Tomato fluorophores are inactive. Interchromosomal recombination is induced by Cre recominase, thus restoring activity of GFP and Tomato. Recombination occurring in post-mitotic cells (G0) or in G1 phase of cell cycle generates red and green positive (yellow) cells. Recombination occurring after DNA replication (G2 phase of cell cycle) generates daughter cells that are uniquely labeled. So-called X-segregation generates daughter cells that are Red and Green and Z-segregation generates daughter cells that are colorless or yellow. (B) In situ hybridization for Cre mRNA in a Mesp1 embryo at the late head fold stage (LHF). Note expression in allantois (asterisk) as well as the allantoic membrane (arrowheads). Expression in the area of the forming cardiogenic mesoderm (dotted circle) is largely absent. (C) The total number of Mesp1-derived cells was empirically determined by FACS analysis. Five independent Mesp1; Rosa embryos at E7.5 were collected, dissociated, and stained for cardiac-Troponin (cTNT) and DAPI. The total number of cells as well as TdTomato and cTNT positive cells were counted and plotted. On average, 1/3 of the total number of cells are Mesp1-derived. No cTNT positive cells were seen at this time point. (D–E) Counting the number of labeled clones at two different developmental time-points (E8.5 and E14.5) reveals a similar distribution of labeling frequency. A stable distribution of clonal labeling between the early and late time points argues against loss of twin spots over time due to apoptosis or ectopic induction after the initial Mesp1 induced clonal labeling. (F) Ventral view of heart with no clones (embryo ID MM21). (G) Lung and attached esophagus from same specimen with clones in mesenchyme surrounding esophagus and trachea (arrow) in mesenchyme of lung parenchyma (arrowhead). E, esophagus; LA, left atrium; LV, left ventricle; OFT, out-flow tract; RA, right atrium; RV, right ventricle. Scale bar: (B) 100 µm. DOI: http://dx.doi.org/10.7554/eLife.03848.004

Epiblast-specific induction of MADM clones.

(A–B) The epiblast-specific Cre line, Sox2::Cre, is active in epiblast cells at E6.5 with little or no activity in extraembryonic tissues when passed through the male germline. Crossing male Cre-containing mice with ROSAAi14 results in broad reporter activity throughout the embryo proper at E10.5. (C–D) Left lateral views of E9.5 embryos of the indicated genotype reveals many yellow clones through the embryo, including the heart (asterisk) (E–G) Ventral view of isolated heart from an epiblast-induced MADM clone. A large, dispersed, yellow clone consisting of ∼75–100 cells extends from the OFT through the RV into the LV. Because of the dispersive nature and single color labeling of this particular example, it is unclear if this represents a single recombination event or multiple events. LV, left ventricle; OFT, outflow tract; RV, right ventricle. DOI: http://dx.doi.org/10.7554/eLife.03848.005

Additional examples of early cardiac progenitor clones.

(A) Dorsal view of left ventricle progenitor clone in embryo MM15 with both twin spots in the left ventricle. (B) Dorsal view of heart from embryo MM35. Note red twin spot in left ventricle and corresponding green twin spot in right atrium. (C) Dorsal view of heart from embryo MM36. Note red and green twin spots in right ventricle. Additional green labeling is present in the right atrium. (D) Ventral view of heart from embryo MM11 reveals red and green twin spots within the right ventricle. Because multiple twin spots are adjacent to one another, it is unclear if clones represent a single progenitor labeling event or more than one progenitor labeling events. (E) Ventral view of heart from MM3 showing an isolated yellow clone in ventral part of outflow-tract. (F) Ventral view of heart from MM4 showing red and green twin spots on outflow-tract. (G–H) Ventral views of hearts from MM38 (G) and MM6 (H) show red a green twin spots in left and right atria. (I) Ventral view of heart from MM1. Two separate clones are seen in this particular example. The first clone is clearly identifiable as an out flow tract clone and consists of a band of green cells around the ventral part of the outflow-tract and a red twin spot (not shown) on dorsal surface of outflow-tract. In addition, a large yellow clone is seen in the left atrium. (J) Ventral view of right ventricle clone (embryo ID MM9). Red and green twin spots are adjacent to each other. (K) Section through red-boxed area of embryo MM9 reveals red labeled cardiomyocytes (asterisks) and green labeled endocardial cells arrows). In (K) blue: phalloidin stained actin. (L) Section through right ventricle of embryo MM33. A single green twin spot is present within the right ventricle (stained with GFP). Endothelial cells have been labeled with anti-PECAM (red) and cardiomyoctes have been labeled with anti-tropomyosin (blue). Note that cells from this twin spot contribute to both PECAM-positive endocardial cells (arrows) as well as tropomyosin positive cardiomyocytes (asterisks). LA, left atrium; LV, left ventricle; OFT, out-flow tract; RA, right atrium; RV, right ventricle. DOI: http://dx.doi.org/10.7554/eLife.03848.006 In order to ensure an accurate description of clone locations throughout the embryo, a thorough external examination of embryos was performed followed by removal and, in many instances, immunostaining of dissected hearts for labeled twin spots. Coherent clusters of uniquely colored cells separated by > 100 µm were classified as a twin spot derived from a single labeling event. Because the majority of hearts (32 of 38 embryos) contained three or fewer uniquely colored clusters, determining lineage relationships between and among clusters was straightforward. A subset of clones uniquely label the heart (Figure 1D–E and Figure 2), demonstrating the existence of an early, cardiac-specific progenitor. We also found specimens with clones of cells in other mesodermal derivatives but with no apparent clones within the heart (Figure 1—figure supplement 1F–G and Figure 2), conclusively demonstrating that within the population of Mesp1+ mesoderm a dedicated population of cardiac progenitors exists.
Figure 2.

Complete description of all Mesp1-MADM clones examined.

All observed clones are detailed here, including cardiac as well as extra-cardiac clones. An exhaustive description of extra-cardiac clones is beyond the scope of the current study and thus only a simple description of the tissue or organ containing a labeled clone is included. Red triangles correspond to red twin spots, green triangles correspond to green twin spots, and yellow triangles correspond to yellow twin spots.

DOI: http://dx.doi.org/10.7554/eLife.03848.007

Complete description of all Mesp1-MADM clones examined.

All observed clones are detailed here, including cardiac as well as extra-cardiac clones. An exhaustive description of extra-cardiac clones is beyond the scope of the current study and thus only a simple description of the tissue or organ containing a labeled clone is included. Red triangles correspond to red twin spots, green triangles correspond to green twin spots, and yellow triangles correspond to yellow twin spots. DOI: http://dx.doi.org/10.7554/eLife.03848.007 To determine if these early cardiac progenitors represent a common precursor for the two heart fields, we analyzed the anatomic distribution of Mesp1-MADM twin spot clones within the heart. In contrast to previous retrospective clonal analysis (Meilhac et al., 2004b), we did not observe twin spots that populated anatomic structures classically thought to derive from first and second heart field progenitors, for example spanning the left and right ventricles, or contributing to the left ventricle and outflow tract. Rather, we saw twin spots that populated discreet anatomic locations including the left ventricle (Figure 1F–G and Figure 1—figure supplement 3A–B), right ventricle (Figure 1D and Figure 1—figure supplement 3C–D), outflow tract (Figure 1N–O and Figure 1—figure supplement 3E–F), atria-left ventricle (Figure 1L–M), and interventricular septum (Figure 1H). Notably absent from our clonal analysis were twin spots that spanned the right and left ventricles. Based on the total number of clonal observations made (n = 96), the probability that a common progenitor for the left and right ventricles does not exist, assuming a binomial distribution (success, or 1, = the progenitor is observed; failure, or 0 = the progenitor is not observed), can be calculated using Jeffreys interval. The upper and lower limits of a 95% confidence interval was calculated such that the upper limit is 0.019 (See Statistical Methods). Thus, we can be quite confident given the number of observations made that such a common progenitor does not exist within the Mesp1+ population. An explanation for the discrepancy between our Mesp1-MADM clonal analysis and prior retrospective clonal analyses lies with the timing of the labeling events. Mesp1 is transiently expressed ((Saga et al., 1999) and Figure 1—figure supplement 1B), thus all of our clones are induced over a narrow window of time during gastrulation. The retrospective clonal analysis employed a cardiomyocyte-specific promoter, so an early labeling event (in the epiblast for example) that would contribute broadly throughout the embryo would only be visualized in the heart, giving the impression of a specific common progenitor cell. Indeed, when we perform MADM clonal analysis using the epiblast-specific Cre line Sox2::Cre, we see many clones in the embryos, including large, dispersed clones throughout the looping heart tube (Figure 1—figure supplement 2) that could be interpreted as a labeling event in a single, common cardiac progenitor. We cannot definitively conclude, however, that these labeled cells within the heart are all clonally related because of the large number of labeling events outside of the heart. In summary, our results suggest that soon after a heart field progenitor is specified, shortly after the initiation of gastrulation, the anatomic destiny of daughter cells quickly diverge, especially those destined to occupy /contribute to the left or right ventricle, and these fates remain fixed.
Figure 1—figure supplement 3.

Additional examples of early cardiac progenitor clones.

(A) Dorsal view of left ventricle progenitor clone in embryo MM15 with both twin spots in the left ventricle. (B) Dorsal view of heart from embryo MM35. Note red twin spot in left ventricle and corresponding green twin spot in right atrium. (C) Dorsal view of heart from embryo MM36. Note red and green twin spots in right ventricle. Additional green labeling is present in the right atrium. (D) Ventral view of heart from embryo MM11 reveals red and green twin spots within the right ventricle. Because multiple twin spots are adjacent to one another, it is unclear if clones represent a single progenitor labeling event or more than one progenitor labeling events. (E) Ventral view of heart from MM3 showing an isolated yellow clone in ventral part of outflow-tract. (F) Ventral view of heart from MM4 showing red and green twin spots on outflow-tract. (G–H) Ventral views of hearts from MM38 (G) and MM6 (H) show red a green twin spots in left and right atria. (I) Ventral view of heart from MM1. Two separate clones are seen in this particular example. The first clone is clearly identifiable as an out flow tract clone and consists of a band of green cells around the ventral part of the outflow-tract and a red twin spot (not shown) on dorsal surface of outflow-tract. In addition, a large yellow clone is seen in the left atrium. (J) Ventral view of right ventricle clone (embryo ID MM9). Red and green twin spots are adjacent to each other. (K) Section through red-boxed area of embryo MM9 reveals red labeled cardiomyocytes (asterisks) and green labeled endocardial cells arrows). In (K) blue: phalloidin stained actin. (L) Section through right ventricle of embryo MM33. A single green twin spot is present within the right ventricle (stained with GFP). Endothelial cells have been labeled with anti-PECAM (red) and cardiomyoctes have been labeled with anti-tropomyosin (blue). Note that cells from this twin spot contribute to both PECAM-positive endocardial cells (arrows) as well as tropomyosin positive cardiomyocytes (asterisks). LA, left atrium; LV, left ventricle; OFT, out-flow tract; RA, right atrium; RV, right ventricle.

DOI: http://dx.doi.org/10.7554/eLife.03848.006

Figure 1—figure supplement 2.

Epiblast-specific induction of MADM clones.

(A–B) The epiblast-specific Cre line, Sox2::Cre, is active in epiblast cells at E6.5 with little or no activity in extraembryonic tissues when passed through the male germline. Crossing male Cre-containing mice with ROSAAi14 results in broad reporter activity throughout the embryo proper at E10.5. (C–D) Left lateral views of E9.5 embryos of the indicated genotype reveals many yellow clones through the embryo, including the heart (asterisk) (E–G) Ventral view of isolated heart from an epiblast-induced MADM clone. A large, dispersed, yellow clone consisting of ∼75–100 cells extends from the OFT through the RV into the LV. Because of the dispersive nature and single color labeling of this particular example, it is unclear if this represents a single recombination event or multiple events. LV, left ventricle; OFT, outflow tract; RV, right ventricle.

DOI: http://dx.doi.org/10.7554/eLife.03848.005

In analyzing the cellular composition of Mesp1-MADM clones, we noticed that while most twin spots give rise to homogenous cellular progeny (cardiomyocytes or endothelial cells), individual cardiac progenitors (<5%, see Figure 2) can contribute to multiple cell types, for example myocardium and endocardium (Figure 1J–K and Figure 1—figure supplement 3J–L), or endothelium and smooth muscle (Figure 1O). While a multipotent progenitor had been predicted from in vitro ES cell-based differentiation models (Wu et al., 2006; Moretti et al., 2006) this is the first evidence of the existence of such a multipotent progenitor in vivo. The existence of a dedicated population of cardiac progenitors within gastrulating mesoderm suggests that these cells may have a unique molecular signature. To define the order and timing of early cardiac gene expression in vivo, we examined by in situ hybridization and by ß-galactosidase reporter activity early markers of cardiac differentiation (Mef2c, Tbx5, Isl1, Mesp1, and Smarcd3) at the late streak (LS) and early head fold (EHF) stages. We find that Smarcd3 expression precedes Isl1 and Tbx5 in a domain that lies at the anterior-proximal region of the embryo and extends into the extraembryonic tissues (Figure 3B,D–E). This expression domain appears coincident temporally but non-overlapping with Mesp1 expression (Figure 3A–B and Figure 3—figure supplement 1), but is within the Mesp1-derived lineage (Figure 4O–P). Activity of the Mef2cAHF enhancer (Verzi et al., 2005) is also detected at the LS stage (Figure 3C) prior to the expression of Tbx5 and Isl1. Previous studies have shown that activity of this enhancer is dependent on Isl1 (Dodou et al., 2004). In order to confirm an absence of Isl1 expression at the LS stage, we used a reporter allele where a nuclear lacZ (Isl1) has replaced a short segment of the coding sequence, including the endogenous start codon (Sun et al., 2007). While there was robust ß-galactosidase reporter activity at the cardiac crescent stage, no detectable staining was seen in LS stage embryos (Figure 3—figure supplement 2A–B), suggesting that initiation of Mef2cAHF enhancer expression precedes Isl1 expression and its initiation may be independent of Isl1. Several hours later (EHF stage), weak Isl1 and Tbx5 expression is detectable, Mef2cAHF activity remains, and Smarcd3 expression restricts to the embryo proper (Figure 3G–J). The VEGF-A receptor Flk1 labels multipotent progenitors that can differentiate into hematopoietic, endothelial, smooth muscle and cardiac lineages (Ishitobi et al., 2011; Kattman et al., 2006), thus we looked at co-localization of Mesp1, Flk1, and Smarcd3 in late streak embryos. While we find minimal overlap between Mesp1 and Flk1 and Mesp1 and a reporter of early Smarcd3 expression (Figure 3—figure supplement 1A,C–D), there is significant overlap of Flk1 with this same reporter of early Smarcd3 expression (see below) in late streak stage embryos. Taken together, we see an orderly progression of gene expression that follows the progressive commitment of nascent mesoderm, from early expression of Mesp1 to the intermediate expression of Smarcd3, Flk1, and the Mef2cAHF enhancer, and finally the later cardiac lineage-specific expression of Tbx5 and Isl1 (Figure 3K).
Figure 3.

