Literature DB >> 25259715

Early transcriptional responses of bovine chorioallantoic membrane explants to wild type, ΔvirB2 or ΔbtpB Brucella abortus infection.

Juliana P S Mol1, Erica A Costa1, Alex F Carvalho2, Yao-Hui Sun3, Reneé M Tsolis3, Tatiane A Paixão4, Renato L Santos1.   

Abstract

The pathogenesis of the Brucella-induced inflammatory response in the bovine placenta is not completely understood. In this study we evaluated the role of the B. abortus Type IV secretion system and the anti-inflammatory factor BtpB in early interactions with bovine placental tissues. Transcription profiles of chorioallantoic membrane (CAM) explants inoculated with wild type (strain 2308), ΔvirB2 or ΔbtpB Brucella abortus were compared by microarray analysis at 4 hours post infection. Transcripts with significant variation (>2 fold change; P<0.05) were functionally classified, and transcripts related to defense and inflammation were assessed by quantitative real time RT-PCR. Infection with wild type B. abortus resulted in slightly more genes with decreased than increased transcription levels. Conversely, infection of trophoblastic cells with the ΔvirB2 or the ΔbtpB mutant strains, that lack a functional T4SS or that has impaired inhibition of TLR signaling, respectively, induced more upregulated than downregulated genes. Wild type Brucella abortus impaired transcription of host genes related to immune response when compared to ΔvirB and ΔbtpB mutants. Our findings suggest that proinflammatory genes are negatively modulated in bovine trophoblastic cells at early stages of infection. The virB operon and btpB are directly or indirectly related to modulation of these host genes. These results shed light on the early interactions between B. abortus and placental tissue that ultimately culminate in inflammatory pathology and abortion.

Entities:  

Mesh:

Year:  2014        PMID: 25259715      PMCID: PMC4178178          DOI: 10.1371/journal.pone.0108606

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Brucellosis is an important zoonotic disease with worldwide distribution, caused by bacteria of the genus Brucella. It causes significant economic losses due to abortions and culling of infected cattle, whereas in humans it is associated with a febrile illness with variable symptoms, and it may occasionally be fatal [1]–[3]. Most cases of bovine brucellosis are due to Brucella abortus infection, which is transmitted by contact with contaminated aborted fetuses, fetal membranes, and uterine secretions after abortion or during the postpartum period [4], [5]. Aborted fetuses resulting from B. abortus infection often exhibit signs of fibrinous pleuritis, which may be associated with suppurative bronchopneumonia and fibrinous pericarditis [6], [7]. During pregnancy, after the initial infection of the erythrophagocytic trophoblasts located at the base of the chorionic villi, the bacteria spread throughout the placenta following a periplacentomal pattern, infecting trophoblastic cells of the intercotyledonary region, mostly at the end of gestation (180 to 240 days) [8]–[11]. Thus, B. abortus triggers an intense acute inflammatory response in the placenta, which is associated with abortion [7]. While this inflammatory pathology is well-described, very little is known about the initial interactions between B. abortus and placental cells that ultimately result in placentitis and abortion, two processes that are key components of disease transmission. Because of the difficulty of studying these early interactions in pregnant animals, ex vivo infection of cultured chorioallantoic membrane (CAM) explants, which results in localization of B. abortus to trophoblasts, has been used to study the initial phases of placental infection [12], [13]. Virulence factors of B. abortus have been studied in the context of persistent infection of the mononuclear phagocyte system, however few studies have been performed in the context of placental infection in the natural host. The type IV secretion system (T4SS) is considered to be a key virulence factor of Brucella spp., and it is responsible for secretion of effector proteins across the bacterial cell envelope [14]–[16]. The T4SS has been shown to be involved in abortion in goats [17], raising the question of its contribution to early interactions with the placenta. A second set of virulence factors, shown to be involved in immune evasion, are the TIR domain proteins, BtpA and BtpB [18]–[20]. BtpA is present in B. abortus, B. melitensis, and B. suis ATCC 23445 (biovar 2), but it is absent in B. suis 1330 (biovar 1). BtpA binds directly to MyD88, preventing signaling via TLR2 and TLR4, impairing innate immune response and inhibiting maturation of in vitro infected dendritic cells by blocking the TLR2 signaling pathway [18], [20]. BtpB is present in all species of Brucella. It inhibits TLR signaling, preventing activation of dentritic cells, and together with BtpA can modulate the host inflammatory responses during Brucella sp. infection [19]. Interestingly, translocation of BtpB into host macrophages was shown to depend on the VirB T4SS [19]. In this study, the CAM explant model was used as an ex vivo model to study the pathogenesis of Brucella infection during the initial phase of the bacteria-host interaction [12]. Carvalho Neta et al [13], using this model, demonstrated that B. abortus modulates the innate immune response by trophoblastic cells by inhibiting the transcription of proinflammatory mediators at early stages of infection. The aim of this study was to interrogate the role of the VirB T4SS and BtpB in early suppression of inflammatory responses in the placenta.

Materials and Methods

Bacterial strains

The inocula were prepared by growth for 12–15 hours under agitation at 37°C of the three bacterial strains: B abortus 2308 was cultivated in Brucella broth (Difco, Lawrence, KS, USA) and the ΔvirB2 B. abortus and ΔbtpB B. abortus strains were cultivated in Tryptic Soy Broth (Difco) supplemented with kanamycin (100 µg/µL). After incubation, the optical density of bacterial suspensions was determined by spectrophotometry (OD600) and adjusted to 1.0×108 CFU/mL. To confirm the concentration of bacteria, the inocula were serially diluted in PBS (pH 7.4), and 100 µL of each dilution were plated on Tryptic Soy Agar (Difco), in duplicate. After 48 h of incubation at 37°C with 5% CO2, colonies counted and the number of colony forming units (CFU) was obtained by the average of duplicates. The handling of agent and infected material was performed under biosafety level 3 containment.

Generation of mutant strains

The ΔvirB2 B. abortus strain used in this study was obtained by allelic exchange of the virB2 gene (BAB2_0067), inserting a kanamycin cassette. The plasmid used to construct the mutant strains was the pAV2.2, a kanamycin resistant vector, which has been described previously [21]. The ΔbtpB B. abortus strain was obtained by allelic exchange of the btpB gene (BAB1_0279) for a kanamycin cassette. The plasmid used for btpB mutagenesis was generated in this study. For this purpose a plasmid called pUKD/btpB was made by using a previously described three-step cloning strategy [22]. Briefly, a fragment of the 5′ region of BAB1_0279 with engineered SmaI site was amplified from B. abortus genomic DNA using primers BMEI1674UP-F (TGAATGTGGCAAGCCCTCGAC) and BMEI1674UP-R (A). A fragment of the 3′ region of BAB1_0279 with engineered SmaI and PstI sites was amplified using primers BMEI1674DN-F (A) and BMEI1674DN-R (T). Both amplicons were TOPO cloned into pCR2.1 to yield plasmids pUP/btpB and pDN/btpB respectively. The orientation of the inserted 5′ fragment of BAB1_0279 was determined by PCR and restriction analysis to make sure the unique SmaI site was next to the T7 promoter in pCR2.1 vector. The 3′ fragment of BAB1_0279 was then excised by SmaI/PstI double digestion and cloned into the same sites of pUP/btpB to generate the pUD/btpB. The resulting plasmid was selected for ampicillin resistance as double digestion of SmaI/PstI truncates the original kanamycin resistance gene in pCR2.1. In the third cloning step, a 1.3-kb SmaI fragment of pUC4-KIXX (Pharmacia) containing the Tn5 kanamycin resistance gene was cloned into the SmaI site of pUD/btpB to give rise topUKD/btpB, which was selected for both kanamycin and ampicillin resistance. These plasmids were transformed into electrocompetent B. abortus cells by electroporation as previously described [23]. Colonies that were kanamycin resistant and ampicillin sensitive were selected as mutant candidates. Deletion of the virB2 and btpB genes was confirmed by PCR using primers flanking the deleted region.