Smarcd3 expression initiates in gastrulating mesoderm and precedes expression of Isl1 and Tbx5.

(A–B and D–E) In situ hybridization at late-streak (LS) stage for Mesp1, Smarcd3, Isl1, and Tbx5. (C) X-gal staining at late-streak stage for Mef2cAHF-lacZ. Smarcd3 mRNA is expressed anterior to Mesp1 mRNA in embryonic and extraembryonic tissues. Tbx5 and Isl1 are undetectable by in situ hybridization at this stage. Activity of the Mef2cAHF enhancer is detectable around the node (asterisk) and in the anterior embryonic tissues (white arrowheads). (F–G and I–J) In situ hybridization at early-head-fold (EHF) stage for Mesp1, Smarcd3, Isl1, and Tbx5. (H) X-gal staining at early-head-fold (EHF) stage for Mef2cAHF-lacZ enhancer. Isl1 and Tbx5 expression is now detectable (arrowheads). (K) Summary of gene expression. Mesp1 expression (blue) precedes all other genes. Flk1 (gray), Smarcd3 (red), and Mef2cAHF (yellow) expression follows, beginning at the mid-streak stage, in overlapping domains. Isl1 (orange) and Tbx5 (magenta) expression begins at the late-streak/early head fold stage and overlaps with the stripe of Smarcd3 expression. Mesp1 expression at this stage is restricted to a small domain at the posterior of the embryo. Scale bars: (A–J) (100 µm).

DOI: http://dx.doi.org/10.7554/eLife.03848.008

(A) In situ hybridization for Mesp1 mRNA and antibody staining for GFP in Flk1 LS stage embryo reveals minimal overlap between active expression of Mesp1 and Flk1. (B) Antibody staining for GFP and salmon-gal staining in Smarcd3-F1-lacZ; Flk1 late-streak stage embryo shows significant overlap between Flk1 and Smarcd3 expression. (C) In situ hybridization for Mesp1 mRNA and salmon-gal staining of Smarcd3-F1-lacZ in LS and EHF (D) stage embryos. Mesp1 mRNA is localized predominantly at the base of the forming allantois (asterisks) and is largely non-overlapping with Salmon-gal staining of Smarcd3-F1-lacZ. Scale bars: (A–D), 100 µm.

DOI: http://dx.doi.org/10.7554/eLife.03848.009

(A) X-gal staining of Isl1 late streak (LS) stage embryos reveals no detectable staining even after over-night incubation at 37°C in staining solution. (B) One day later at E7.75, X-gal staining is seen within the developing cardiac crescent.

DOI: http://dx.doi.org/10.7554/eLife.03848.010

Figure 3—figure supplement 1.

Additional characterization of Smarcd3-F1-LacZ expression.

(A) In situ hybridization for Mesp1 mRNA and antibody staining for GFP in Flk1 LS stage embryo reveals minimal overlap between active expression of Mesp1 and Flk1. (B) Antibody staining for GFP and salmon-gal staining in Smarcd3-F1-lacZ; Flk1 late-streak stage embryo shows significant overlap between Flk1 and Smarcd3 expression. (C) In situ hybridization for Mesp1 mRNA and salmon-gal staining of Smarcd3-F1-lacZ in LS and EHF (D) stage embryos. Mesp1 mRNA is localized predominantly at the base of the forming allantois (asterisks) and is largely non-overlapping with Salmon-gal staining of Smarcd3-F1-lacZ. Scale bars: (A–D), 100 µm.

DOI: http://dx.doi.org/10.7554/eLife.03848.009

Figure 4.

Identification of an early cardiac specific enhancer of Smarcd3.

(A) Genomic region upstream of Smarcd3 translational start site (black arrow). Grey boxes: regions of non-coding sequence conservation between human and mouse. Indicated regions were used to generate Smarcd3-F1-lacZ and Smarcd3-F6-nlacZ alleles. (B–C) Salmon-gal staining of Smarcd3-F1-lacZ allele (red) closely mimics endogenous expression of Smarcd3 mRNA (dark blue). (D) X-gal staining of Smarcd3-F6-nlacZ allele (light blue) labels a fraction of total Smarcd3 mRNA. (E–I) lateral and frontal views of salmon-gal stained Smarcd3-F1-LacZ embryos at (E) early head fold (EHF), (F–G) cardiac crescent, (H) E8.5, and (I) E9.5 stages. Note the staining in extraembryonic tissues at EHF and cardiac crescent stages (asterisks). Also note salmon-gal staining in lateral mesoderm of E8.5 and E9.5 embryos (arrowheads). (J–N) A single copy of the F6 enhancer along with Hsp68 minimal promoter and nls-LacZ coding sequence were targeted to the Hipp11 locus on chromosome 11 (see extended methods for details). Lateral and frontal views of X-gal stained Smarcd3-F6-Hsp68-nLacZ embryos at (J) early head fold (EHF), (K–L) cardiac crescent, (M) E8.5, and (N) E9.5 stages. Note absence of staining in extraembryonic tissues at EHF and cardiac crescent stages as well as restricted cardiac expression at E8.5 and E9.5 (arrowheads). (O) Lateral view of late streak stage Mesp1; ROSAmTmG; Smarcd3-F1-lacZ embryo showing partial overlap of Smarcd3 expression with the Mesp1-derived lineage. (P) Additional anterior view. Blue: DAPI stained nuclei, Green: GFP staining, Red: Beta-galactosidase. Scale bars: (B–D, E–G, J–L), 100 µm, (H and M), 100 µm, (I and N), 100 µm.

DOI: http://dx.doi.org/10.7554/eLife.03848.011

(A) A single copy of the F6 enhancer along with the Hsp68 minimal promoter and nLacZ coding sequence were targeted to the Hipp11 locus on chromosome 11 (see extended methods for details).

DOI: http://dx.doi.org/10.7554/eLife.03848.012

Figure 3—figure supplement 2.

Characterization of early Isl1nlacZ expression.

(A) X-gal staining of Isl1 late streak (LS) stage embryos reveals no detectable staining even after over-night incubation at 37°C in staining solution. (B) One day later at E7.75, X-gal staining is seen within the developing cardiac crescent.

DOI: http://dx.doi.org/10.7554/eLife.03848.010

Smarcd3 expression initiates in gastrulating mesoderm and precedes expression of Isl1 and Tbx5.

(A–B and D–E) In situ hybridization at late-streak (LS) stage for Mesp1, Smarcd3, Isl1, and Tbx5. (C) X-gal staining at late-streak stage for Mef2cAHF-lacZ. Smarcd3 mRNA is expressed anterior to Mesp1 mRNA in embryonic and extraembryonic tissues. Tbx5 and Isl1 are undetectable by in situ hybridization at this stage. Activity of the Mef2cAHF enhancer is detectable around the node (asterisk) and in the anterior embryonic tissues (white arrowheads). (F–G and I–J) In situ hybridization at early-head-fold (EHF) stage for Mesp1, Smarcd3, Isl1, and Tbx5. (H) X-gal staining at early-head-fold (EHF) stage for Mef2cAHF-lacZ enhancer. Isl1 and Tbx5 expression is now detectable (arrowheads). (K) Summary of gene expression. Mesp1 expression (blue) precedes all other genes. Flk1 (gray), Smarcd3 (red), and Mef2cAHF (yellow) expression follows, beginning at the mid-streak stage, in overlapping domains. Isl1 (orange) and Tbx5 (magenta) expression begins at the late-streak/early head fold stage and overlaps with the stripe of Smarcd3 expression. Mesp1 expression at this stage is restricted to a small domain at the posterior of the embryo. Scale bars: (A–J) (100 µm). DOI: http://dx.doi.org/10.7554/eLife.03848.008

Additional characterization of Smarcd3-F1-LacZ expression.

(A) In situ hybridization for Mesp1 mRNA and antibody staining for GFP in Flk1 LS stage embryo reveals minimal overlap between active expression of Mesp1 and Flk1. (B) Antibody staining for GFP and salmon-gal staining in Smarcd3-F1-lacZ; Flk1 late-streak stage embryo shows significant overlap between Flk1 and Smarcd3 expression. (C) In situ hybridization for Mesp1 mRNA and salmon-gal staining of Smarcd3-F1-lacZ in LS and EHF (D) stage embryos. Mesp1 mRNA is localized predominantly at the base of the forming allantois (asterisks) and is largely non-overlapping with Salmon-gal staining of Smarcd3-F1-lacZ. Scale bars: (A–D), 100 µm. DOI: http://dx.doi.org/10.7554/eLife.03848.009

Characterization of early Isl1nlacZ expression.

(A) X-gal staining of Isl1 late streak (LS) stage embryos reveals no detectable staining even after over-night incubation at 37°C in staining solution. (B) One day later at E7.75, X-gal staining is seen within the developing cardiac crescent. DOI: http://dx.doi.org/10.7554/eLife.03848.010 In comparing human and mouse sequences at the Smarcd3 locus, we identified several regions of conservation in noncoding sequences upstream of the Smarcd3 transcriptional start site. We tested an ∼9 kb genomic element we called Smarcd3-F1 in a transgenic mouse reporter assay and found that it was sufficient to recapitulate early endogenous Smarcd3 expression (Figure 4A–C). Expression was maintained in the cardiac crescent and looping heart at later stages of development (Figure 4E–I), however expression in extraembryonic tissues was noted. Given the broad expression domain of Smarcd3 mRNA and our Smarcd3-F1::lacZ reporter lines, we sought to define an enhancer fragment that might uniquely label early cardiac progenitors. Through deletion analysis of the 9 kb enhancer/promoter region (Smarcd3-F1), we defined an ∼2.5 kb genomic element (Smarcd3-F6) that is expressed only in the embryo proper, in a more restricted pattern than Smarcd3-F1 (Figure 4D and J–N and Figure 4—figure supplement 1).
Figure 4—figure supplement 1.

Generation of Smarcd3-F6nLacZ reporter mice.

(A) A single copy of the F6 enhancer along with the Hsp68 minimal promoter and nLacZ coding sequence were targeted to the Hipp11 locus on chromosome 11 (see extended methods for details).

DOI: http://dx.doi.org/10.7554/eLife.03848.012

Identification of an early cardiac specific enhancer of Smarcd3.

(A) Genomic region upstream of Smarcd3 translational start site (black arrow). Grey boxes: regions of non-coding sequence conservation between human and mouse. Indicated regions were used to generate Smarcd3-F1-lacZ and Smarcd3-F6-nlacZ alleles. (B–C) Salmon-gal staining of Smarcd3-F1-lacZ allele (red) closely mimics endogenous expression of Smarcd3 mRNA (dark blue). (D) X-gal staining of Smarcd3-F6-nlacZ allele (light blue) labels a fraction of total Smarcd3 mRNA. (E–I) lateral and frontal views of salmon-gal stained Smarcd3-F1-LacZ embryos at (E) early head fold (EHF), (F–G) cardiac crescent, (H) E8.5, and (I) E9.5 stages. Note the staining in extraembryonic tissues at EHF and cardiac crescent stages (asterisks). Also note salmon-gal staining in lateral mesoderm of E8.5 and E9.5 embryos (arrowheads). (J–N) A single copy of the F6 enhancer along with Hsp68 minimal promoter and nls-LacZ coding sequence were targeted to the Hipp11 locus on chromosome 11 (see extended methods for details). Lateral and frontal views of X-gal stained Smarcd3-F6-Hsp68-nLacZ embryos at (J) early head fold (EHF), (K–L) cardiac crescent, (M) E8.5, and (N) E9.5 stages. Note absence of staining in extraembryonic tissues at EHF and cardiac crescent stages as well as restricted cardiac expression at E8.5 and E9.5 (arrowheads). (O) Lateral view of late streak stage Mesp1; ROSAmTmG; Smarcd3-F1-lacZ embryo showing partial overlap of Smarcd3 expression with the Mesp1-derived lineage. (P) Additional anterior view. Blue: DAPI stained nuclei, Green: GFP staining, Red: Beta-galactosidase. Scale bars: (B–D, E–G, J–L), 100 µm, (H and M), 100 µm, (I and N), 100 µm. DOI: http://dx.doi.org/10.7554/eLife.03848.011

Generation of Smarcd3-F6nLacZ reporter mice.