Chorioallantoic membrane explant culture and infection

Snapwell plates (Transwell Cell Culture Permeable Supports – Snapwell Inserts - Corning Incorp., NY, EUA) were used for culturing CAM explants [12], [13]. Seven intact pregnant bovine uteruses at the final third of gestation were obtained at local slaughterhouses. Gestational age was estimated by cephalococcygeal length (CR - Crown-rump length) [24]. All fetuses were serologically negative for Brucella spp. by using the Acidified Antigen Buffered test with fetal amniotic fluid. Prior to obtaining the CAM, the perimetrium was thoroughly decontaminated with iodinated alcohol, the uterus was then opened and CAM removed and placed in RPMI 1640 sterile medium (Invitrogen, São Paulo, Brazil) containing antibiotics (100 U/mL penicillin and 100 µg/mL streptomycin) for 20 minutes. CAM explants were then washed twice in RPMI (Invitrogen) at 37°C for complete removal of the antibiotic. Sterile rings and detachable supports were positioned over the intercotyledonary portion of the CAM explants. Excess tissue was removed from CAM explants, which were placed in 6 well culture plates (Corning, NY, USA) containing sterile culture medium RPMI 1640 supplemented with 4 mM glutamine, 1 mM pyruvate, 1 mM nonessential amino acids, 2.9 mM sodium bicarbonate and 15% fetal bovine serum (Invitrogen), and incubated at 37°C in a humidified atmosphere with 5% CO2. The experimental protocol was approved by the Ethics Committee on Animal Experimentation of UFMG (CETEA – Protocol 183/2010). The trophoblastic surface of the CAM explants was inoculated with 200 µL of culture medium (RPMI 1640) containing 2.0×107 CFU, which corresponded to a multiplicity of infection of approximately 1000 (MOI 1000∶1) as previously used by Carvalho Neta et al. [13]. CAM explants were inoculated in triplicate with wild type, ΔvirB2 or ΔbtpB strains of B. abortus 2308. Plates were incubated at 37°C with 5% CO2 for 4 h, the medium was then replaced with RPMI 1640 medium supplemented with 50 µg/mL gentamicin (Invitrogen, São Paulo, Brazil) to inactivate extracellular bacteria. Plates were maintained at 37°C with an atmosphere containing 5% CO2 for 1 h followed by washing three times with PBS (phosphate buffered saline - pH 7.4) to eliminate the antibiotic. Uninfected CAM controls were inoculated with sterile RPMI 1640 medium and kept under the same conditions.

Determining the number of internalized bacteria

To determine the number of internalized bacteria, three explants inoculated with wild type, ΔvirB2 or ΔbtpB B. abortus 2308 were incubated for 4 h, followed by 1 h incubation with RPMI 1640 medium supplemented with 50 µg gentamicin/mL (Invitrogen, São Paulo, Brazil) to inactivate extracellular bacteria, washed three times with PBS (pH 7.4), and then lysed with 200 µL of sterile 0.1% Triton X-100 (Roche, Mannheim, Germany). Serial dilutions of the lysates were prepared in PBS (pH 7.4), and 100 µL of each dilution were plated on tryptose agar (Difco) in duplicate. After 48 h of incubation at 37°C with 5% CO2, the number of colony forming units (CFU) was counted in each plate.

RNA extraction and preparation of cDNA

After removal of RPMI culture medium supplemented with gentamicin (n = 4 for microarray analysis; n = 3 for qRT-PCR), TRIzol Reagent (Invitrogen) was added to the trophoblastic surface of the CAM explants of uninfected controls or explants infected with wild type, ΔvirB2 or ΔbtpB B. abortus 2308, for total RNA extraction, according to the manufacturer's instructions. Purity and concentration of RNA samples were assessed by spectrophotometry, and RNA quality evaluated by agarose/formaldehyde gel electrophoresis. RNA samples were stored at −80°C. Synthesis of cDNA was performed using Superscript III First Strand S (Invitrogen), following the manufacturer's specifications using a RNA concentration of 1,500 ng in a reaction with a final volume of 20 µL, and cDNA was stored at −20°C.

Microarray analysis

Gene expression profiles were evaluated using the Agilent two color microarray-based gene expression platform according to manufacturer's instructions. Briefly, RNA (500 ng) was amplified and labeled using the two-color Quick Amp labeling kit (Agilent Technologies, CA, USA). Complementary RNA (cRNA) was synthesized from triplicates of CAM explants of four independent experiments. cRNA from uninfected control explants labeled with Cy3 and cRNA from explants infected with either wild type, ΔvirB2 or ΔbtpB B abortus 2308, labeled with Cy5 were hybridized on the same slide at 65°C, for 17 hours and 10 RPM in a high-density microarray containing 4×44,000 genes representing fully sequenced bovine genome (#G2519F Agilent Technologies, Palo Alto, CA, USA). After hybridization, slides were washed in Gene Expression wash buffers 1 and 2 as per instructions, scanned with an Agilent DNA microarray scanner (Agilent Technologies) and the hybridization signals were extracted using the Agilent Feature Extraction software version 11.0.

Quantitative real-time PCR (qRT-PCR)

After functional classification using the Funcat (Functional Classification) platform (http://mips.helmholtzmuenchen.de/genre/proj/mfungd/Search/Catalogs/searchCatfirstFun.html) genes of interest, i.e. related to inflammation and immune response that had at least a 2-fold change in transcription levels and that were statistically significant (P<0.05) were selected for confirmation based on qRT-PCR. Levels of transcripts were normalized based on β-actin transcript level. qRT-PCR was performed using the SYBR Green PCR Master Mix (Applied Biosystems, NY, USA) and the StepOnePlus thermal cycler (Applied Biosystems, NY, USA). Primers used in this study are described in Table 1. The data were analyzed using the comparative Cycle threshold (Ct) method [25].
Table 1

Primers used in this study.

GenePrimers (5′-3′)Product size (nt)
IFN-alpha G TCAAGCCATCTCTGTGCTCC 72
ACGGCTGAACCCTCTACACT
Chemokine (C-X-C motif) ligand 12 GATGCCAAGGTCTTCGTCGT 104
TCAAAGAATCGGCAAGGGCA
Interleukin 15 TGGGCTGTATCAGTGCAAGT 148
ACTTTGCAATTGGGATGAGCA
Interleukin 1 family, member 6 (epsilon)-like GCCGGAGCTTTGTCTCTTCT 136
CCTGCCATTCTGGTCATGGT
Transmembrane 4 L six family member 19 CCCTGCCGAAGGATGCTTAT 85
GCAAATCAAGGCTCCAAGCA
Tumor necrosis factor receptor superfamily, member 9 ACATGGCATCTGTCGACCTT 82
ACGTCACTTTCCTTCGTCCC
Apolipoprotein L, 3 CAGAGACACACGAAAGGCG 108
GGCTGGAAGAAGGTGTCGTT
Heat shock 70 kDa protein 1- like AAACTGGATCGAAGGCGGC 53
GCTGCAGCCATGATTTTCCT
Platelet/endothelial cell adhesion molecule GCTGACCCTTCTGCTCTGTT 116
GTGTCAGGTTCTCCCCGTTT
Pellino homolog 2 CCCAATAAGGAGCCCGTGAA 136
TGGGTTTGACTCCGTTAGCC
β-actina ACTTGCGCAGAAAACGAGAT 84
CACCTTCACCGTTCCAGTTT

Statistical analysis

Normalization and statistical analysis of the microarray data were performed using the GeneSpring software (Agilent Technologies, CA, USA). Analysis of variance (ANOVA) and the Student's t-test were performed with significance level of P<0.05. Analysis of variance (ANOVA) was performed after logarithmic transformation of CFU values and means were compared by the Tukey's Multiple Comparison Test (P<0.05).

Microarray data accession number

The microarray data set has been submitted to the Gene Expression Omnibus database at NCBI (http://www.ncbi.nlm.nih.gov/geo/) and assigned accession number GSE58216.

Results

Internalization of wild type, ΔvirB2 and ΔbtpB Brucella abortus strains by bovine trophoblastic cells

In order to evaluate whether the Brucella strains used in this study had comparable levels of internalization in trophoblastic cells of bovine CAM explants, CFU numbers at 4 h post inoculation followed by 1 h of incubation with gentamicin. There was no difference between the number of internalized wild type and ΔbtpB B. abortus 2308. It has been demonstrated that in infected CAM, B. abortus is found intracellularly in trophoblasts [13]. In contrast, the number of internalized ΔvirB2 mutant B. abortus was significantly lower than the other two strains (Figure 1).
Figure 1

Internalization of wild type, ΔvirB2 or ΔbtpB Brucella abortus by bovine trophoblastic cells.

Chorioallantoic membrane (CAM) explants were inoculated, incubated for 4 h, followed by 1 h incubation with gentamicin, and then lysed for intracellular CFU counting. Data represents the average log of CFU numbers from CAM explants, from three independent experiments performed in triplicates. Data underwent logarithmic transformation followed by analysis of variance (ANOVA) and the Tukey's multiple comparison test with significance level of P<0.05.

Internalization of wild type, ΔvirB2 or ΔbtpB Brucella abortus by bovine trophoblastic cells.

Chorioallantoic membrane (CAM) explants were inoculated, incubated for 4 h, followed by 1 h incubation with gentamicin, and then lysed for intracellular CFU counting. Data represents the average log of CFU numbers from CAM explants, from three independent experiments performed in triplicates. Data underwent logarithmic transformation followed by analysis of variance (ANOVA) and the Tukey's multiple comparison test with significance level of P<0.05.

Transcription profile of bovine trophoblastic cells during infection with wild type, ΔvirB2 or ΔbtpB Brucella abortus 2308 strains

Considering that B. abortus modulates the innate immune response of bovine trophoblastic cells [13], and that TIR domain-containing Brucella proteins, such as BtpB have been shown to impair the host innate immune response [19], whereas the virB-encoded T4SS is required for Brucella survival within host cells [26], a comparison of the transcription profile of bovine trophoblastic cells infected with wild type B. abortus, or the isogenic ΔvirB2 or ΔbtpB strains was performed in this study. A heat map was generated to analyze transcripts with >2 fold change that had statistically significant differences in expression (P<0.05) (Figure 2). Infection of bovine trophoblastic cells with wild type B. abortus 2308 resulted in 80 transcripts with differential levels of expression (i.e. at least a 2-fold change). Among those transcripts, 37 were upregulated and 43 were downregulated. In contrast, infection with ΔvirB2 or ΔbtpB B. abortus mutant strains resulted in a higher number of differentially expressed transcripts (138 and 117, respectively). While the number of downregulated genes was similar between wild type B. abortus and the mutant strains, remarkably, we observed an increased number of upregulated genes in CAM explants infected with both the ΔvirB2 and the ΔbtpB mutants (Figure 2 and 3, Table 2).
Figure 2

Gene transcription profiling of the host response to B. abortus strains at 4 hours after infection of bovine trophoblastic cells.

(A) A heat map of gene transcription changes in bovine trophoblastic cells infected with wild type, ΔvirB2 and ΔbtpB B. abortus– strains, compared to mock-infected controls. (B) Fold changes in gene transcription for genes that were significantly (P<0.05) up or downregulated during wild type, ΔvirB2 and ΔbtpB B. abortus infection compared to mock-infected controls. These data represent results from pools of total RNA obtained from triplicates of CAM explants obtained from four independent experiments. Increase or decrease in mRNA levels are indicated in red or green, respectively.

Figure 3

Venn diagram indicating the number of genes with significant changes in mRNA levels assessed by microarray analysis in bovine trophoblastic cells from CAM explants obtained from 4 placentas at the last trimester of pregnancy (n = 4) infected with wild type, ΔvirB2 and ΔbtpB B. abortus compared to mock-infected controls.

Changes in transcription higher than 2-fold and values of P<0.05 were considered significant. (A) Downregulated genes and (B) upregulated genes. Abbreviations: 4105740 BARC 9BOV cDNA clone 9BOV30_O11 5′ (CK974693), HNF1 homeobox B (HNF1B), Hypothetical protein LOC616908 (LOC616908), LB01613.CR_H15 GC_BGC-16 cDNA clone IMAGE:8082593 (DT810899), Homeobox A4 (HOXA4), N-myc downstream regulated 1 (NDRG1), Ovo-like 1 (Drosophila) (OVOL1), PREDICTED: wingless-type MMTV integration site family, member 8B (WNT8B), Hypothetical LOC516011 (MEI), Q9V5V8_DROME CG13214-PA, isoform A (Q9V5V8), BDP1 protein Fragment (BDP1), Chromosome 15 open reading frame 26 ortholog (C21H15ORF26), Calmodulin binding transcription activator 1 (CAMTA1), GRM1 protein Fragment (GRM1), hCG1653800-like (LOC526866), Na+/K+ transporting ATPase interacting 2 (NKAIN2), Ankyrin repeat domain 52 (ANKRD52), 001128BAMA005012HT BAMA cDNA (BAMA), Ectonucleotide pyrophosphatase/phosphodiesterase 2 (ENPP2), Heat shock 70 kDa protein 1-like (HSPA1L), Hypothetical LOC505551 (MYCBPAP), NDRG family member 4 (NDRG4), PG12B_HUMAN (Q9BX93) Group XIIB secretory phospholipase A2-like protein precursor [TC318659] (PG12B), WSC domain containing 1 (WSCD1), BP250013A20E1 Soares normalized bovine placenta cDNA (BF042192), Contactin 4, isoform c precursor (CNTN4), LysM, putative peptidoglycan-binding, domain containing 3 (LYSMD3), Transient receptor potential channel 2 (TRPC2).

Table 2

Genes with significant decrease in transcription level in bovine trophoblastic cells (chorioallantoic membrane explants) infected with wild type (strain 2308), ΔvirB2, or ΔbtpB in comparison to uninfected controls at 4 hours post infection.