(A) A single copy of the F6 enhancer along with the Hsp68 minimal promoter and nLacZ coding sequence were targeted to the Hipp11 locus on chromosome 11 (see extended methods for details). DOI: http://dx.doi.org/10.7554/eLife.03848.012 Based on the temporal and spatial expression of Smarcd3, prior to expression of the canonical heart field markers Tbx5 and Isl1, and within a small subset of Mesp1-derived cells, we hypothesized that Smarcd3+ cells may represent cardiac precursors. To define the lineage potential of Smarcd3+ cells and to compare the lineage potential of the cell populations marked by our two enhancer elements, we performed temporally regulated genetic fate-mapping using mice expressing a tamoxifen inducible CreERT2 under control of the Smarcd3-F1 and Smarcd3-F6 sequences (Smarcd3-F1CreERT2 and Smarcd3-F6CreERT2 mice; Figure 5—figure supplement 1A–H). Lineage labeling of Smarcd3-F1CreERT2; Rosa at E5.5 and observation at E10.5 marked cells that contribute predominantly to the heart and anterior forelimb (Figure 5A–B), with scattered cells in the trunk and cranial mesoderm (Figure 5A and data not shown); observation at earlier time points revealed significant labeling in extraembryonic tissues (Figure 5—figure supplement 2A–C). Within the heart, labeled cells contribute to cardiomyocyte, endocardial, and pericardial layers (Figure 5C). Labeling one day earlier (E4.5) marks a similar distribution of cells but with reduced labeling (Figure 5—figure supplement 2D–F). Earlier induction (E3.5) and non-injected animals have minimal to no detectable labeling (Figure 5—figure supplement 2G–K and data not shown). Given the restricted expression pattern of the Smarcd-F6 enhancer, we hypothesized that marking these cells early on would label a more restricted population of cells later in the embryo. Indeed, lineage tracing with Smarcd3-F6CreERT2 labeled a much smaller number of more spatially defined cells, including the heart and a small group of cells in the anterior forelimb (Figure 5D–E). There was minimal to no labeling in head/trunk mesoderm or in extraembryonic tissues, and within the heart Smarcd3-F6CreERT2 labeled primarily the myocardial layer (Figure 5F and Figure 5—figure supplement 3A–C), consistent with this enhancer labeling a more restricted population of cells. We addressed the clonal potential of early Smarcd3+ cells with limiting doses of tamoxifen to induce small numbers of well-isolated labeled cells in Smarcd3-F1CreERT2;Rosa embryos (Figure 5G–H). The shape and distribution of the labeled patches is reminiscent of previous work describing the oriented clonal cell growth throughout the myocardium (Meilhac et al., 2004a). In order to confirm the clonal nature of these patches induced with our Smarcd3-F1CreERT2 allele, we attempted to perform MADM analysis with this particular allele. Unfortunately, the recombination frequency was too low to identify any clones in several litters of embryos and we proceeded with using the Rosa multicolor reporter (Snippert et al., 2010). We identified 6 Smarcd3-F1CreERT2;Rosa embryos from several litters where tamoxifen was administered at E5.5, which contained rare or infrequent labeling events; none of these examples showed a labeling pattern that would support a common progenitor contributing to both right and left ventricles. Instead, we saw isolated, single-color clones (Figure 5I and Figure 5—figure supplement 3D) that contributed to a single chamber. While the number of embryos we examined is not sufficient to reach statistical significance, the results are highly supportive of our conclusions from the Mesp1Cre-MADM analysis. We conclude that Smarcd3 expression in the late gastrulating embryo labels a defined population of specified cardiac precursors that are fated to occupy unique anatomic structures within the mature heart.
Figure 5—figure supplement 1.

Generation and characterization of Smarcd3-F1CreERT2 and Smarcd3-F6CreERT2 mice.

(A) Schematic of Smarcd3-F1CreERT2 construction. The Smarcd3-F1 enhancer/promoter was cloned upstream of the CreERT2 coding sequence. Flanking H19 insulator sequences were added to minimize position effects (see extended methods for details). (B–G) In situ hybridization for CreERT2 in Smarcd3-F1CreERT2 embryos at MS (B and E) LS (C and F) and EHF (D and G) stages reveals an identical pattern of expression to the Smarcd3-F1-lacZ allele and endogenous Smarcd3 early in development. (H) Schematic of Smarcd3-F6CreERT2 construction. A single copy of the F6 enhancer along with the Hsp68 minimal promoter and CreERT2 coding sequence were targeted to the Hipp11 locus on chromosome 11 (see extended methods for details).

DOI: http://dx.doi.org/10.7554/eLife.03848.014

Figure 5.

A Smarcd3 enhancer in the late gastrulating embryo labels a population of specified cardiac precursors.

(A) Smarcd3-F1+ cells labeled at E5.5 and observed at E10.5 contribute to the heart and anterior forelimb (arrows). In addition, scattered cells are observed in the trunk and neck (not shown). (B) Labeled cells are present in all chambers of the heart, including the RV, LV, OFT, and RA and LA (not shown). (C) Within the heart, labeled cells contribute to the pericardial layer as well as the cardiomyocte and endocardial cell layers. (D) Smarcd3-F6+ cells labeled at E6.5 and observed at E10.5 contribute to the heart and anterior forelimb. No additional labeling in the trunk or neck is observed. (E) Labeled cells are also present in all chambers of the heart. The number of labeled cells, however, appears reduced. (F) Within the heart, myocardial and pericardial (not shown) cells are labeled. (G–H) Limiting doses of tamoxifen administered to Smarcd3-F1CreERT2;Rosa embryos at E5.5 label scattered clusters of cells throughout the heart at E10.5. (I) Clonal analysis with the Smarcd3-F1CreERT2;Rosa line (E5.5 label, harvested at E10.5) shows that a single Smarcd3-F1+ progenitor can populate the left ventricle (YFP, arrow heads) or the left atrium (red fluorescent protein, asterisk). Scale bars: (A and D), 500 µm (B and E), 200 µm (I), 50 µm. en, endocardium; LV, left ventricle; LA, left atrium; m, myocardium; OFT, out flow tract; p, pericardium; RA, right atrium; RV, right ventricle.

DOI: http://dx.doi.org/10.7554/eLife.03848.013

(A) Schematic of Smarcd3-F1CreERT2 construction. The Smarcd3-F1 enhancer/promoter was cloned upstream of the CreERT2 coding sequence. Flanking H19 insulator sequences were added to minimize position effects (see extended methods for details). (B–G) In situ hybridization for CreERT2 in Smarcd3-F1CreERT2 embryos at MS (B and E) LS (C and F) and EHF (D and G) stages reveals an identical pattern of expression to the Smarcd3-F1-lacZ allele and endogenous Smarcd3 early in development. (H) Schematic of Smarcd3-F6CreERT2 construction. A single copy of the F6 enhancer along with the Hsp68 minimal promoter and CreERT2 coding sequence were targeted to the Hipp11 locus on chromosome 11 (see extended methods for details).

DOI: http://dx.doi.org/10.7554/eLife.03848.014

(A) Early labeling using Smarcd3-F1CreERT2 at E5.5 followed by observation at E7.5 reveals robust labeling within the cardiac crescent (arrows) as well as lateral plate mesoderm (arrowheads) and allantois (asterisk). (B) Observation one day later at E8.5 reveals a similar distribution of cells within the looping heart (asterisk) and lateral plate mesoderm (arrowheads). (C) At E9.5, labeled cells are present within the heart (asterisk) and scattered along the lateral plate mesoderm (arrowheads) and cranial mesoderm (asterisks). (D) Smarcd3-F1CreERT2 cells labeled at E4.5 and observed at E10.5 contribute to the heart and anterior forelimb (arrows). In addition, labeled cells within trunk and cranial mesoderm are present (asterisks). (E–F) Labeled cells are present in all chambers of the heart, including the RV, LV, OFT, and RA and LA (not shown) and contribute to the myocardium and pericardium. (G–H) Injection of tamoxifen into Smarcd3-F1CreERT2 animals at E3.5 and observation at E9.5 reveals no labeling in embryos. (I–K) Un-injected Smarcd3-F1CreERT2 animals have no labeled cells in the head, trunk, or limbs, and rare un-injected embryos have a few scattered cells in the heart (K, asterisks) at E13.5. A total of 16 mock injected embryos were examined and the embryo shown is an extreme example that represents the most labeling that we saw throughout the 16 mock-injected embryos. LA, left atrium; LV, left ventricle; m, myocardium; OFT, out-flow tract; p, pericardium; RA, right atrium; RV, right ventricle.

DOI: http://dx.doi.org/10.7554/eLife.03848.015

(A–C) Early labeling using Smarcd3-F6CreERT2 at E6.5 and observation at E10.5 reveals scattered cells (green) throughout the heart (red) without significant contribution to trunk or cranial mesoderm. (D) limiting doses of tamoxifen were used to induce small numbers of well-isolated labeled cells at E6.5 in Smarcd3-F1CreERT2;Rosa embryos. Hearts were observed at E10.5. Note isolated clones of YFP labeled cells adjacent to interventricular septum and top of left ventricle (asterisks). LA, left atrium; LV, left ventricle; m, myocardium; OFT, out-flow tract; p, pericardium; RA, right atrium; RV, right ventricle.

DOI: http://dx.doi.org/10.7554/eLife.03848.016

Figure 5—figure supplement 2.

Additional characterization of Smarcd3-F1CreERT2 mice.

(A) Early labeling using Smarcd3-F1CreERT2 at E5.5 followed by observation at E7.5 reveals robust labeling within the cardiac crescent (arrows) as well as lateral plate mesoderm (arrowheads) and allantois (asterisk). (B) Observation one day later at E8.5 reveals a similar distribution of cells within the looping heart (asterisk) and lateral plate mesoderm (arrowheads). (C) At E9.5, labeled cells are present within the heart (asterisk) and scattered along the lateral plate mesoderm (arrowheads) and cranial mesoderm (asterisks). (D) Smarcd3-F1CreERT2 cells labeled at E4.5 and observed at E10.5 contribute to the heart and anterior forelimb (arrows). In addition, labeled cells within trunk and cranial mesoderm are present (asterisks). (E–F) Labeled cells are present in all chambers of the heart, including the RV, LV, OFT, and RA and LA (not shown) and contribute to the myocardium and pericardium. (G–H) Injection of tamoxifen into Smarcd3-F1CreERT2 animals at E3.5 and observation at E9.5 reveals no labeling in embryos. (I–K) Un-injected Smarcd3-F1CreERT2 animals have no labeled cells in the head, trunk, or limbs, and rare un-injected embryos have a few scattered cells in the heart (K, asterisks) at E13.5. A total of 16 mock injected embryos were examined and the embryo shown is an extreme example that represents the most labeling that we saw throughout the 16 mock-injected embryos. LA, left atrium; LV, left ventricle; m, myocardium; OFT, out-flow tract; p, pericardium; RA, right atrium; RV, right ventricle.

DOI: http://dx.doi.org/10.7554/eLife.03848.015

Figure 5—figure supplement 3.

Additional characterization of Smarcd3-F6CreERT2 mice.

(A–C) Early labeling using Smarcd3-F6CreERT2 at E6.5 and observation at E10.5 reveals scattered cells (green) throughout the heart (red) without significant contribution to trunk or cranial mesoderm. (D) limiting doses of tamoxifen were used to induce small numbers of well-isolated labeled cells at E6.5 in Smarcd3-F1CreERT2;Rosa embryos. Hearts were observed at E10.5. Note isolated clones of YFP labeled cells adjacent to interventricular septum and top of left ventricle (asterisks). LA, left atrium; LV, left ventricle; m, myocardium; OFT, out-flow tract; p, pericardium; RA, right atrium; RV, right ventricle.

DOI: http://dx.doi.org/10.7554/eLife.03848.016

A Smarcd3 enhancer in the late gastrulating embryo labels a population of specified cardiac precursors.

(A) Smarcd3-F1+ cells labeled at E5.5 and observed at E10.5 contribute to the heart and anterior forelimb (arrows). In addition, scattered cells are observed in the trunk and neck (not shown). (B) Labeled cells are present in all chambers of the heart, including the RV, LV, OFT, and RA and LA (not shown). (C) Within the heart, labeled cells contribute to the pericardial layer as well as the cardiomyocte and endocardial cell layers. (D) Smarcd3-F6+ cells labeled at E6.5 and observed at E10.5 contribute to the heart and anterior forelimb. No additional labeling in the trunk or neck is observed. (E) Labeled cells are also present in all chambers of the heart. The number of labeled cells, however, appears reduced. (F) Within the heart, myocardial and pericardial (not shown) cells are labeled. (G–H) Limiting doses of tamoxifen administered to Smarcd3-F1CreERT2;Rosa embryos at E5.5 label scattered clusters of cells throughout the heart at E10.5. (I) Clonal analysis with the Smarcd3-F1CreERT2;Rosa line (E5.5 label, harvested at E10.5) shows that a single Smarcd3-F1+ progenitor can populate the left ventricle (YFP, arrow heads) or the left atrium (red fluorescent protein, asterisk). Scale bars: (A and D), 500 µm (B and E), 200 µm (I), 50 µm. en, endocardium; LV, left ventricle; LA, left atrium; m, myocardium; OFT, out flow tract; p, pericardium; RA, right atrium; RV, right ventricle. DOI: http://dx.doi.org/10.7554/eLife.03848.013

Generation and characterization of Smarcd3-F1CreERT2 and Smarcd3-F6CreERT2 mice.

(A) Schematic of Smarcd3-F1CreERT2 construction. The Smarcd3-F1 enhancer/promoter was cloned upstream of the CreERT2 coding sequence. Flanking H19 insulator sequences were added to minimize position effects (see extended methods for details). (B–G) In situ hybridization for CreERT2 in Smarcd3-F1CreERT2 embryos at MS (B and E) LS (C and F) and EHF (D and G) stages reveals an identical pattern of expression to the Smarcd3-F1-lacZ allele and endogenous Smarcd3 early in development. (H) Schematic of Smarcd3-F6CreERT2 construction. A single copy of the F6 enhancer along with the Hsp68 minimal promoter and CreERT2 coding sequence were targeted to the Hipp11 locus on chromosome 11 (see extended methods for details). DOI: http://dx.doi.org/10.7554/eLife.03848.014

Additional characterization of Smarcd3-F1CreERT2 mice.