Function* and GenBank identificationStrain** Fold ChangeP value
Cell biogenesis
NOMO3-like protein Fragment [ENSBTAT00000046252]ΔbtpB 2.1800.0420
tubulin polymerization promoting protein [NM_173976]ΔbtpB 2.3530.0004
LMNB2_HUMAN (Q03252) Lamin-B2 [TC345309]ΔvirB2 2.3380.0467
microfibrillar associated protein 5 [NM_174386]ΔvirB2 2.6510.0089
keratin 10 [NM_174377]WT2.5540.0319
Cell cycle/DNA processing
AT rich interactive domain 1A, transcript variant 1 [XM_592084]ΔbtpB 2.3610.0151
hypothetical LOC516011 [XM_594137]ΔbtpB 2.0310.0048
nuclear receptor subfamily 2, group E, member 3 [NM_001167900]ΔbtpB 3.2370.0254
SWI/SNF related, matrix associated [NM_001172224]ΔbtpB 2.1160.0012
centrosomal protein 97 kDa [NM_001192424]ΔvirB2 2.2010.0321
ephrin-A5 [NM_001076432]ΔvirB2 2.2050.0113
hepatocyte nuclear factor 4, alpha [NM_001015557]ΔvirB2 2.3670.0496
misc_RNA (ETV4), miscRNA [ENSBTAT00000010973]ΔvirB2 2.0570.0492
ovo-like 1 [NM_001081521]ΔvirB2 2.1120.0196
polymerase I and transcript release factor [NM_001081731]ΔvirB2 2.9080.0010
zinc finger, ZZ-type with EF-hand domain 1 [XM_864249]ΔvirB2 2.4350.0063
hypothetical LOC516011 [XM_594137]WT2.1090.0476
ovo-like 1 [NM_001081521]WT2.0820.0145
Q6P1W9_HUMAN Histone deacetylase 7 A protein [TC363092]WT2.0410.0057
Cell fate
triple functional domain (PTPRF interacting) [ENSBTAT00000007252]ΔvirB2 2.3060.0159
Defense and inflammation
CD200 molecule [NM_001034620]ΔbtpB 2.0730.0250
platelet/endothelial cell adhesion molecule [NM_174571]ΔbtpB 2.2400.0460
N-myc downstream regulated 1 [NM_001035009]ΔvirB2 2.1890.0192
polymeric immunoglobulin receptor [NM_174143]ΔvirB2 2.2110.0280
chemokine (C-X-C motif) ligand 12 mRNA [NM_001113174]WT5.5270.0436
N-myc downstream regulated 1 [NM_001035009]WT2.2220.0349
pellino homolog 2 [XM_612354]WT2.0400.0366
serine peptidase inhibitor. Kazal type 5 [NM_001102102]WT2.1180.0015
TRAF2 and NCK interacting kinase [ENSBTAT00000015600]WT2.2110.0097
Signal transduction
oculocerebrorenal syndrome of [NM_001102191]ΔbtpB 2.9560.0060
odorant receptor MOR10-like [XM_591864]ΔbtpB 4.4760.0062
neurogranin (protein kinase C substrate. RC3) [NM_001113313]ΔvirB2 2.4140.0222
olfactory receptor Olfr399-like [XM_002695734]ΔvirB2 2.2140.0109
olfactory receptor. family 13. subfamily C. member 3-like [XM_001256440]ΔvirB2 2.0030.0077
wingless-type MMTV integration site family. member 8B [XM_582222]ΔvirB2 2.0170.0492
olfactory receptor Olr136-like [XM_002693219]WT2.1060.0471
olfactory receptor Olr1654-like [XM_001255032]WT2.0010.0205
olfactory receptor Olr1654 [XM_001255418]WT2.0250.0407
olfactory receptor. family 4. subfamily K. member 13-like [XM_001255280]WT2.0480.0460
phosphodiesterase 7A [ENSBTAT00000015427]WT2.0250.0092
wingless-type MMTV integration site family. member 5B [XM_584724]WT2.4340.0412
wingless-type MMTV integration site family. member 8B [XM_582222]WT2.2830.0412
Transport
1254442 MARC 7BOV cDNA 5′ [DN516021]ΔbtpB 2.6590.0189
ELMO/CED-12 domain containing 1 [NM_001078108]ΔbtpB 2.1350.0376
ArfGAP with SH3 domain. ankyrin repeat and PH domain 2 [ENSBTAT00000003007]ΔvirB2 2.0030.0184
sodium channel. voltage-gated. type V. alpha subunit [NM_174458]ΔvirB2 2.2160.0095
syntaxin-1B (Syntaxin-1B2) (Synaptocanalin I) [ENSBTAT00000044107]ΔvirB2 2.0200.0409
discs. large homolog [NM_001191307]WT2.1320.0067
N-ethylmaleimide-sensitive factor attachment protein. beta [NM_001046233]WT2.1220.0228
potassium voltage-gated channel. shaker-related subfamily. beta member 1 [NM_001025336]WT2.8700.0002
RAB6A. member RAS oncogene family (RAB6A). mRNA [NM_001193115]WT2.4770.0284
Systemic development
Ellis van Creveld syndrome 2 [NM_173927]ΔbtpB 2.0300.0344
HNF1 homeobox B [NM_001192855]ΔbtpB 2.2860.0035
HUMHRX {Homo sapiens} (exp = −1; wgp = 0; cg = 0) [TC345413]ΔbtpB 2.1700.0209
myeloid/lymphoid or mixed-lineage leukemia [NM_001192549]ΔbtpB 2.4640.0004
HNF1 homeobox [NM_001192855]ΔvirB2 2.4260.0167
homeobox A4 [NM_001076134]ΔvirB2 2.3158 E-05
mitofusin 2 (MFN2). transcript variant 1 [NM_001190269]ΔvirB2 2.3710.0020
myeloid/lymphoid or mixed-lineage leukemia [NM_001192025]ΔvirB2 2.0310.0124
homeobox A4 [NM_001076134]WT2.0050.0010
Interaction with environment
contactin-4-like [XM_600040]ΔbtpB 2.4850.0004
extracellular matrix protein 2. female organ and adipocyte specific [NM_001034597]ΔbtpB 2.1500.0377
neurocan (NCAN). mRNA [NM_001193082]ΔvirB2 2.2010.0117
Neuronal cell adhesion molecule Fragment [ENSBTAT00000008864]ΔvirB2 2.0470.0035
binder of sperm 1[NM_001001145]WT2.1850.0221
neuroligin 2 [NM_001191242]WT2.0010.0026
SCO-spondin homolog mRNA [NM_174706]WT2.1430.0118
Metabolism
4-hydroxyphenylpyruvate dioxygenase-like [NM_001099371]ΔbtpB 2.0380.0057
acyl-CoA dehydrogenase. long chain (ACADL) [NM_001076936]ΔbtpB 2.0220.0375
inter-alpha (globulin) inhibitor H3 [NM_001101898]ΔvirB2 2.1120.0272
phospholipase A2. group [NM_001193052]ΔvirB2 2.1270.0342
pipecolic acid oxidase [NM_001014878]ΔvirB2 2.2060.0239
steryl-sulfatase-like [XM_001789191]ΔvirB2 2.0390.0008
adenosine deaminase. RNA-specific [ENSBTAT00000009896]WT2.3420.0200
ADP-ribosyltransferase 5 [NM_001076515]WT2.2040.0048
phosphoinositide-3-kinase. catalytic. delta polypeptide [XM_580673]WT2.0740.0283
retinol dehydrogenase 12 (all-trans/9-cis/11-cis) [NM_183363]WT2.1890.0146
Protein fate
leucine rich repeat containing 41 (LRRC41) [NM_001045873]ΔbtpB 2.3720.0161
peptidylprolyl isomerase (cyclophilin)-like 2 [NM_001038081]ΔbtpB 2.0140.0093
ribosomal protein S6 kinase. 90 kDa. polypeptide 4 [NM_001191400]ΔbtpB 2.3900.0029
F-box protein 32 [NM_001046155]ΔvirB2 2.3410.0159
Protein synthesis
eukaryotic elongation factor-2 kinase (EEF2K). mRNA [NM_001192542]ΔvirB2 2.0560.0075
alanyl-tRNA synthetase 2. mitochondrial (putative) [NM_001191211]WT2.0660.0296
Binding function
EH domain binding protein 1-like 1 [NM_001191243]ΔbtpB 2.1200.0095
PR domain containing 13 [NM_001193010]ΔbtpB 2.0780.0181
suppressor of sable-like [XM_582657]ΔbtpB 2.5820.0487
syndecan binding protein (syntenin) 2 [ENSBTAT00000039310]ΔvirB2 2.1710.0358
Regulation of metabolism
cystatin SC [NM_001038122]ΔbtpB 2.2760.0247
Serine protease inhibitor Kazal-type 6 Precursor [ENSBTAT00000047606]ΔbtpB 2.2120.0325
dedicator of cytokinesis 4 [XM_613918]ΔvirB2 2.0060.0180
LB00228.CR_H15 GC_BGC-02 cDNA clone IMAGE:7950401 [DT823428]WT2.0670.0031
Transcription
Q5TAY6_HUMAN (Q5TAY6) Zinc finger protein 31 [TC342188]ΔbtpB 2.1080.0298
zinc finger and BTB domain containing 9 [NM_001191462]ΔbtpB 2.0450.0121
zinc finger protein 296 [NM_001192262]ΔbtpB 2.5380.0158
zinc finger protein 30 homolog [XR_083922]ΔbtpB 2.2950.0294
LB02718.CR_O08 GC_BGC-27 cDNA clone IMAGE:8313058 [DV891009]ΔvirB2 2.9980.0025
FtsJ methyltransferase domain containing 2 [NM_001082430]WT2.0430.0280
hypothetical LOC618701 [NM_001099723]WT2.3160.0041
lin-28 homolog B [XM_612469]WT2.0240.0152
sterol regulatory element Binding Protein family member (sbp-1)-like [XM_583656]WT2.0870.0268
zinc finger protein 213 [ENSBTAT00000037526]WT2.5060.0012
zinc finger protein 42. transcript variant 7 [XM_872583]WT2.3020.0396
Unclassified
4105740 BARC 9BOV cDNA clone 9BOV30_O11 5′ [CK974693]ΔbtpB 2.3810.0330
4121344 BARC 8BOV cDNA clone 8BOV_34C06 5′ [CN787257]ΔbtpB 2.1890.0149
chromosome 16 open reading frame 7 [XM_592406]ΔbtpB 2.0990.0197
hypothetical protein LOC616908 [NM_001076437]ΔbtpB 2.3110.0208
LRRN4 C-terminal like [NM_001195069]ΔbtpB 2.0240.0208
Q9V5V8_DROME (Q9V5V8) CG13214-PA [TC333751]ΔbtpB 2.7040.0059
1429623 MARC 7BOV cDNA 3′ [DR113203]ΔvirB2 2.1930.0128
4105740 BARC 9BOV cDNA clone 9BOV30_O11 5′ [CK974693]ΔvirB2 2.7060.0170
AL450489 match: proteins: Q8VCL4 Q9CUK0 Q9Y4E5 [TC317712]ΔvirB2 2.0010.0179
family with sequence similarity 3. member D. transcript variant 2 [XM_865037]ΔvirB2 2.1440.0251
hypothetical protein LOC616908 [NM_001076437]ΔvirB2 2.5580.0058
LB01613.CR_H15 GC_BGC-16 cDNA clone IMAGE:8082593 [DT810899]ΔvirB2 2.0350.0297
LB01652.CR_A20 GC_BGC-16 cDNA clone IMAGE:8385118 5′ [EH174578]ΔvirB2 2.0940.0009
misc_RNA (LOC785410). miscRNA [ENSBTAT00000025153]ΔvirB2 2.0410.0060
similar to Myeloid-associated differentiation marker [NM_001101279]ΔvirB2 2.1770.0396
chromosome 10 open reading frame 120 ortholog [NM_001076476]WT2.2370.0331
hypothetical LOC619120 [XM_871440]WT2.2080.0093
hypothetical LOC785309 [XM_001253376]WT2.0280.0256
LB01613.CR_H15 GC_BGC-16 cDNA clone IMAGE:8082593 [DT810899]WT2.2430.0250
MIPOL1 protein [ENSBTAT00000000857]WT2.5710.0281
misc_RNA (LOC524074). miscRNA [ENSBTAT00000000329]WT2.0400.0279
Q9V5V8_DROME (Q9V5V8) CG13214-PA. isoform A [TC333751]WT2.5410.0239

*Functional classification generated by Funcat (http://mips.helmholtz-muenchen.de/genre/proj/mfungd/Search/Catalogs/searchCatfirstFun.html);

**WT = wild type Brucella abortus 2308.

Gene transcription profiling of the host response to B. abortus strains at 4 hours after infection of bovine trophoblastic cells.

(A) A heat map of gene transcription changes in bovine trophoblastic cells infected with wild type, ΔvirB2 and ΔbtpB B. abortus– strains, compared to mock-infected controls. (B) Fold changes in gene transcription for genes that were significantly (P<0.05) up or downregulated during wild type, ΔvirB2 and ΔbtpB B. abortus infection compared to mock-infected controls. These data represent results from pools of total RNA obtained from triplicates of CAM explants obtained from four independent experiments. Increase or decrease in mRNA levels are indicated in red or green, respectively.

Venn diagram indicating the number of genes with significant changes in mRNA levels assessed by microarray analysis in bovine trophoblastic cells from CAM explants obtained from 4 placentas at the last trimester of pregnancy (n = 4) infected with wild type, ΔvirB2 and ΔbtpB B. abortus compared to mock-infected controls.

Changes in transcription higher than 2-fold and values of P<0.05 were considered significant. (A) Downregulated genes and (B) upregulated genes. Abbreviations: 4105740 BARC 9BOV cDNA clone 9BOV30_O11 5′ (CK974693), HNF1 homeobox B (HNF1B), Hypothetical protein LOC616908 (LOC616908), LB01613.CR_H15 GC_BGC-16 cDNA clone IMAGE:8082593 (DT810899), Homeobox A4 (HOXA4), N-myc downstream regulated 1 (NDRG1), Ovo-like 1 (Drosophila) (OVOL1), PREDICTED: wingless-type MMTV integration site family, member 8B (WNT8B), Hypothetical LOC516011 (MEI), Q9V5V8_DROME CG13214-PA, isoform A (Q9V5V8), BDP1 protein Fragment (BDP1), Chromosome 15 open reading frame 26 ortholog (C21H15ORF26), Calmodulin binding transcription activator 1 (CAMTA1), GRM1 protein Fragment (GRM1), hCG1653800-like (LOC526866), Na+/K+ transporting ATPase interacting 2 (NKAIN2), Ankyrin repeat domain 52 (ANKRD52), 001128BAMA005012HT BAMA cDNA (BAMA), Ectonucleotide pyrophosphatase/phosphodiesterase 2 (ENPP2), Heat shock 70 kDa protein 1-like (HSPA1L), Hypothetical LOC505551 (MYCBPAP), NDRG family member 4 (NDRG4), PG12B_HUMAN (Q9BX93) Group XIIB secretory phospholipase A2-like protein precursor [TC318659] (PG12B), WSC domain containing 1 (WSCD1), BP250013A20E1 Soares normalized bovine placenta cDNA (BF042192), Contactin 4, isoform c precursor (CNTN4), LysM, putative peptidoglycan-binding, domain containing 3 (LYSMD3), Transient receptor potential channel 2 (TRPC2). *Functional classification generated by Funcat (http://mips.helmholtz-muenchen.de/genre/proj/mfungd/Search/Catalogs/searchCatfirstFun.html); **WT = wild type Brucella abortus 2308. These results indicated that downregulation of host trophoblastic cell transcripts at early stages of infection is directly or indirectly associated with the virB Type IV secretion system and BtpB.

Wild type B. abortus impairs host transcription of genes related to immune response when compared to ΔvirB and ΔbtpB mutants

Differentially expressed transcripts of trophoblastic cells in response to infection with wild type B. abortus or the ΔvirB2 and ΔbtpB mutant strains were functionally classified (Tables 2 and 3). Explants infected with wild type B. abortus had the highest number of downregulated genes that are related to signal transduction (7/43; 16.2%), transcription (6/43; 13.9%), and defense and inflammation (5/43; 11.6%). Upregulated transcripts were related to metabolism (6/37; 16.2%), transport (5/37; 16.2%), and signal transduction (4/37; 10.8%). Explants infected with the ΔvirB2 mutant strain had downregulated transcripts mostly in the following categories: cell cycle/DNA processing (7/44; 15.9%), metabolism (4/44; 9.1%), and signal transduction (4/44; 9.1%), and upregulated genes related to defense and inflammation (17/94; 18.0%), metabolism (14/94; 14.8%), and signal transduction (8/94; 8.5%). Explants infected with the ΔbtpB strain had larger numbers of downregulated transcripts associated with cell cycle/DNA processing (4/38; 10.5%), transcription (4/38; 10.5%), and systemic development (4/38; 10.5%). Genes upregulated were classified as transport-related (10/79; 12.6%), signal transduction (9/79; 11.3%), and cell cycle/DNA processing (7/79; 8.8%) (Figure 4, Table 3). Interestingly, while in wild type B. abortus-infected explants most of the differentially expressed transcripts that were classified as associated with defense and inflammation were downregulated (5/7; 71.4%), explants infected with either the ΔvirB2 or ΔbtpB strains had mostly upregulated transcripts in that category (17/19; 89.4%), supporting the idea that infection by B. abortus 2308 causes a downregulation of the immune response at early stages of infection in order to prevent a robust inflammatory response. Therefore, deletion of the virulence genes virB2 and btpB results in strains that trigger increased transcription of several genes related to the immune response.
Table 3

Genes with significant increase in transcription level in bovine trophoblastic cells (chorioallantoic membrane explants) infected with wild type (strain 2308), ΔvirB2, or ΔbtpB in comparison to uninfected controls at 4 hours post infection.