(A) Early labeling using Smarcd3-F1CreERT2 at E5.5 followed by observation at E7.5 reveals robust labeling within the cardiac crescent (arrows) as well as lateral plate mesoderm (arrowheads) and allantois (asterisk). (B) Observation one day later at E8.5 reveals a similar distribution of cells within the looping heart (asterisk) and lateral plate mesoderm (arrowheads). (C) At E9.5, labeled cells are present within the heart (asterisk) and scattered along the lateral plate mesoderm (arrowheads) and cranial mesoderm (asterisks). (D) Smarcd3-F1CreERT2 cells labeled at E4.5 and observed at E10.5 contribute to the heart and anterior forelimb (arrows). In addition, labeled cells within trunk and cranial mesoderm are present (asterisks). (E–F) Labeled cells are present in all chambers of the heart, including the RV, LV, OFT, and RA and LA (not shown) and contribute to the myocardium and pericardium. (G–H) Injection of tamoxifen into Smarcd3-F1CreERT2 animals at E3.5 and observation at E9.5 reveals no labeling in embryos. (I–K) Un-injected Smarcd3-F1CreERT2 animals have no labeled cells in the head, trunk, or limbs, and rare un-injected embryos have a few scattered cells in the heart (K, asterisks) at E13.5. A total of 16 mock injected embryos were examined and the embryo shown is an extreme example that represents the most labeling that we saw throughout the 16 mock-injected embryos. LA, left atrium; LV, left ventricle; m, myocardium; OFT, out-flow tract; p, pericardium; RA, right atrium; RV, right ventricle. DOI: http://dx.doi.org/10.7554/eLife.03848.015

Additional characterization of Smarcd3-F6CreERT2 mice.

(A–C) Early labeling using Smarcd3-F6CreERT2 at E6.5 and observation at E10.5 reveals scattered cells (green) throughout the heart (red) without significant contribution to trunk or cranial mesoderm. (D) limiting doses of tamoxifen were used to induce small numbers of well-isolated labeled cells at E6.5 in Smarcd3-F1CreERT2;Rosa embryos. Hearts were observed at E10.5. Note isolated clones of YFP labeled cells adjacent to interventricular septum and top of left ventricle (asterisks). LA, left atrium; LV, left ventricle; m, myocardium; OFT, out-flow tract; p, pericardium; RA, right atrium; RV, right ventricle. DOI: http://dx.doi.org/10.7554/eLife.03848.016 Given the restricted expression and lineage potential of cells marked by the Smarcd3-F6 enhancer, we sought to characterize the global molecular signature that uniquely identifies this population. We generated a mouse ES cell line with a targeted insertion of the Smarcd3-F6 enhancer driving expression of a fluorescent reporter and we differentiated these cells into cardiomyocytes using an established directed differentiation protocol (Figure 6A and Figure 6—figure supplement 1) (Wamstad et al., 2012). In this system, we find expression of Mesp1 is rapidly induced at early mesoderm stage (Day 3-Day 4) while expression of the cardiac precursor markers Nkx2-5 and Tbx5 initiate about a day later (Figure 6C). Expression of Smarcd3 as well as the Smarcd3-F6 reporter are detectable in ES cells and gradually decline until both are sharply induced at Day 4. At the same time, Mesp1 expression is rapidly downregulated (Figure 6B). As a result, Mesp1 and Smarcd3 mRNA are largely non-overlapping, temporally. We isolated total RNA from three biological replicates of sorted cells shortly after the initiation of reporter activity at the mesoderm stage (D4.75) and compared the gene expression profiles of GFP + to GFP- cells by RNA-seq (Figure 6D). GFP + cells expressed genes associated with early cardiovascular progenitors (e.g. Hand2, Gata4, and Meis1), while GFP- cells expressed genes associated with hematopoietic and other lineages. Among the GFP + population, we attempted to identify markers that were unique to either cardiomyocyte or endocardial progenitors. While cell type-specific markers for differentiated cells are well documented (eg. contractile proteins for cardiomyocytes vs Nfatc1 for endocardial cells) such markers are less well defined at the early stages when we are isolating mRNA. In addition, our differentiation protocol pushes cells towards a cardiomyocyte fate, thus we may not expect to see any endocardial cell markers. One gene of interest that appears to be depleted in our GFP + population/enriched in our GFP- population is Tal1/Scl. This gene had been implicated as a critical component of endocardial morphogenesis (Bussmann et al., 2007) and more recently has been shown to repress cardiomyogenesis in yolk sac vasculature and endocardium (Van Handel et al., 2012). A complete list of differentially expressed genes meeting a strict false discovery rate (FDR) of 0.02 (2%) is presented in Figure 6—Source data 1. Overall, these results indicate that cells labeled by the Smarcd3-F6 enhancer, both in vivo and in vitro, represent an early cardiac progenitor population.
Figure 6.

Smarcd3-F6 enhancer labels an early cardiac progenitor in differentiating ES cells.

(A) Schematic of cardiac differentiation protocol and representative images at indicated time points during differentiation of Smarcd3-F6nlsEGFP mESCs. (B) Time course of gene expression during cardiac differentiation. Low expression of Smarcd3 as well as GFP is detectable in ES cells. Expression decreases over the course of the differential protocol but is rapidly induced shortly after day 4. (C) Expression of Mesp1 peaks between day 3-day 4 of the differentiation protocol. Expression of Nkx2-5 and Tbx5 begins later at day 5. Values shown are the mean plus SEM for 4 independent experiments, each performed in triplicate (D) Heatmap showing differential gene expression in GFP + compared to GFP- sorted cells. Many genes involved in cardiac progenitor development are enriched in the GFP + population. Markers of primitive mesoderm and of hematopoietic and other cell lineage development are enriched in the GFP- population. Values are log2 fold change and are clipped at 1.2. Analysis is based on three biological replicates. Yellow = higher in GFP positive population, blue = higher in GFP negative population.

DOI: http://dx.doi.org/10.7554/eLife.03848.017

A mouse ESC line with the Smarcd3-F6 reporter was differentiated toward the cardiac lineage (see methods for complete details). 18 hours after replating, GFP + cells were sorted from GFP- cells. Total RNA was extracted and analyzed by RNA-sequencing. Following bioinformatics analysis (see methods) a list of differentially expressed transcripts meeting a strict FDR of 0.02 was selected. This list of transcripts was used to generate the heatmap in Figure 3K.

DOI: http://dx.doi.org/10.7554/eLife.03848.018

(A) Schematic of Smarcd3-F6nlsEGFP mESC construction. The Smarcd3-F6 enhancer was cloned upstream of the Hsp68 minimal promoter and nlsEGFP coding sequences. The reporter construct was flanked by H19 insulator sequences. The entire construct was targeted to the Hipp11 locus on chromosome 11 and successfully targeted ESC clones were identified by PCR (not shown) and Southern blotting (B).

DOI: http://dx.doi.org/10.7554/eLife.03848.019

Figure 6—figure supplement 1.

Generation and characterization of Smarcd3-F6nlsEGFP mESC line.

(A) Schematic of Smarcd3-F6nlsEGFP mESC construction. The Smarcd3-F6 enhancer was cloned upstream of the Hsp68 minimal promoter and nlsEGFP coding sequences. The reporter construct was flanked by H19 insulator sequences. The entire construct was targeted to the Hipp11 locus on chromosome 11 and successfully targeted ESC clones were identified by PCR (not shown) and Southern blotting (B).

DOI: http://dx.doi.org/10.7554/eLife.03848.019

Smarcd3-F6 enhancer labels an early cardiac progenitor in differentiating ES cells.

(A) Schematic of cardiac differentiation protocol and representative images at indicated time points during differentiation of Smarcd3-F6nlsEGFP mESCs. (B) Time course of gene expression during cardiac differentiation. Low expression of Smarcd3 as well as GFP is detectable in ES cells. Expression decreases over the course of the differential protocol but is rapidly induced shortly after day 4. (C) Expression of Mesp1 peaks between day 3-day 4 of the differentiation protocol. Expression of Nkx2-5 and Tbx5 begins later at day 5. Values shown are the mean plus SEM for 4 independent experiments, each performed in triplicate (D) Heatmap showing differential gene expression in GFP + compared to GFP- sorted cells. Many genes involved in cardiac progenitor development are enriched in the GFP + population. Markers of primitive mesoderm and of hematopoietic and other cell lineage development are enriched in the GFP- population. Values are log2 fold change and are clipped at 1.2. Analysis is based on three biological replicates. Yellow = higher in GFP positive population, blue = higher in GFP negative population. DOI: http://dx.doi.org/10.7554/eLife.03848.017

Complete list of differentially expressed genes meeting strict FDR of 0.02.

A mouse ESC line with the Smarcd3-F6 reporter was differentiated toward the cardiac lineage (see methods for complete details). 18 hours after replating, GFP + cells were sorted from GFP- cells. Total RNA was extracted and analyzed by RNA-sequencing. Following bioinformatics analysis (see methods) a list of differentially expressed transcripts meeting a strict FDR of 0.02 was selected. This list of transcripts was used to generate the heatmap in Figure 3K. DOI: http://dx.doi.org/10.7554/eLife.03848.018

Generation and characterization of Smarcd3-F6nlsEGFP mESC line.

(A) Schematic of Smarcd3-F6nlsEGFP mESC construction. The Smarcd3-F6 enhancer was cloned upstream of the Hsp68 minimal promoter and nlsEGFP coding sequences. The reporter construct was flanked by H19 insulator sequences. The entire construct was targeted to the Hipp11 locus on chromosome 11 and successfully targeted ESC clones were identified by PCR (not shown) and Southern blotting (B). DOI: http://dx.doi.org/10.7554/eLife.03848.019 One class of clones identified in our Mesp1-MADM clonal analysis included twin spots within the interventricular septum (IVS) between the left and right ventricles (Figure 7A–D and Figure 2). These twin spots formed a sharp boundary within the IVS, reminiscent of compartment boundaries classically defined in the Drosophila wing imaginal disc and mammalian midbrain-hindbrain boundary (Lawrence and Struhl, 1996; Dahmann and Basler, 1999). To determine if and when this boundary between the right ventricle and left ventricle is established, we performed temporally regulated genetic fate-mapping to mark early cardiac progenitors and followed their contribution later in the mature IVS. In order to mark cells that would contribute to the right ventricle, we used the Mef2c-AHF enhancer (Verzi et al., 2005) to drive expression of a fusion of the Dre recombinase (Anastassiadis et al., 2009) to the tamoxifen inducible ERT2 protein (Mef2cAHF). We found that this enhancer element is expressed very early in the embryo, in a domain that appeared to partially overlap with that of Smarcd3 (Figure 3C,H). Previous work using a constitutive Cre recombinase expressed under the control of the Mef2cAHF enhancer suggested that endothelial and myocardial components of the outflow tract, right ventricle, and IVS are derived from this population (Verzi et al., 2005). To label the complementary population of progenitors that contribute predominantly to the left ventricle, we targeted a tamoxifen inducible Cre recombinase to the Tbx5 locus (Tbx5) (Figure 7—figure supplement 1A–B). In the looped heart, expression of Tbx5 is restricted to the left ventricle and atria with very little expression in the right ventricle or outflow tract (Bruneau et al., 1999). Early labeling of Tbx5+ cells marked cells that were predominantly restricted to the left ventricle and atria (Figure 7E–F and 7I–L); scattered surface labeling on the right ventricle (Figure 7—figure supplement 1I–J) was also seen with early tamoxifen injection, but myocardial labeling was limited to the LV up to the junction with the RV at the IVS. Earlier observation at E8.5 following a pulse of tamoxifen at E6.5 revealed labeling in a restricted population of cells within the presumptive left ventricle (Figure 7—figure supplement 2), suggesting that the Tbx5 lineage restriction arises early and is not a consequence of later sorting out of cells. Labeling Mef2cAHF + cells at E6.5 marked a complementary population of cells that were largely restricted to the right ventricle and outflow tract (Figure 7G–H and Figure 7—figure supplement 3A). Using an intersectional reporter that responds to the combined activity of Cre and Dre we confirmed that these early Mef2cAHF + cells are also within the Smarcd3-F1 lineage (Figure 7M and Figure 7—figure supplement 3B–C). The expression of Tbx5 and the Mef2AHF enhancer appears to label complementary populations that are established prior to morphogenesis, which correspond, in part, to left and right ventricular precursors, respectively.
Figure 7.

Early establishment of a boundary between the right and left ventricle at the interventricular septum.

(A) Ventral view of yellow septal clone (embryo ID MM8) with additional red and green twin-spots in outflow tract (arrow heads). (B) Section through heart reveals sharp septal boundary of clone (arrows) with an extension of cells at top of septum into RV (asterisk). (C) Ventral view of large septal clone (embryo ID MM25) originating from left ventricle. (D) Section through red-boxed area reveals large yellow clone (arrows) extending from apex of left ventricle towards the top of the interventricular septum. An additional clone of red cells (asterisks) is directly adjacent to the yellow clone. The green twin spot is located just medial to the red twin spot (arrowheads). All clones appear to be originating from the apex of the left ventricle. (E–F) Tbx5+ cells labeled at E6.5 and observed at E10.5 contribute to left ventricle and atria. (G–H) Mef2cAHF + cells labeled at E6.5 and observed at E10.5 contribute to specific anterior heart field structures, including the right ventricle and outflow tract. Note sharp boundary at future site of interventricular septum (IVS, asterisks). (I–J) Tbx5+ cells labeled at E7.5 and observed at E14.5 for mTmG. (K–L) Tbx5+ cells labeled at E6.5 and observed at E14.5 for R26R. A sharp boundary at IVS between the left and right ventricles is present following early labeling of Tbx5+ cells. (M) Smarcd3-F1/Mef2cAHF double positive cells were labeled at E6.5 and observed at E10.5 using the intersectional reporter, RosaAi66. Labeled cells contribute to right ventricle and outflow tract with a minor population of cells extending into the left ventricle. (N) Tbx5+ cells were labeled at E6.5 and their lineage followed using the Rosa Cre-reporter (green). Mef2cAHF + cells were also labeled at E6.5 and their lineage followed using the Rosa Dre-reporter (blue). Note largely non-overlapping Tbx5 and Mef2cAHF derived lineages in left and right ventricles, respectively, except perhaps a small area of overlap at the forming interventricular septum (asterisks). (O) Tbx5/Mef2cAHF double positive cells were labeled at E6.5 and observed at E10.5 using the intersectional reporter, Rosa. A narrow ring of labeled cells is present between the left and right ventricles. (P) Sections confirm a restricted population of labeled cells within the interventricular septum and superior aspect of the ventricular chamber (asterisk). Red, TdTomato; Green, Tropomyosin.