Function* and GenBank identification B. abortus infection** Fold ChangeP value
Cell biogenesis
actin. gamma 2. smooth muscle. enteric [NM_001013592]ΔbtpB 3.3880.0139
calponin 1. basic. smooth muscle [NM_001046379]ΔbtpB 3.0470.0061
LysM. putative peptidoglycan-binding. domain containing 3 [NM_001192982]ΔbtpB 2.4040.0076
myosin. heavy chain 11. smooth muscle [NM_001102127]ΔbtpB 2.9860.0016
tropomyosin 1 (alpha) [NM_001013590]ΔbtpB 2.0480.0243
tropomyosin 2 (beta) [NM_001010995]ΔbtpB 2.7100.0047
keratin 6A [NM_001083510]ΔvirB2 3.4740.0202
matrilin 3 [XM_591137]ΔvirB2 5.0586 E-05
myosin light chain 2a-like (LOC789339) [XM_001256122]ΔvirB2 2.8170.0170
LysM. putative peptidoglycan-binding. domain containing 3 [NM_001192982]WT2.2040.0357
Cell cycle/DNA processing
esophageal cancer related gene 4 protein [NM_001038113]ΔbtpB 3.5990.0450
establishment of cohesion 1 homolog 2-like (LOC786089 [XM_001253877]ΔbtpB 2.1200.0201
HUMRECQ DNA helicase [TC350379]ΔbtpB 2.1480.0214
NDC80 homolog. kinetochore complex component [XM_582722]ΔbtpB 2.1820.0184
PC4 and SFRS1-interacting protein [ENSBTAT00000036721]ΔbtpB 2.0240.0350
polycomb group ring finger 5 [NM_001077980]ΔbtpB 2.9100.0040
SRY (sex determining region Y)-box 7 [XM_615317]ΔbtpB 2.1220.0205
cAMP responsive element modulator [NM_001034710]ΔvirB2 2.0590.0380
histone cluster 1. H1d (HIST1H1D) [NM_001101066]ΔvirB2 2.2920.0155
nuclear receptor coactivator 7 [ENSBTAT00000049978]ΔvirB2 2.3450.0433
centromere-binding factor 5 like PUA domain containing protein with a type I pseudouridine synthase domain [TC372398]ΔvirB2 6.1120.0379
SAMD9_HUMAN Sterile alpha motif domain-containing protein 9 [TC347659]ΔvirB2 2.1190.0026
T-box 19 mRNA [NM_001075663]ΔvirB2 2.1350.0244
Defense and inflammation
CCAAT/enhancer binding protein (C/EBP). epsilon [NM_001192808]ΔbtpB 2.4940.0084
complement factor H (CFH) [NM_001033936]ΔbtpB 3.1720.0291
tumor necrosis factor (ligand) superfamily. member 10-like [XM_583785]ΔbtpB 3.2900.0267
tumor necrosis factor receptor superfamily. member 13C [NM_001193192]ΔbtpB 2.6920.0317
apolipoprotein L. 3 [NM_001100351]ΔvirB2 3.1910.0168
chemokine (C-C motif) ligand 5 mRNA [NM_175827]ΔvirB2 2.1210.0331
chemokine (C-C motif) receptor-like 2 [NM_001075732]ΔvirB2 2.1650.0295
chemokine (C-X-C motif) receptor 5 [NM_001011675]ΔvirB2 2.0760.0285
chemokine binding protein 2 [NM_001015581]ΔvirB2 2.0680.0105
complement component 3a receptor 1 [NM_001083752]ΔvirB2 2.8510.0072
Fc fragment of IgG binding protein [XM_614095]ΔvirB2 2.0720.0406
fms-related tyrosine kinase 3-like [XM_590263]ΔvirB2 2.6520.0419
heat shock 70 kDa protein 1-like [NM_001167895]ΔvirB2 2.1500.0015
interleukin 1 family. member 6 (epsilon)-like (IL1F6) [XM_601728]ΔvirB2 4.0250.0148
interleukin 15 [NM_174090]ΔvirB2 5.2500.0004
interleukin 2 receptor. alpha [NM_174358]ΔvirB2 2.6690.0156
MPV17 mitochondrial membrane protein-like [NM_001046602]ΔvirB2 2.1340.0018
radical S-adenosyl methionine domain containing 2 [NM_001045941]ΔvirB2 2.8240.0480
rCG28728-like (LOC533818) Protein Gbp4 [XM_001789771]ΔvirB2 2.3020.0076
transmembrane 4 L six family member 19 [ENSBTAT00000057570]ΔvirB2 4.0740.0023
tumor necrosis factor receptor superfamily. member 9 [NM_001035336]ΔvirB2 4.2460.0294
heat shock 70 kDa protein 1-like [NM_001167895]WT2.0170.0055
toll-like receptor 6 [NM_001001159]WT2.1110.0407
Cell differentiation
neuropilin 2 [NM_001193237]ΔvirB2 2.6810.0464
Signal transduction
A kinase (PRKA) anchor protein 12 [XM_591518]ΔbtpB 2.1520.0478
ADAM metallopeptidase with thrombospondin type 1 motif. 6 [NM_001193016]ΔbtpB 2.1940.0198
GRM1 protein Fragment [ENSBTAT00000057021]ΔbtpB 2.7790.0282
olfactory receptor Olr1242-like (LOC788607) [XM_001255616]ΔbtpB 2.0010.0184
olfactory receptor. family 11. subfamily G. member 2-like [XM_002690673]ΔbtpB 2.1220.0021
olfactory receptor. family 2. subfamily A. member 4-like [XM_001790464]ΔbtpB 2.8130.0035
Q2ABB1_BOVIN (Q2ABB1) Bitter taste receptor. partial (12%) [TC320439]ΔbtpB 2.0660.0299
Ras-related associated with diabetes [NM_001045913]ΔbtpB 2.3940.0208
spermatogenesis associated 7 [NM_001098928]ΔbtpB 2.4110.0332
brain and acute leukemia. cytoplasmic [NM_001083508]ΔvirB2 2.8540.0281
cerebellin 3 precursor [NM_001079603]ΔvirB2 2.9670.0233
draxin [NM_001195012]ΔvirB2 2.1110.0437
EDAR-associated death domain [ENSBTAT00000061420]ΔvirB2 4.1270.0499
G protein-coupled receptor 115 [NM_001143875]ΔvirB2 3.9830.0298
GRM1 protein Fragment [ENSBTAT00000057021]ΔvirB2 2.1800.0058
prostaglandin E receptor 2 (subtype EP2) [NM_174588]ΔvirB2 2.0550.0338
thromboxane A2 receptor [NM_001167919]ΔvirB2 2.2250.0365
olfactory receptor. family 5. subfamily I. member 1-like [XM_002693698]WT2.3880.0441
olfactory receptor. family 8. subfamily A. member 1-like [XM_581848]WT2.1310.0329
PIGLHHCGB luteinizing hormone receptor precursor variant B [TC374819]WT2.0410.0479
similar to obscurin. cytoskeletal calmodulin and titin-interacting RhoGEF [NM_001102196]WT2.0940.0228
Transport
BC015727 solute carrier organic anion transporter family member 4A1 [TC352480]ΔbtpB 2.2830.0079
ceruloplasmin-like [XM_002685007]ΔbtpB 2.0250.0133
cytochrome P450. family 4. subfamily V. polypeptide 2 [NM_001034373]ΔbtpB 2.1850.0105
hephaestin-like [XM_587920]ΔbtpB 2.2250.0456
Na+/K+ transporting ATPase interacting 2 [NM_001102345]ΔbtpB 2.0370.0496
phosphatidylinositol binding clathrin assembly protein [NM_001101977]ΔbtpB 2.1320.0410
potassium inwardly-rectifying channel. subfamily J. member 10 [NM_001081601]ΔbtpB 2.5260.0063
RAB GTPase activating protein 1-like [NM_001103263]ΔbtpB 3.0330.0415
reticulon 1 [ENSBTAT00000015218]ΔbtpB 2.2640.0315
ryanodine receptor 3 [XM_590220]ΔbtpB 3.0200.0285
AB051866 RIM long form [TC358572]ΔvirB2 2.0410.0086
ATPase. H+ transporting V0 subunit e2 [NM_001097574]ΔvirB2 2.0070.0134
Na+/K+ transporting ATPase interacting 2 [NM_001102345]ΔvirB2 2.1370.0129
potassium inwardly-rectifying channel. subfamily J. member 13 [NM_001193254]ΔvirB2 2.1760.0023
potassium voltage-gated channel. subfamily H (eag-related) [NM_001191394]ΔvirB2 2.4290.0015
small calcium-binding mitochondrial carrier 1-like [XM_609165]ΔvirB2 2.1540.0417
solute carrier organic anion transporter family [XM_002689417]ΔvirB2 2.0260.0265
ATPase. Ca++ transporting. plasma membrane 2 [NM_001191245]WT2.2510.0153
component of oligomeric golgi complex 5 [BC149439]WT2.1430.0081
Na+/K+ transporting ATPase interacting 2 (NKAIN2). mRNA [NM_001102345]WT3.0870.0001
sodium-dependent noradrenaline transporter [ENSBTAT00000046433]WT2.1880.0049
unc-13 homolog C [XM_001249446]WT2.5200.0306
Systemic development
shisa homolog 2 [NM_001101265]ΔbtpB 2.1970.0304
NDRG family member 4 [NM_001075695]ΔvirB2 2.0540.0350
Q69Z70_MOUSE (Q69Z70) MKIAA1910 protein (Fragment) [TC349493]ΔvirB2 2.2880.0273
NDRG family member 4 [NM_001075695]WT2.5330.0276
Interaction with environment
BC026119 contactin 4. isoform c precursor [TC348690]ΔbtpB 2.7470.0276
SCO-spondin homolog [NM_174706]ΔbtpB 2.1030.0497
AF311284 erythroid membrane-associated protein [TC330508]ΔvirB2 2.9430.0056
ectonucleotide pyrophosphatase/phosphodiesterase 2 [NM_001080293]ΔvirB2 2.2080.0225
BC026119 contactin 4. isoform c precursor [TC348690]WT2.7773 E-05
ectonucleotide pyrophosphatase/phosphodiesterase 2 [NM_001080293]WT2.1930.0290
kinesin family member 3B-like. transcript variant 3 [XM_863957]WT2.7780.0242
Metabolism
Acp1 protein-like [XM_868782]ΔbtpB 3.1370.0429