DOI: http://dx.doi.org/10.7554/eLife.03848.020

(A) Tbx5 targeting strategy. Top shows the wild-type (WT) allele of Tbx5: exons are indicated by roman numerals. Open boxes are untranslated regions, filled boxes are coding regions, and red box shows T-box encoding sequence. The targeting vector has a CreERT2-IRES-2X-FLAG inserted in frame with the endogenous Tbx5 coding region and a neomycin resistance cassette (neoR) flanked by frt sites (triangles) in the second intron. Flpase was used to remove the neoR cassette. (B) Southern analysis shows proper targeting of multiple independent ES cell lines. (C–N) Tbx5 mice were crossed to Rosa reporter mice. Cre activity was induced at the indicated timepoints by tamoxifen injection and analyzed at E14.5. (C–H) Early induction labeled few reporter cells in the retina of double transgenic embryos, however later induction robustly labeled cells within the retina. (I–N) Early induction robustly labeled cells in the left ventricle and atria of double transgenic embryos. In addition, scattered cells are noted on the surface of the right ventricle and outflow-tract (arrows). Induction after E8.5 (L–N) continued to label the left ventricle and atria as well as the trabeculae of the right ventricle (asterisks M–N). Surface labeling on the right ventricle was no longer present after induction at E8.5. LV, left ventricle; RV, right ventricle; IVS, interventricular septum.

DOI: http://dx.doi.org/10.7554/eLife.03848.021

(A–F) Tbx5 mice were crossed to Rosa reporter mice. Cre activity was induced at E6.5 and embryos were evaluated at E8.5. Early labeling marks a restricted population of cells that is predominantly localized to the presumptive left ventricle. A few scattered cells are noted on the surface of the forming right ventricle (asterisks, F). In situ hybridization for CreERT2 (G–H) or Tbx5 (I–J) along with salmon gal staining for lacZ in embryos labeled at E6.25 and analyzed at E8.25. Note significant overlap of salmon gal staining with CreERT2 and Tbx5 mRNA. A small domain of CreERT2 and Tbx5 mRNA expression at the caudal end of the sinus horns (asterisks) is not double labeled, consistent with the dynamic nature of Tbx5 expression.

DOI: http://dx.doi.org/10.7554/eLife.03848.022

(A) Mef2cAHF mice were crossed to Rosa reporter mice. Dre activity was induced at E6.5 and embryos were evaluated at E14.5. Early labeling marks a restricted population of cells that is predominantly localized to the right ventricle and outflow tract. A few scattered cells are noted extending into the left ventricle (asterisks, and data not shown). (B–C) Smarcd3-F1/Mef2cAHF double positive cells were labeled at E6.5 and observed at E14.5 using the intersectional reporter, RosaAi66. Labeled cells contribute to right ventricle and outflow tract. A sharp boundary is present within the interventricular septum at the apex of the heart (arrowheads), however a minor population of cells extend into the left side near the superior portion of the septum (asterisk). Note an absence of contribution to the cushion at the top of the interventricular septum (arrow). (D) Tbx5/Mef2cAHF double positive cells were labeled at E6.5 and observed at E12.5 using the intersectional reporter, Rosa. A narrow ring of labeled cells is present between the left and right ventricles. A few, scattered double positive cells also populate the left ventricular chamber (asterisk).

DOI: http://dx.doi.org/10.7554/eLife.03848.023

Figure 7—figure supplement 1.

Generation of a multi-use Tbx5 allele.

(A) Tbx5 targeting strategy. Top shows the wild-type (WT) allele of Tbx5: exons are indicated by roman numerals. Open boxes are untranslated regions, filled boxes are coding regions, and red box shows T-box encoding sequence. The targeting vector has a CreERT2-IRES-2X-FLAG inserted in frame with the endogenous Tbx5 coding region and a neomycin resistance cassette (neoR) flanked by frt sites (triangles) in the second intron. Flpase was used to remove the neoR cassette. (B) Southern analysis shows proper targeting of multiple independent ES cell lines. (C–N) Tbx5 mice were crossed to Rosa reporter mice. Cre activity was induced at the indicated timepoints by tamoxifen injection and analyzed at E14.5. (C–H) Early induction labeled few reporter cells in the retina of double transgenic embryos, however later induction robustly labeled cells within the retina. (I–N) Early induction robustly labeled cells in the left ventricle and atria of double transgenic embryos. In addition, scattered cells are noted on the surface of the right ventricle and outflow-tract (arrows). Induction after E8.5 (L–N) continued to label the left ventricle and atria as well as the trabeculae of the right ventricle (asterisks M–N). Surface labeling on the right ventricle was no longer present after induction at E8.5. LV, left ventricle; RV, right ventricle; IVS, interventricular septum.

DOI: http://dx.doi.org/10.7554/eLife.03848.021

Figure 7—figure supplement 2.

Early labeling of Tbx5CreERT2 lineage.

(A–F) Tbx5 mice were crossed to Rosa reporter mice. Cre activity was induced at E6.5 and embryos were evaluated at E8.5. Early labeling marks a restricted population of cells that is predominantly localized to the presumptive left ventricle. A few scattered cells are noted on the surface of the forming right ventricle (asterisks, F). In situ hybridization for CreERT2 (G–H) or Tbx5 (I–J) along with salmon gal staining for lacZ in embryos labeled at E6.25 and analyzed at E8.25. Note significant overlap of salmon gal staining with CreERT2 and Tbx5 mRNA. A small domain of CreERT2 and Tbx5 mRNA expression at the caudal end of the sinus horns (asterisks) is not double labeled, consistent with the dynamic nature of Tbx5 expression.

DOI: http://dx.doi.org/10.7554/eLife.03848.022

Figure 7—figure supplement 3.

Additional characterization of early Mef2cAHF and Tbx5 lineages.

(A) Mef2cAHF mice were crossed to Rosa reporter mice. Dre activity was induced at E6.5 and embryos were evaluated at E14.5. Early labeling marks a restricted population of cells that is predominantly localized to the right ventricle and outflow tract. A few scattered cells are noted extending into the left ventricle (asterisks, and data not shown). (B–C) Smarcd3-F1/Mef2cAHF double positive cells were labeled at E6.5 and observed at E14.5 using the intersectional reporter, RosaAi66. Labeled cells contribute to right ventricle and outflow tract. A sharp boundary is present within the interventricular septum at the apex of the heart (arrowheads), however a minor population of cells extend into the left side near the superior portion of the septum (asterisk). Note an absence of contribution to the cushion at the top of the interventricular septum (arrow). (D) Tbx5/Mef2cAHF double positive cells were labeled at E6.5 and observed at E12.5 using the intersectional reporter, Rosa. A narrow ring of labeled cells is present between the left and right ventricles. A few, scattered double positive cells also populate the left ventricular chamber (asterisk).

DOI: http://dx.doi.org/10.7554/eLife.03848.023

Early establishment of a boundary between the right and left ventricle at the interventricular septum.

(A) Ventral view of yellow septal clone (embryo ID MM8) with additional red and green twin-spots in outflow tract (arrow heads). (B) Section through heart reveals sharp septal boundary of clone (arrows) with an extension of cells at top of septum into RV (asterisk). (C) Ventral view of large septal clone (embryo ID MM25) originating from left ventricle. (D) Section through red-boxed area reveals large yellow clone (arrows) extending from apex of left ventricle towards the top of the interventricular septum. An additional clone of red cells (asterisks) is directly adjacent to the yellow clone. The green twin spot is located just medial to the red twin spot (arrowheads). All clones appear to be originating from the apex of the left ventricle. (E–F) Tbx5+ cells labeled at E6.5 and observed at E10.5 contribute to left ventricle and atria. (G–H) Mef2cAHF + cells labeled at E6.5 and observed at E10.5 contribute to specific anterior heart field structures, including the right ventricle and outflow tract. Note sharp boundary at future site of interventricular septum (IVS, asterisks). (I–J) Tbx5+ cells labeled at E7.5 and observed at E14.5 for mTmG. (K–L) Tbx5+ cells labeled at E6.5 and observed at E14.5 for R26R. A sharp boundary at IVS between the left and right ventricles is present following early labeling of Tbx5+ cells. (M) Smarcd3-F1/Mef2cAHF double positive cells were labeled at E6.5 and observed at E10.5 using the intersectional reporter, RosaAi66. Labeled cells contribute to right ventricle and outflow tract with a minor population of cells extending into the left ventricle. (N) Tbx5+ cells were labeled at E6.5 and their lineage followed using the Rosa Cre-reporter (green). Mef2cAHF + cells were also labeled at E6.5 and their lineage followed using the Rosa Dre-reporter (blue). Note largely non-overlapping Tbx5 and Mef2cAHF derived lineages in left and right ventricles, respectively, except perhaps a small area of overlap at the forming interventricular septum (asterisks). (O) Tbx5/Mef2cAHF double positive cells were labeled at E6.5 and observed at E10.5 using the intersectional reporter, Rosa. A narrow ring of labeled cells is present between the left and right ventricles. (P) Sections confirm a restricted population of labeled cells within the interventricular septum and superior aspect of the ventricular chamber (asterisk). Red, TdTomato; Green, Tropomyosin. DOI: http://dx.doi.org/10.7554/eLife.03848.020

Generation of a multi-use Tbx5 allele.

(A) Tbx5 targeting strategy. Top shows the wild-type (WT) allele of Tbx5: exons are indicated by roman numerals. Open boxes are untranslated regions, filled boxes are coding regions, and red box shows T-box encoding sequence. The targeting vector has a CreERT2-IRES-2X-FLAG inserted in frame with the endogenous Tbx5 coding region and a neomycin resistance cassette (neoR) flanked by frt sites (triangles) in the second intron. Flpase was used to remove the neoR cassette. (B) Southern analysis shows proper targeting of multiple independent ES cell lines. (C–N) Tbx5 mice were crossed to Rosa reporter mice. Cre activity was induced at the indicated timepoints by tamoxifen injection and analyzed at E14.5. (C–H) Early induction labeled few reporter cells in the retina of double transgenic embryos, however later induction robustly labeled cells within the retina. (I–N) Early induction robustly labeled cells in the left ventricle and atria of double transgenic embryos. In addition, scattered cells are noted on the surface of the right ventricle and outflow-tract (arrows). Induction after E8.5 (L–N) continued to label the left ventricle and atria as well as the trabeculae of the right ventricle (asterisks M–N). Surface labeling on the right ventricle was no longer present after induction at E8.5. LV, left ventricle; RV, right ventricle; IVS, interventricular septum. DOI: http://dx.doi.org/10.7554/eLife.03848.021

Early labeling of Tbx5CreERT2 lineage.

(A–F) Tbx5 mice were crossed to Rosa reporter mice. Cre activity was induced at E6.5 and embryos were evaluated at E8.5. Early labeling marks a restricted population of cells that is predominantly localized to the presumptive left ventricle. A few scattered cells are noted on the surface of the forming right ventricle (asterisks, F). In situ hybridization for CreERT2 (G–H) or Tbx5 (I–J) along with salmon gal staining for lacZ in embryos labeled at E6.25 and analyzed at E8.25. Note significant overlap of salmon gal staining with CreERT2 and Tbx5 mRNA. A small domain of CreERT2 and Tbx5 mRNA expression at the caudal end of the sinus horns (asterisks) is not double labeled, consistent with the dynamic nature of Tbx5 expression. DOI: http://dx.doi.org/10.7554/eLife.03848.022

Additional characterization of early Mef2cAHF and Tbx5 lineages.

(A) Mef2cAHF mice were crossed to Rosa reporter mice. Dre activity was induced at E6.5 and embryos were evaluated at E14.5. Early labeling marks a restricted population of cells that is predominantly localized to the right ventricle and outflow tract. A few scattered cells are noted extending into the left ventricle (asterisks, and data not shown). (B–C) Smarcd3-F1/Mef2cAHF double positive cells were labeled at E6.5 and observed at E14.5 using the intersectional reporter, RosaAi66. Labeled cells contribute to right ventricle and outflow tract. A sharp boundary is present within the interventricular septum at the apex of the heart (arrowheads), however a minor population of cells extend into the left side near the superior portion of the septum (asterisk). Note an absence of contribution to the cushion at the top of the interventricular septum (arrow). (D) Tbx5/Mef2cAHF double positive cells were labeled at E6.5 and observed at E12.5 using the intersectional reporter, Rosa. A narrow ring of labeled cells is present between the left and right ventricles. A few, scattered double positive cells also populate the left ventricular chamber (asterisk). DOI: http://dx.doi.org/10.7554/eLife.03848.023 Given the seemingly complementary lineage contributions of early Tbx5 and Mef2cAHF expressing progenitors to the mature heart, we sought to map their contributions and overlap within the interventricular septum. We performed simultaneously lineage tracing of Tbx5+ and Mef2cAHF + cells using separate reporters for Cre (Rosa) and Dre (Rosa) activity and found that the two populations of labeled cells appeared largely mutually exclusive, except perhaps a narrow stripe of cells at the border between the forming left and right ventricles (Figure 7N). We confirmed the existence of a small population of double positive cells early in development using the intersectional Cre/Dre reporter described previously. Labeling at E6.5 marked a small population of cells that would eventually go on to form a narrow ring of cells at the border between the left and right ventricles in the forming IVS (Figure 7O–P and Figure 7—figure supplement 3D). In summary, genetic lineage labeling of the earlyTbx5+ and Mef2cAHF + precursors along with our clonal analysis of early Mesp1+ progenitors that contribute to the IVS suggest that a compartment boundary between the future left and right ventricles is established early, prior to cardiac morphogenesis, and that early progenitors positive for both Tbx5 and Mef2cAHF will go on to contribute specifically to the forming IVS.

Discussion

The existence of a multipotent cardiac progenitor that can contribute to all anatomic and cellular components of the mature heart has been predicted, but the identity and origins of such a progenitor has remained undefined. Our findings, summarized in Figure 8, pinpoint the existence of specified cardiac precursors in gastrulating mesoderm, and also highlight an unanticipated early segregation of first and second heart field progenitors in their contribution to distinct chambers of the developing heart. Further, we define the orderly progression of gene expression that parallels the commitment of nascent mesoderm to a cardiovascular fate. In particular, the expression of Smarcd3 labels a population primarily comprised of the earliest specified precursors, which can be identified in vivo and in ES cell-derived differentiating cells.
Figure 8.

Summary of patterning and specification of early gastrulating mesoderm.