ATPase. Na+/K+ transporting. alpha 2 polypeptide [NM_001081524]ΔbtpB 2.4190.0372
glycerol kinase [NM_001075236]ΔbtpB 2.550.0022
mitochondrial carnitine palmitoyltransferase 1A [FJ415874]ΔbtpB 2.0690.0432
phospholipid scramblase 4 [NM_001081732]ΔbtpB 2.38999580.0197
transient receptor potential channel 2 [NM_174477]ΔbtpB 2.500790.0329
acyl-CoA synthetase short-chain family member 2 [NM_001105339]ΔvirB2 2.1830.0024
acylglycerol kinase [NM_001098969]ΔvirB2 2.2560.0417
ankyrin repeat domain 52 [NM_001192530]ΔvirB2 2.3190.0195
cDNA clone IMAGE:8166104 [BC114144]ΔvirB2 3.9040.0002
cDNA clone IMAGE:8233560 [BC153862]ΔvirB2 2.4130.0455
cytochrome P450. family 2. subfamily J. polypeptide 2-like [XM_587546]ΔvirB2 2.4190.0104
glycine-N-acyltransferase [NM_177513]ΔvirB2 2.8110.0005
LOC781710 protein Fragment [ENSBTAT00000056121]ΔvirB2 3.6990.0107
nicotinamide nucleotide adenylyltransferase 2 [NM_001075486]ΔvirB2 2.1620.0180
PG12B_HUMAN Group XIIB secretory phospholipase A2-like protein precursor [TC318659]ΔvirB2 2.0300.0275
Q6UWU2_HUMAN (Q6UWU2) APKK229 [TC386487]ΔvirB2 2.2040.0345
UDP glucuronosyltransferase 1 family. polypeptide A1 [NM_001105636]ΔvirB2 3.9700.0026
WNK lysine deficient protein kinase 2 [XM_582977]ΔvirB2 2.0590.0433
WSC domain containing 1 [XM_617236]ΔvirB2 2.2110.0212
ankyrin repeat domain 52 [NM_001192530]WT2.1780.0400
glutathione S-transferase. theta 3-like [XM_001256131]WT2.3450.0440
PG12B_HUMAN Group XIIB secretory phospholipase A2-like protein precursor [TC318659]WT2.2600.0337
polo-like kinase 3 [NM_001075153]WT2.7990.0023
transient receptor potential channel 2 [NM_174477]WT2.0670.0262
WSC domain containing 1 [XM_617236]WT2.0240.0180
Protein fate
ADAMTS-like 3 [Source:HGNC Symbol;Acc:14633] [ENSBTAT00000006101]ΔbtpB 3.1140.0331
carboxypeptidase E [NM_173903]ΔbtpB 3.0770.0390
F-box protein 16 [NM_001078119]ΔbtpB 2.7100.0311
ubiquitin specific protease 16-like. transcript variant 2 [XM_866110]ΔbtpB 2.1800.0066
von Hippel-Lindau tumor supressor [NM_001110019]ΔbtpB 2.2790.0439
YOD1 OTU deubiquinating enzyme 1 homolog [NM_001080309]ΔbtpB 2.5090.0374
ADAM metallopeptidase with thrombospondin type 1 motif. 3 [NM_001192797]ΔvirB2 2.6590.0124
heat shock 22 kDa protein 8 [NM_001014955]ΔvirB2 2.3370.0349
misc_RNA (LOC613597). miscRNA [ENSBTAT00000019285]WT2.3150.0422
Binding function
ELAV (embryonic lethal. abnormal vision. Drosophila)-like 4ΔbtpB 2.1260.0388
multiple C2 domains. transmembrane 2 [BC118493]ΔbtpB 2.3660.0429
PHD finger protein 14 [BC148049]ΔbtpB 2.4710.0011
phosphodiesterase 4D interacting protein [ENSBTAT00000061284]ΔbtpB 3.1210.0365
RNA binding motif protein 20 [NM_001192613]ΔbtpB 2.5260.0167
RUN and FYVE domain containing 4 [NM_001102081]ΔbtpB 2.3200.0400
calcineurin-like phosphoesterase domain containing 1 [NM_001031771]ΔvirB2 2.0200.0497
hypothetical LOC505551 [XM_581851]ΔvirB2 2.4330.0181
ribosomal protein SA-like [XR_083612]ΔvirB2 2.0370.0153
RNA binding motif protein 43 [NM_001099168]ΔvirB2 2.1860.0282
TRIM6-TRIM34 readthrough [NM_001046461]ΔvirB2 2.2230.0417
tripartite motif-containing 55. transcript variant 1 [XM_001789975]ΔvirB2 4.2790.0149
hypothetical LOC505551 [XM_581851]WT2.4560.0446
Regulation of metabolism
ArfGAP with coiled-coil. ankyrin repeat and PH domains 2 [NM_001105337]ΔbtpB 2.9090.0049
RPTOR independent companion of MTOR. complex 2 [NM_001144096]ΔbtpB 2.1470.0249
low density lipoprotein receptor-related protein 8. apolipoprotein e receptor [NM_001097565]ΔvirB2 2.6300.0135
regulator of G-protein signaling 16 [NM_174450]ΔvirB2 2.0470.0101
family with sequence similarity 129. member A [NM_001191282]WT2.3010.0063
Transcription
BDP1 protein Fragment [ENSBTAT00000000471]ΔbtpB 2.2260.0048
calmodulin binding transcription activator 1 [NM_001100294]ΔbtpB 2.3360.0111
pseudouridylate synthase 7 homolog (S. cerevisiae)-likeΔbtpB 2.0520.0460
regulation of nuclear pre-mRNA domain-containing protein 2 (RPRD2)ΔbtpB 2.1390.0382
regulatory factor X 7 [NM_001192820]ΔbtpB 2.1360.0104
TBP-associated factor 11 [XM_867002]ΔbtpB 2.7470.0340
zinc finger protein 667 [NM_001102078]ΔbtpB 2.5600.0113
adenosine deaminase. RNA-specific. B2 [NM_001192588]ΔvirB2 2.0430.0150
BDP1 protein Fragment [ENSBTAT00000000471]ΔvirB2 2.3200.0031
calmodulin binding transcription activator 1 [NM_001100294]ΔvirB2 2.0640.0012
EP300 interacting inhibitor of differentiation 3 [NM_001100312]ΔvirB2 2.1810.0017
zinc finger protein 565 [NM_001102216]ΔvirB2 2.1410.0036
POU class 6 homeobox 2 [NM_001102046]WT3.3000.0430
TOX high mobility group box family member 3 [XM_880075]WT2.3460.0435
Elements of external origin
Q52KE6_MOUSE (Q52KE6) Pgbd5 protein [TC306097]WT2.1200.0246
Unclassified
A17601A FFB cDNA clone A1760 3′ [EE903511]ΔbtpB 2.2430.0274
BP250013A20E1 Soares normalized bovine placenta cDNA [BF042192]ΔbtpB 3.3740.0263
chromosome 15 open reading frame 26 ortholog [NM_001075536]ΔbtpB 2.1450.0133
chromosome 9 open reading frame 30 ortholog [NM_001076019]ΔbtpB 2.1110.0187
hCG1653800-like [XM_002695883]ΔbtpB 2.8530.0319
hypothetical protein LOC100125939 [NM_001105502]ΔbtpB 2.1310.0483
hypothetical protein LOC534992 [NM_001079608]ΔbtpB 2.2900.0212
LB029104.CR.1_D17 GC_BGC-29 cDNA clone IMAGE:8491939 [EE363922]ΔbtpB 2.7400.0270
LB03019.CR_A20 GC_BGC-30 cDNA clone IMAGE:8139166 [DV930234]ΔbtpB 2.2180.0201
misc_RNA (LOC784747). miscRNA [ENSBTAT00000002161]ΔbtpB 2.4160.0075
myeloid-associated differentiation marker-like [XM_608387]ΔbtpB 2.1390.0025
Q4SMS2_TETNG (Q4SMS2) Chromosome 8 SCAF14545 [TC378905]ΔbtpB 2.1170.0304
trophoblast Kunitz domain protein 5-like [XR_083836]ΔbtpB 3.0240.0220
001128BAMA005012HT BAMA cDNA [DY090836]ΔvirB2 2.8893 E-05
596479 MARC 6BOV cDNA 3′ [CB423273]ΔvirB2 2.1060.0237
cDNA clone IMAGE:8190996 [BC119997]ΔvirB2 2.1080.0029
chromosome 15 open reading frame 26 ortholog [NM_001075536]ΔvirB2 2.0430.0057
hCG1653800-like [XM_002695883]ΔvirB2 2.7800.0446
Hw_FAT_14_050513_F05 CF-24-HW fat cDNA library cDNA[DV775976]ΔvirB2 2.1130.0218
hypothetical LOC100140997 [XM_001787456]ΔvirB2 2.5230.0305
hypothetical LOC514143 [XM_591946]ΔvirB2 2.7600.0153
hypothetical LOC524181 [XM_002702390]ΔvirB2 2.2240.0180
hypothetical LOC614176 [XM_865557]ΔvirB2 2.2090.0181
LB004140.C21_N19 GC_BGC-04 cDNA clone IMAGE:9059349 3′ [EV693857]ΔvirB2 2.0070.0298
LB02816.CR_B07 GC_BGC-28 cDNA clone IMAGE:8225577 [DV909965]ΔvirB2 2.0040.0107
LB02963.CR_E02 GC_BGC-29 cDNA clone IMAGE:8476204 [EE364260]ΔvirB2 2.8540.0497
misc_RNA (LOC100140452). miscRNA [ENSBTAT00000053419]ΔvirB2 2.8510.0383
P-glycoprotein Fragment [ENSBTAT00000047541]ΔvirB2 3.0310.0386
putative uncharacterized protein FLJ41210 Fragment [ENSBTAT00000010299]ΔvirB2 2.1770.0388
Q61107_MOUSE (Q61107) Purine nucleotide binding protein [TC353960]ΔvirB2 2.3830.0108
similar to LOC129881 protein [XM_868516]ΔvirB2 2.9880.0424
uncharacterized protein ENSP00000334415 homolog [NM_001110092]ΔvirB2 2.0420.0338
001128BAMA005012HT BAMA cDNA [DY090836]WT2.1480.0013
693743 MARC 6BOV cDNA 3′ [CB442901]WT2.6290.0263
cDNA clone IMAGE:8031759 [BC149666]WT2.0180.0354
coiled-coil domain containing 54 [NM_001105490]WT2.0430.0249
hypothetical protein LOC785476 [NM_001099194]WT2.1520.0139
Q4SID5_TETNG (Q4SID5) Chromosome 5 SCAF14581 [TC371777]WT2.2990.0367
Q5JS37_HUMAN (Q5JS37) OTTHUMP00000018294 [TC345240]WT2.1270.0460
uMC-bcl_0B02-014-e08 Day 14 CL from a pregnant animal bcl cDNA 3′ [CV976853]WT2.7750.0030