Clonal analysis reveals early patterning of gastrulating mesoderm including the segregation of cardiac vs non-cardiac mesoderm. Among cardiac mesoderm, progenitors for the two heart fields diverge soon after the initiation of gastrulation and rapidly become specified into discrete populations of committed precursors. Expression of Smarcd3 begins prior to that of other known markers of cardiac progenitors (Nkx2-5, Tbx5, and Isl1) and an enhancer of Smarcd3 (Smarcd3-F6) marks the earliest cardiac-specific progenitor population. Expression of the Mef2AHF enhancer and Tbx5 further subdivides this early population into first vs second heart field progenitors. Inducible genetic lineage tracing along with clonal analysis predicts the existence of a compartment boundary between the future left and right ventricles that is established prior to cardiac morphogenesis.

DOI: http://dx.doi.org/10.7554/eLife.03848.024

Summary of patterning and specification of early gastrulating mesoderm.

Clonal analysis reveals early patterning of gastrulating mesoderm including the segregation of cardiac vs non-cardiac mesoderm. Among cardiac mesoderm, progenitors for the two heart fields diverge soon after the initiation of gastrulation and rapidly become specified into discrete populations of committed precursors. Expression of Smarcd3 begins prior to that of other known markers of cardiac progenitors (Nkx2-5, Tbx5, and Isl1) and an enhancer of Smarcd3 (Smarcd3-F6) marks the earliest cardiac-specific progenitor population. Expression of the Mef2AHF enhancer and Tbx5 further subdivides this early population into first vs second heart field progenitors. Inducible genetic lineage tracing along with clonal analysis predicts the existence of a compartment boundary between the future left and right ventricles that is established prior to cardiac morphogenesis. DOI: http://dx.doi.org/10.7554/eLife.03848.024 Our results show that mesoderm is rapidly specified at or before E6.0 to E7.5 into discrete fates that anticipate anatomical localization. Retrospective lineage tracing using a cardiac marker suggested the existence of a precursor that could contribute to all chambers of the heart (Meilhac et al., 2004b). Our results, and those of Lescroart et al. (2014), suggest that such a precursor could only exist prior to gastrulation, likely in the epiblast or shortly thereafter, and that early mesoderm is rapidly patterned such that specific cells are shunted towards a unique path that assigns them to a specific cardiac compartment. Whether these mesodermal cells retain plasticity and could adopt different fates if transplanted elsewhere in the embryo is not clear. We also cannot at this point distinguish between a scenario where Mesp1+ cells are pre-patterned or the gradual restriction of Mesp1+ cells to different lineage fates during gastrulation in response to signaling cues. Understanding which molecular cues induce the emergence and patterning of this population of early cardiac precursors will be of considerable interest, particularly in the context of regenerative cell therapy, and especially given the apparent heterogeneity of early cardiac progenitors. The Smarcd3-expressing cardiac precursor population is already specified into separate populations that will contribute to the left ventricle and atria, as marked by Tbx5, and the right ventricle and outflow tract, as labeled by the Mef2cAHF enhancer. These results are consistent with genetic tracing of cardiac precursors expressing Hcn4, which contribute to the left ventricle and conduction system (Später et al., 2013), and we additionally show, at both a population and single cell level, that both left and right ventricular progenitors are independently established early in development and are separated by a compartment boundary. This compartment boundary is derived from a unique population of early progenitors that express Tbx5 as well as a subpopulation of cells co-expressing the Mef2cAHF enhancer, suggesting that a relatively small number of cells may be important in establishing and/or maintaining this border between the left and right ventricles. Understanding the molecular and cellular basis of this compartment boundary, and its importance in ventricular septation, will be of great relevance to congenital heart defects. This knowledge will also be relevant for disease modeling from stem cells, or for regenerative strategies, since knowing whether a progenitor cell is committed to become a right ventricular cardiomyocyte vs an atrial cardiomyocyte, for example, could be critical depending upon the anatomic or cellular defect one is attempting to correct. In organisms with a simpler heart, such as zebrafish or Ciona (Stolfi et al., 2010; Tolkin and Christiaen, 2012; Stainier et al., 1993; Keegan et al., 2004), there is also a very early specification of cardiac precursors. Indeed, fate mapping in the chick embryo suggests distinct origins of the outflow tract vs the remainder of the heart, but does not indicate a compartmentalization of left and right ventricular progenitors, nor what molecular identity early cardiac precursors adopt (Camp et al., 2012). Our data suggest that the mouse embryo, despite the complexity of its developing heart, has a very early patterning and allocation of mesodermal cells to specific cardiac fates and anatomical derivatives. In addition, it has been hypothesized that simpler organisms have integrated cardiac and pharyngeal mesoderm into a single lineage, the so-called cardiopharyngeal mesoderm (Stolfi et al., 2010). Retrospective clonal analysis in the mouse (Lescroart et al., 2010) suggests a conservation of shared cardiac and pharyngeal lineages; caveats applicable to chamber-specific lineage allocation, including the timing of clone induction and the promoter used to visualize clones, remain. Lescroart and colleagues more recently reported rare instances of Mesp1+ clones co-labeling head muscles and the heart (Lescroart et al., 2014). In our lineage labeling experiments, using the MADM system, we do not see convincing evidence for a common heart and head muscle progenitor. Additionally, Smarcd3+ precursors contribute to heart but not facial muscle. While our collective data do not support a common precursor for heart and facial muscle, we cannot definitively rule out a rare population of common progenitors. Having a well-defined understanding of the developmental origins of patterned organs is critical for the development of regenerative strategies, and for our understanding of the basis of congenital malformations. For the future development of cellular therapies, the knowledge that molecularly distinct populations of progenitors contribute to distinct anatomic regions of the heart will guide the selection of the most appropriate cellular and molecular signature. More broadly, our results suggest a rapid and precise patterning of progenitor populations during gastrulation.

Materials and methods

Mice

The Mesp1 knock-in mice (Saga et al., 1999) were obtained from Yumiko Saga. Mef2cAHF-lacZ mice (Dodou et al., 2004) were obtained from Brian Black. Isl1 knock-in mice (Sun et al., 2007) were obtained from Sylvia Evans. MADM11TG, MADM11GT/GT mice (Hippenmeyer et al., 2010), ROSAR26R mice (Soriano, 1999), ROSAmTmG mice (Muzumdar et al., 2007), ROSAAi66 mice (Allen Brain Institute strain B6;129S-Gt(ROSA)26Sortm66.1(CAG-tdTomato)Hze/J; JAX stock number 021876), Flk1 knock-in mice (Ema et al., 2006), and Sox2::Cre transgenic mice were obtained from Jackson Laboratory. ROSARoxlacZ mice (Anastassiadis et al., 2009) were generated from cryopreserved embryos purchased from MMRRC. Standard tamoxifen induction was done by injecting 3 mg/40 gram of body weight of tamoxifen dissolved in sesame oil intraperitoneally. Low dose tamoxifen induction was done by injecting 1/10th of this concentration (0.3 mg/40 gram body weight). Clonal analysis of Mesp1 mesodermal progenitors was performed by crossing Mesp1;MADM11TG/TG with MADM11GT/GT mice. Lineage analysis of Smarcd3 cardiac progenitors was performed by crossing Smarcd3-F1CreERT2 mice with ROSAR26R, ROSAmTmG, or ROSAConfetti mice followed by administration of tamoxifen (3 mg/40 grams of pregnant dam's body weight (Hayashi and McMahon, 2002) ) at E5.5 or E6.5. Lineage analysis of Mef2cAHF-expressing progenitors was performed by crossing ROSARox-lacZ and Mef2cAHFDreERT2 transgenic mice followed by administration of tamoxifen at E5.5 or E6.5. Lineage analysis of Tbx5-expressing progenitors was performed by crossing Tbx5 knock-in mice and ROSAR26R or ROSAmTmG mice followed by administration of tamoxifen at indicated times.

Cloning and generation of transgenic mice

The Smarcd3-F1 fragment spanned 8796bp upstream of the start codon of Smarcd3 (Chr5:24,107,677-24,116,473) and was cloned using bacterial recombineering from BAC bMQ133n21 into pENTR1A (Invitrogen, Carlsbad, CA). The pWHERE plasmid (InvivoGen) was digested using a blunt cutter (SmaI) and an RFA ‘C’ Gateway cassette (Invitrogen) was inserted 5′ to the promoterless nls-LacZ reporter gene to make a destination vector (pWHERE-DV). For construction of pWHERE-DV-CreERT2, a Gateway RFA ‘B’ cassette was amplified by PCR and cloned into the AvrII site of pWHERE using Cold Fusion cloning (System Biosciences Inc.). The resulting plasmid was digested with XhoI and NheI to remove the nls-LacZ reporter and a cassette encoding CreERT2 (Feil et al., 1997) was amplified and inserted using Cold Fusion Cloning. Construction of the Mef2cAHF allele will be described in detail elsewhere. Briefly, the CAGEN-DV plasmid (Devine and Bruneau, unpublished) was digested with SpeI and XbaI to remove the CAGGS (Chicken Beta-Actin promoter with CMV enhancer) promoter and the resulting ends blunted. The Mef2c-F6/frag3 plasmid (Dodou et al., 2004) was digested with XhoI and SalI to isolate the 3970 bp cardiac enhancer fragment. The resulting ends were blunted and the two blunt-ended fragments ligated together to make the destination vector (Mef2c-F6-DV). A Gateway compatible entry clone for DreERT2 was constructed by PCR stitching of Dre (minus the nls) from plasmid DNA containing a codon-improved version of Dre (a generous gift of Francis Stewart, Biotechnology Center TU, Dresden, Germany) and ERT2 (Feil et al., 1997) separated by a short linker se quence (Hunter et al., 2005) to generate DreERT2. Upon LR recombination with entry clones and destination reporter plasmids, the final vectors were restriction mapped and verified by DNA sequencing. Multiple founders were examined for each transgene. All experiments using mice were reviewed and approved by the UCSF Institutional Animal Care and Use Committee and complied with all institutional and federal guidelines. For construction of the Rosa fluorescent Dre-reporter allele, a nuclear localized mKateV5 (nlsmKateV5) followed by a rabbit globin polyA sequence was cloned between ROX recombination sites downstream of a CAGGS promoter. A Gateway RFA destination cassette (including a rabbit globin polyA sequence) was subsequently cloned downstream to make pCAGGS-nK-DV. A SacI-SalI fragment containing an FRT-pGK-FRT cassette from pK11 (plasmid courtesy of Gail Martin) was cloned downstream of the Gateway RFA-rabbit globin polyA sequence to make pCAGGS-nK-DV-FRT-pGK-FRT. A Gateway entry clone containing a membrane localized TagBFP-FLAG was inserted into pCAGGS-nK-DV-FRT-pGK-FRT using LR recombination. The entire construct was excised using AscI and PacI and cloned into Rosa26PAm1 (Addgene plasmid# 15,036) for targeting to the Rosa26 locus. The construct was linearized with SgfI and electroporated into E14 mouse ES cells. Drug resistant clones were screened by long range PCR using the following primers: Positive clones were subsequently screened by qPCR for single copy insertions of the pGK-Neo cassette. Following verification of correct targeting and karyotyping, two positive ES cell clones were expanded and injected into blastocysts for generation of mice. Chimeric founders were crossed to C57B6 lines to confirm germline transmission. The pGK-Neo cassette was eventually removed by breeding mice to ActFlpe expressing mice.

Cloning and generation of TARGATT transgenic knock-in mice

The Smarcd3-F6 fragment, including approximately 2.5 kb of the 5′ end of the Smarcd3-F1 promoter fragment was cloned by PCR into pENTR1A. Modified pWHERE-DV and pWHERE-DV-CreERT2 plasmids were generated by inserting an Hsp68 minimal promoter into the XhoI restriction site using Cold Fusion Cloning. Upon LR recombination with entry clones and destination reporter plasmids, the final vectors were restriction mapped and verified by DNA sequencing. For generating TARGATT constructs, the PacI fragment from the final construct was subcloned into a PacI digested pBT346.3 plasmid (Applied Stem Cells). DNA was purified and injected along with mRNA for the Phi31o transposase according to manufacturer's protocol.

Cloning and generation of Tbx5 knock-in mice

A 129 BAC clone (67H11, RPCI-22 mouse BAC library) containing the entire mouse Tbx5 locus was obtained from GeneService (UK). Briefly, the cDNA for CreERT2 (Feil et al., 1997), followed by an IRES element (BamHI to NcoI, from pIRES2-EGFP), a Kozak consensus sequence and a 2X FLAG epitope sequence in frame with the translational start of endogenous Tbx5 was inserted between the FspI and NcoI sites of exon 2 of Tbx5, upstream of the endogenous translation start site. At 40bp downstream of exon 2, cloning sites (NotI and AflII) were added and a PGK-EM7-Neo-polyA cassette, flanked by Frt sites (from PL451), was inserted for positive selection. The entire cassette, as well as 5 kb upstream of exon 2 (ClaI to FspI), and 6 kb downstream of exon 2 (40 bp downstream of exon 2 to BclI) were cloned into a modified pBS containing a 5′ DTA negative selection cassette (from pRosa-26-1). The targeting vector was linearized by SalI digestion and electroporated into embryonic stem cells, and G418-resistant clones were tested for correct gene targeting by Southern analysis using 5′ and 3′ (not shown) probes external to the targeting vector. The following primers were used for the 5′ probe: probeA-F1: 5′-GGCCACTGATGGTGTAGAAGCAAC-3′. probeA-R1: 5′- GTAGAGAGAAAGGCCATTCGGTCTG -3′. The following primers were used for the 3′ probe: probeB-F1: 5′-GGGCCATTAGATCACCCTCATTCTG-3′. probeB-R1: 5′- AACTCTGTGTATAAGGGCACTTCCC -3′. Following verification of correct targeting and karyotyping, positive ES cells were expanded and injected into blastocysts for generation of mice. Chimeric founders were crossed to C57B6 lines to confirm germline transmission. The following primers were used for initial genotyping:

Generation and culturing of Smarcd3-F6nlsEGFP mESC line

The Smarca4 knock-in ES cell line (Attanasio et al., 2014) was used for targeting of the Smarcd3-F6-Hsp68-nlsEGFP construct to the Hipp11 locus. Briefly, a modified shuttle vector containing a polylinker including PacI, XhoI, SacII, and flanking AscI sites was purchased from IDT. A pGKNeo selection cassette was subcloned from the pL451 plasmid using XhoI and SacII into the modified shuttle vector. A PacI fragment including flanking H19 insulator sequences, the Smarcd3-F6 enhancer, an Hsp68 minimal promoter, nlsEGFP coding sequence, WPRE mRNA stablilization sequence, and EF1alpha poly A sequence was subcloned into the modified shuttle vector. The entire reporter-selection construct was cloned into the Hipp11 targeting vector (Hippenmeyer et al., 2010) using AscI. The targeting vector was linearized using ApaI and electroporated into ES cells. Following G418 selection, correctly targeted clones were screened by PCR and Southern blotting. For culturing, ES cells were maintained in 2i + LIF media.

Fluorescent activated cell sorting and RNA sequencing

Directed cardiomyocyte differentiations were performed as previously described (Wamstad et al., 2012) using the Smarcd3-F6nlsEGFP mESC line with minor modifications. 18 hours after plating and cardiac induction (with VEGF, Fgf10, and Fgf2), supernatant was collected and 0.22 μm filtered. Cells were then washed with PBS (w/o Ca2+/Mg2+), dissociated from plates using TrypLE (Gibco), resuspended in filtered supernatant, and placed on ice. GFP+ and GFP− populations were subsequently sorted into RNAprotect cell reagent (Qiagen) using a BD FACSAria II flow cytometer. RNA was then purified from each population using the RNeasy Mini kit (Qiagen). Stranded RNA-seq libraries were then prepared using the Ovation Mouse FFPE RNA-Seq Multiplex System (NuGEN) and sequenced on an Illumina HiSeq 2000. Three biological replicates for each population (GFP+ and GFP-) were obtained and analyzed by RNA-sequencing.

Bioinformatics analysis

Sequence reads were aligned to the mm9 (mouse) assembly with Tophat 2 (Kim and Salzberg, 2011), using Ensembl version 67 exon annotation. Differential expression and variance-corrected log fold change was calculated using the program ‘DefinedRegionDifferentialSeq’ in USeq version 8.6.4 (http://useq.sourceforge.net/). In order to report gene-level counts, the highest-total-read-count transcript was reported for each gene, resulting in gene level annotation only. The final heatmap reports all genes/nonCode elements where the Benjamini-Hochberg FDR-corrected value (Benjamini and Hochberg, 1995; Nix et al., 2008) (false discovery rate) was less than 0.02 (i.e. 2% false discovery) in the comparison of (GFP+) vs (GFP-).

In situ hybridization, immunostaining and LacZ staining

Embryos were processed as previously described (Wythe et al., 2013). For lacZ embryos, beta galactosidase activity was detected using Salmon Gal (Sigma) prior to processing for in situ hybridization. Immunostaining of MADM samples for GFP and Myc was as previously described (Zong et al., 2005). Antibodies used on cryosections include: Rabbit anti-GFP (Invitrogen, 1:1000), Goat anti-Myc (Novus, 1:200), Rat anti-CD31 (BD Pharmingen, 1:100), Mouse anti-tropomyosin (DSHB clone CH-1, 1:50). Whole-mount lacZ and indirect immunofluorescent images were obtained using a Leica dissecting microscope and camera with the Leica LAS Montage extended focus function. Confocal images were obtained on a Nikon ECLIPSE Ti 2000 confocal microscope with a Yokogawa CSU-X1 spinning disk and Hamamatsu ImagEM CCD camera. Images were processed using Volocity software (Perkin Elmer). All images, including immunofluorescent, in situ hybridization, and LacZ images are representative images. At least 5 embryos (in situ hybridization and LacZ) or 3 independent sections (immunofluorescence) were examined for each experiment. Images shown represent average or representative expression levels.

Mouse experiments

All mouse protocols were approved by the Institutional Animal Care and Use Committee at UCSF.

Statistical analyses

In the Mesp1Cre-MADM mice, heart labeling results from a Cre-mediated chromosomal translocation that occurs within a narrow developmental time window of Cre expression, between the initiation of gastrulation and shortly there after (E6.0 and E7.0). Importantly, this translocation event does not happen in the absence of Cre-recombinase (our observations and previously published (Tasic et al., 2012)) and there is no visible labeling prior to translocation. We have empirically defined the frequency of this event by measuring two different variables: (1) the total number of cells that can undergo this translocation and (2) the observed frequency of labeled clones. The total number of cells that could undergo translocation was determined by counting the number of cells that had recombined a Cre-dependent reporter (Rosa) at the end of gastrulation (E7.5). FACS analysis determined that this number was ∼850 cells (∼1/3 of the total number of cells in the embryo at this time (Figure 1—figure supplement 1C)). Given the fact that we observed a total of 96 clones across 38 embryos, our clonal sampling represents 11% (or 96 clones / 850 Mesp1+ cells) of the total Mesp1+ population (assuming a random sampling). Thus a rare subpopulation, such as a common progenitor for both the right and left ventricles, would be missed only if it represented less than 10% of the total Mesp1 population. We also measured the observed frequency of labeled clones at two different time points (E8.5 and E14.5) to determine if the frequency of labeled clones changed over time (either increased or decreased) as might happen with additional recombination outside of our time window (E6.0–E7.0) or with selective loss of a twin spot via apoptosis (Figure 1—figure supplement 1D–E). Although the number of samples we have analyzed at E8.5 is small, we detected no significant change in the observed frequency of labeled clones at the two time points analyzed and thus conclude that recombination frequency is stable over developmental time and there is no gain or loss of clones outside our narrow labeling time window. Based on the number of observations made (n = 96) and the fact that we did not observe a common progenitor (number of successes = 0), we calculated the upper and lower bounds of a 95% and 99% confidence interval (CI) that a common progenitor does not exist using a binomial probability (Jeffreys interval) appropriate for instances when the number of successes is either very close to 0 or very close to 1. x = number of successes, n = sample size, c = confidence interval is the inverse regularized beta function. We used the R Package ‘binom’, version 1.1-1 for calculating these values. The calculated values for a 95% CI were: 0 (lower) and 0.01975768 (upper) and the calculated values for a 99% CI were: 0 (lower) and 0.03387941 (upper). Thus, given the number of observations we made, we can be quite confident that a common progenitor does not exist. An additional level of confidence regarding the lineage relationship of clones in different anatomical regions of the heart can be gained by comparing the color combinations observed. For example, clone MM2 could be interpreted as one recombination event that gave rise to two clusters: one in the right ventricle and one in the left ventricle. However the color combinations seen (red/green twin spots in right ventricle and yellow/blank twin spots in left ventricle) exclude the possibility that these two clusters are derived from the same event. Likewise, for clone MM26, only two labeled patches are seen in the entire embryo (red twin spot in left ventricle and green twin spot in right atrium). Assuming there is no selective loss of twin spots (as we have determined above by measuring the clonal frequency at two different time points) we can conclude that these two clusters are derived from a single event. eLife posts the editorial decision letter and author response on a selection of the published articles (subject to the approval of the authors). An edited version of the letter sent to the authors after peer review is shown, indicating the substantive concerns or comments; minor concerns are not usually shown. Reviewers have the opportunity to discuss the decision before the letter is sent (see review process). Similarly, the author response typically shows only responses to the major concerns raised by the reviewers. Thank you for sending your work entitled “Early Patterning and Specification of Cardiac Progenitors in Gastrulating Mesoderm” for consideration at eLife. Your article has been favorably evaluated by Fiona Watt (Senior editor), Marianne Bronner (Reviewing editor), and 2 reviewers. The Reviewing editor and the other reviewers discussed their comments before we reached this decision, and the Reviewing editor has assembled the following comments to help you prepare a revised submission. With the goal of identifying developmental fields or boundaries in the heart, Devine and colleagues perform lineage-tracing studies on cardiac progenitor cells, defined by expression of mesodermal markers, in late pre-gastrulation/early gastrulation mouse embryos. Utilizing the mesodermal germ layer marking Mesp1 in conjunction with transcriptional elements from Smarcd3, which is expressed within the Mesp1 cell population, the authors make a compelling case that specification of cardiac progenitors occurs early, that this specification is concurrent for each heart field, and that there is not a common progenitor for primary and secondary heart fields. This is an important topic, as these stages are difficult to access technically and there are outstanding questions about the heterogeneity of cardiac progenitors. The number and variety of mouse strains employed for lineage tracing, some of which are generated for this manuscript, and the number of experiments performed, are impressive. The results suggest that the mammalian heart is compartmentalized at early life stages. Overall, this is an interesting and well executed study; however, a few of the conclusions need further support or clarification. Major concerns: 1) The authors state that the Mesp-Cre is active in mesoderm from E6.0 to E7.0, but it is unclear how this is determined? The reference Saga 1999 does not seem to show this, as it is likely Cre Protein persists longer than the Mesp mRNA and the authors should mention this. Without a conditional Cre, the authors should explain more clearly how they know that new clones are not induced throughout development. Are E14.5 embryos optically clear enough (as compared to E8.5 embryos) to count total fluorescent clones and be certain that new cell labeling events do not continue? More explanation in the main text is requested. 2) The authors make a novelty claim that they have shown that individual cardiac progenitor cells give rise to multiple cardiac cell types. This is not shown conclusively, as they do not use adequate costaining to identify cells in their Figure 1 tissue sections. They should use antibodies against a myocyte marker and an endothelial marker in a 4-color stain of clonal progeny to show this. 3) In the text and staining in Figure 3. What is the evidence that Mesp1 and Smarcd3 mRNAs do not overlap? When possible, which it should be for reporters like GFP and lacZ, the authors should use fluorescence detection to colocalize markers in tissue sections. Then, arrows could be used to pinpoint cells in sections with different signatures to better make the authors' points. 4) The authors use a confetti approach with a Smarcd3 enhancer driving an inducible Cre. This is a useful way to confirm the MADM results, although there may be pitfalls with tamoxifen persistence, etc. The authors mention the results briefly that labeled cells within clones are contained in single chambers, but it is better to show the full dataset here to have an idea of how they made their conclusion. 5) The authors mention that early Tbx5+ cell labeling marks progeny corresponding to epicardial progenitors. However, they do not show cell type-specific markers to validate this colocalization. They need to do the costains or remove the statement. [Editors' note: further revisions were requested prior to acceptance, as described below.] Thank you for resubmitting your work entitled “Early Patterning and Specification of Cardiac Progenitors in Gastrulating Mesoderm” for further consideration at eLife. Your revised article has been favorably evaluated by Fiona Watt (Senior editor) and a member of the Board of Reviewing Editors. The manuscript has been improved but there are some remaining relatively minor issues that need to be addressed before acceptance, as outlined below: Original Comment #4: The authors use a confetti approach with a Smarcd3 enhancer driving an inducible Cre. This is a useful way to confirm the MADM results, although there may be pitfalls with tamoxifen persistence, etc. The authors mention the results briefly that labeled cells within clones are contained in single chambers, but it is better to show the full dataset here to have an idea of how they made their conclusion. Also, authors should indicate this small number of confetti animals examined in the text of their manuscript, and any limitation of their analysis, for the benefit of anyone who will attempt to repeat this work. Original Comment #5: The authors mention that early Tbx5+ cell labeling marks progeny corresponding to epicardial progenitors. However, they do not show cell type-specific markers to validate this colocalization. They need to do the costains or remove the statement. Further comment in response to authors' rebuttal: Disagree. Based on the image provided, the authors should remove the statement on contribution to epicardial progenitors. The red Tbx18 signal is equivalent to background – the signal and claim of costain is unlikely to convince the reader. 1) The authors state that the Mesp-Cre is active in mesoderm from E6.0 to E7.0, but it is unclear how this is determined? The reference Saga 1999 does not seem to show this, as it is likely Cre Protein persists longer than the Mesp mRNA and the authors should mention this. Without a conditional Cre, the authors should explain more clearly how they know that new clones are not induced throughout development. Are E14.5 embryos optically clear enough (as compared to E8.5 embryos) to count total fluorescent clones and be certain that new cell labeling events do not continue? More explanation in the main text is requested. The reviewers raise an important point with respect to the timing of clone induction. While we have not used a conditional Cre allele to control the timing of Cre activity, we believe there are several lines of evidence that support the conclusion that Mesp1 is active (and thus clones are induced) over a very narrow temporal window (from ∼E6.0-E7.5). First, we have performed in situ hybridization for Cre mRNA in Mesp1 embryos at multiple stages and find that by the late head fold stage (LHF) expression of Cre mRNA is largely restricted to the allantoic base and allantoic membrane with minimal expression in area of the forming cardiogenic mesoderm (Figure 1–figure supplement 1B), supporting the idea that Cre mRNA and thus Cre activity is extinguished after E7.5. While staining for Cre protein would be the preferred method for determining protein perdurance, we have been unable to identify a suitable antibody for Cre immunostaining despite attempts with several different antibodies on both whole-mount embryos and tissue sections. Second, in the original reference describing the expression and requirement of Mesp1 in early gastrulating mesoderm (Saga et al. 1999) they look both at Mesp1 mRNA (their Figure 3G-3L) as well as beta-galactosidase activity in a knock-in allele (their Figure 3A-3F). Even with the perdurance of beta-galactosidase enzyme activity, the authors see minimal X-gal staining after E7.75. If we assume that beta-galactosidase activity likely persists as long or longer than Cre protein activity, it is unlikely that clones are induced after ∼E7.5. Third, we have counted the number of clones in embryos at E8.5 and at E14.5 (Figure 1–figure supplement 1C-D and Statistical Analysis) and we see a similar distribution, suggesting that no additional clones are induced over this time window. Finally, a recent paper (Lescroart et al. 2014) describes a complementary lineage labeling approach using a Mesp1-rtTA transgenic allele. Based on the timing of doxycycline administration, they define a functional window of Mesp1 activity between E6.25-E7.5, consistent with what we and others have shown. We regret omitting a full description of our clonal analysis protocol and this is now included both in the main text as well as the Materials and Methods. In order to ensure an accurate description of clone locations, a thorough external examination was performed of each embryo. Following this, hearts were dissected and, in many instances, immunostained for labeled twin spots (GFP and Myc). Whole-mount hearts were photographed and subsequently embedded and sectioned for additional immunostaining (PECAM and tropomyosin). The use of optical clearing solutions, such as Scale or ClearT, was not necessary and thus not used. 2) The authors make a novelty claim that they have shown that individual cardiac progenitor cells give rise to multiple cardiac cell types. This is not shown conclusively, as they do not use adequate costaining to identify cells in their tissue sections. They should use antibodies against a myocyte marker and an endothelial marker in a 4-color stain of clonal progeny to show this. The reviewers are correct to point out that for technical reasons we did not initially stain for all cell-lineage markers at the same time in our tissue sections. We relied on cell morphology and staining or absence of staining for a single lineage marker (PECAM). We now have stained an additional clone example (Figure 1–figure supplement 3L) that clearly shows a twin spot (Green) that gives rise to both endocardium (PECAM positive) and cardiomyocytes (Tropomyosin positive), thus providing additional confirmation that individual cardiac progenitor cells can give rise to multiple cardiac cell types. 3) In the text and staining in . What is the evidence that Mesp1 and Smarcd3 mRNAs do not overlap? When possible, which it should be for reporters like GFP and lacZ, the authors should use fluorescence detection to colocalize markers in tissue sections. Then, arrows could be used to pinpoint cells in sections with different signatures to better make the authors' points. The reviewers suggest that whenever possible we should look at co-localization of Mesp1 and Smarcd3 in the same tissue section or embryo rather than comparing between embryos stained for each respective marker (example, Figure 3–figure supplement 1A,B). We have now included additional images that document the non-overlapping expression of Mesp1 mRNA and Smarcd3-F1 lacZ activity (Figure 3–figure supplement 1C,D). While immunostaining for Mesp1 and Smarcd3-F1 LacZ/GFP would be the preferred method to document at the cellular level the different signatures of cells, we have not been able to identify a suitable antibody for Mesp1 immunostaining. As a result, we must rely on Mesp1 mRNA in situ hybridization combined with immunostaining or X-gal staining for Smarcd-F1. In addition, we would like to point out that in our in vitro differentiation assay (Figure 6 B&C) we see a temporal distinction between the peaks of Mesp1 and Smarcd3 expression; Mesp1 mRNA expression is mostly gone at day 4.5, the same time that Smarcd3 mRNA expression begins to increase. These data also support the idea that at the temporal level, Mesp1 and Smarcd3 are non-overlapping differentiation markers. 4) The authors use a confetti approach with a Smarcd3 enhancer driving an inducible Cre. This is a useful way to confirm the MADM results, although there may be pitfalls with tamoxifen persistence, etc. The authors mention the results briefly that labeled cells within clones are contained in single chambers, but it is better to show the full dataset here to have an idea of how they made their conclusion. The reviewers point out that we used a complementary approach (Confetti mice) to confirm the major conclusions from our MADM clonal analysis. We did not perform an exhaustive analysis with the Confetti mice because we felt the results from our MADM analysis were compelling and statistically significant. We focused our efforts on the MADM approach because of the advantages that we felt this system offered (rare labeling, ability to distinguish twin spots, permanent daughter cell labeling). While we attempted to perform MADM analysis with our Smarcd3-F1CreERT2 allele, the recombination frequency was too low to identify any clones in several litters of embryos. In addition, as the reviewers point out, there are pitfalls associated with tamoxifen persistence that might confound our results. Nonetheless, we crossed our Smarcd3-F1CreERT2 allele with the ROSA allele and induced recombination early (E6.5) and identified 6 embryos from several litters that contained rare or infrequent labeling events and none of these examples showed a labeling pattern that would support a common progenitor contributing to both right and left ventricles. Instead, we saw clonal labeling of a single chamber. While the number of embryos we looked at is not statistically significant, we believe performing a full analysis using the Smarcd3-F1CreERT2; Confetti system in addition to the Mesp1-MADM system is beyond the scope of this paper, but that the current data are highly supportive of our conclusions with the MADM system. 5) The authors mention that early Tbx5+ cell labeling marks progeny corresponding to epicardial progenitors. However, they do not show cell type-specific markers to validate this colocalization. They need to do the costains or remove the statement. The reviewers are correct to point out that we describe an early Tbx5+ population that contributes to epicardial progenitors based on anatomic location without formally showing co-localization with an epicardial marker. We have now stained tissue sections from an early tamoxifen pulse (E6.5) harvested at E14.5 with anti-Tbx18, a marker of epicardial (and interventricular septum) cells (Zeng et al. 2011). We see rare GFP-positive/Tbx5-lineage derived cells on the epicardial surface of the heart that are also positive for Tbx18 immunostaining (Figure 7–figure supplement 1O), thus confirming that an early population of Tbx5 derived cells also labels epicardial progenitors. [Editors' note: further revisions were requested prior to acceptance, as described below.] Original Comment #4: The authors use a confetti approach with a Smarcd3 enhancer driving an inducible Cre. This is a useful way to confirm the MADM results, although there may be pitfalls with tamoxifen persistence, etc. The authors mention the results briefly that labeled cells within clones are contained in single chambers, but it is better to show the full dataset here to have an idea of how they made their conclusion. Also, authors should indicate this small number of confetti animals examined in the text of their manuscript, and any limitation of their analysis, for the benefit of anyone who will attempt to repeat this work. We have added text to add the numbers of embryos studied, and emphasize the technical limitations of the use of the confetti mice. We also indicated that the MADM system has a recombination frequency too low for use with CreERT2 transgenes. Original Comment #5: The authors mention that early Tbx5+ cell labeling marks progeny corresponding to epicardial progenitors. However, they do not show cell type-specific markers to validate this colocalization. They need to do the costains or remove the statement. Further comment in response to authors' rebuttal: Disagree. Based on the image provided, the authors should remove the statement on contribution to epicardial progenitors. The red Tbx18 signal is equivalent to background – the signal and claim of costain is unlikely to convince the reader. We agree that the data is not as convincing as it could be, and have removed the panel from Figure 7–figure supplement 1, as well as text referring to epicardial labeling.
5′ homology arm:ROSA1 5′-CCACTGACCGCACGGGGATTC-3′ (in genomic)
ROSA7 5′-GGGGAACTTCCTGACTAGGG-3′ (in FRT)
3′ homology arm:ROSA2 5′-TCAATGGGCGGGGGTCGTT-3′ (in CAGGS)
ROSA5 5′-GGGGAAAATTTTTAATATAAC-3′ (in genomic)
5′ end of targeted locus:Tbx5CreF1: TATGTCGCTAGACACTCTCC
Tbx5CreR1:CCGGCAAACGGACAGAAGCA
Knock-in = 226 bp, WT = no band
3′ end of the targeted locus:Tbx5CreNeoFor1: ACTGTGCCTTCTAGTTGCCAGC.
Tbx5CreWT: Rev: AAAGTGGATTGGGATAGAGTGG
Knock-in = 470 bp, WT = no band
After mating to B-actin-FlpE mice to remove the Neo cassette:Tbx5NeoFlp’DF1: ACAACCATGGACTACAAGGACG
Tbx5CreWT Rev: AAAGTGGATTGGGATAGAGTGG
Knock-in = 420 bp, WT = no band
Mice were maintained on a C57B6 background after crossing to various reporter mice. Inheritance of the allele was confirmed by PCRTbx5Exon2WTFor2: ATACAGATGAGGGCTTTGGCCTGG
Tbx5CreWTRev: AAAGTGGATTGGGATAGAGTGG
WT band = 290 bp, CreRT2 band = 360 bp
  55 in total

1.  Ligand-activated Flpe for temporally regulated gene modifications.

Authors:  Nina L Hunter; Rajeshwar B Awatramani; Francis W Farley; Susan M Dymecki
Journal:  Genesis       Date:  2005-03       Impact factor: 2.487

2.  Mosaic analysis with double markers in mice.

Authors:  Hui Zong; J Sebastian Espinosa; Helen Hong Su; Mandar D Muzumdar; Liqun Luo
Journal:  Cell       Date:  2005-05-06       Impact factor: 41.582

3.  Multipotent embryonic isl1+ progenitor cells lead to cardiac, smooth muscle, and endothelial cell diversification.

Authors:  Alessandra Moretti; Leslie Caron; Atsushi Nakano; Jason T Lam; Alexandra Bernshausen; Yinhong Chen; Yibing Qyang; Lei Bu; Mika Sasaki; Silvia Martin-Puig; Yunfu Sun; Sylvia M Evans; Karl-Ludwig Laugwitz; Kenneth R Chien
Journal:  Cell       Date:  2006-11-22       Impact factor: 41.582

4.  Islet 1 is expressed in distinct cardiovascular lineages, including pacemaker and coronary vascular cells.

Authors:  Yunfu Sun; Xingqun Liang; Nader Najafi; Margaret Cass; Lizhu Lin; Cheng-Leng Cai; Ju Chen; Sylvia M Evans
Journal:  Dev Biol       Date:  2006-12-29       Impact factor: 3.582

Review 5.  Building the mammalian heart from two sources of myocardial cells.

Authors:  Margaret Buckingham; Sigolène Meilhac; Stéphane Zaffran
Journal:  Nat Rev Genet       Date:  2005-11       Impact factor: 53.242

6.  The right ventricle, outflow tract, and ventricular septum comprise a restricted expression domain within the secondary/anterior heart field.

Authors:  Michael P Verzi; David J McCulley; Sarah De Val; Evdokia Dodou; Brian L Black
Journal:  Dev Biol       Date:  2005-09-26       Impact factor: 3.582

7.  Deletion of the selection cassette, but not cis-acting elements, in targeted Flk1-lacZ allele reveals Flk1 expression in multipotent mesodermal progenitors.

Authors:  Masatsugu Ema; Satoru Takahashi; Janet Rossant
Journal:  Blood       Date:  2005-09-15       Impact factor: 22.113

8.  Multipotent flk-1+ cardiovascular progenitor cells give rise to the cardiomyocyte, endothelial, and vascular smooth muscle lineages.

Authors:  Steven J Kattman; Tara L Huber; Gordon M Keller
Journal:  Dev Cell       Date:  2006-11       Impact factor: 12.270

9.  Developmental origin of a bipotential myocardial and smooth muscle cell precursor in the mammalian heart.

Authors:  Sean M Wu; Yuko Fujiwara; Susan M Cibulsky; David E Clapham; Ching-Ling Lien; Thomas M Schultheiss; Stuart H Orkin
Journal:  Cell       Date:  2006-11-22       Impact factor: 41.582

10.  Early endocardial morphogenesis requires Scl/Tal1.

Authors:  Jeroen Bussmann; Jeroen Bakkers; Stefan Schulte-Merker
Journal:  PLoS Genet       Date:  2007-07-09       Impact factor: 5.917

View more
  80 in total

1.  Wnt signaling balances specification of the cardiac and pharyngeal muscle fields.

Authors:  Amrita Mandal; Andrew Holowiecki; Yuntao Charlie Song; Joshua S Waxman
Journal:  Mech Dev       Date:  2017-01-10       Impact factor: 1.882

Review 2.  A new heart for a new head in vertebrate cardiopharyngeal evolution.

Authors:  Rui Diogo; Robert G Kelly; Lionel Christiaen; Michael Levine; Janine M Ziermann; Julia L Molnar; Drew M Noden; Eldad Tzahor
Journal:  Nature       Date:  2015-04-23       Impact factor: 49.962

3.  Single-Cell Lineage Tracing Reveals that Oriented Cell Division Contributes to Trabecular Morphogenesis and Regional Specification.

Authors:  Jingjing Li; Lianjie Miao; David Shieh; Ernest Spiotto; Jian Li; Bin Zhou; Antoni Paul; Robert J Schwartz; Anthony B Firulli; Harold A Singer; Guoying Huang; Mingfu Wu
Journal:  Cell Rep       Date:  2016-03-24       Impact factor: 9.423

4.  Clonal analysis reveals a common origin between nonsomite-derived neck muscles and heart myocardium.

Authors:  Fabienne Lescroart; Wissam Hamou; Alexandre Francou; Magali Théveniau-Ruissy; Robert G Kelly; Margaret Buckingham
Journal:  Proc Natl Acad Sci U S A       Date:  2015-01-20       Impact factor: 11.205

5.  Single cell expression analysis reveals anatomical and cell cycle-dependent transcriptional shifts during heart development.

Authors:  Guang Li; Lei Tian; William Goodyer; Eric J Kort; Jan W Buikema; Adele Xu; Joseph C Wu; Stefan Jovinge; Sean M Wu
Journal:  Development       Date:  2019-06-14       Impact factor: 6.868

6.  Temporally Distinct Six2-Positive Second Heart Field Progenitors Regulate Mammalian Heart Development and Disease.

Authors:  Zhengfang Zhou; Jingying Wang; Chaoshe Guo; Weiting Chang; Jian Zhuang; Ping Zhu; Xue Li
Journal:  Cell Rep       Date:  2017-01-24       Impact factor: 9.423

Review 7.  Earlier and broader roles of Mesp1 in cardiovascular development.

Authors:  Yu Liu
Journal:  Cell Mol Life Sci       Date:  2017-01-03       Impact factor: 9.261

8.  Calcium handling precedes cardiac differentiation to initiate the first heartbeat.

Authors:  Richard Cv Tyser; Antonio Ma Miranda; Chiann-Mun Chen; Sean M Davidson; Shankar Srinivas; Paul R Riley
Journal:  Elife       Date:  2016-10-11       Impact factor: 8.140

Review 9.  Development, Proliferation, and Growth of the Mammalian Heart.

Authors:  Marie Günthel; Phil Barnett; Vincent M Christoffels
Journal:  Mol Ther       Date:  2018-06-19       Impact factor: 11.454

Review 10.  Genetic and epigenetic regulation of cardiomyocytes in development, regeneration and disease.

Authors:  Miao Cui; Zhaoning Wang; Rhonda Bassel-Duby; Eric N Olson
Journal:  Development       Date:  2018-12-20       Impact factor: 6.868

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.