*Functional classification generated by Funcat (http://mips.helmholtz-muenchen.de/genre/proj/mfungd/Search/Catalogs/searchCatfirstFun.html);

**WT = wild type Brucella abortus 2308.

Figure 4

Functional classification of genes with significant changes in transcription levels in bovine trophoblastic cells at 4 hours after infection with wild type, ΔvirB2, and ΔbtpB B. abortus.

(A) Downregulated genes, and (B) upregulated genes in comparison to mock-infected controls.

Functional classification of genes with significant changes in transcription levels in bovine trophoblastic cells at 4 hours after infection with wild type, ΔvirB2, and ΔbtpB B. abortus.

(A) Downregulated genes, and (B) upregulated genes in comparison to mock-infected controls. *Functional classification generated by Funcat (http://mips.helmholtz-muenchen.de/genre/proj/mfungd/Search/Catalogs/searchCatfirstFun.html); **WT = wild type Brucella abortus 2308.

Transcription of genes related to immune response during the early stages of infection of bovine trophoblasts with wild type, ΔvirB2 or ΔbtpB B. abortus strains

Considering that acute inflammation in the placenta is a hallmark of B. abortus infection in cattle [7] and that B. abortus influences expression of proinflammatory transcripts by bovine trophoblastic cells [13], here we focused the analysis of differentially expressed transcripts associated with defense and inflammation. The microarray data presented above demonstrated downregulation of transcripts in wild type B. abortus-infected explants that included chemokines, genes involved in signaling pathways by TLR, in regulation of proliferation and cellular differentiation, cellular response to stress and anti-inflammatory responses. Only two genes in these categories had significantly increased transcription, namely: Toll-like receptor 6 (TLR6) and heat shock 70 kDa protein 1-like (HSPA1L) (Figure 5B). In contrast, trophoblastic cells infected with either the ΔvirB2 mutant strain or the ΔbtpB strain had a significant increase of transcripts of cytokines and chemokines as well as genes associated with the complement cascade (Figure 5C). Transcription of only two genes related to defense and inflammation were significantly decreased, namely platelet/endothelial cell adhesion molecule (PECAM1) and CD200 molecule (C200) (Figure 5D).
Figure 5

Changes in transcript abundance of defense and inflammation genes during infection of bovine trophoblastic cells with wild type, ΔvirB2 and ΔbtpB B. abortus, compared to mock-infected controls.

(A) Heat map of transcription changes during infections with wild type, ΔvirB2 and ΔbtpB B. abortus. (B–D) Fold changes in gene transcription of genes classified as defense and inflammation that were significantly (P<0.05) up or downregulated during wild type (B), ΔvirB2 (C), and ΔbtpB (D) B. abortus, compared to mock-infected controls. Fold changes >2 with P<0.05 were considered significant. Abbreviations: apolipoprotein L, 3 (APOL3), butyrophilin-like 9 (BTNL9), cathelicidin 4 (CATHL4), CCAAT/enhancer binding protein (C/EBP), epsilon (CEBPE), CD200 molecule (CD200), chemokine (C-C motif) ligand 5 (CCL5), chemokine (C-C motif) receptor-like 2 (CCRL2), chemokine (C-X-C motif) ligand 12 (CXCL12), chemokine (C-X-C motif) receptor 5 (CXCR5), chemokine binding protein 2 (CCBP2), complement component 3a receptor 1 (C3AR1), complement factor H (CFH), complement factor I (CFI), family with sequence similarity 19 (chemokine (C-C motif)-like), member A4 (FAM19A4), Fc fragment of IgG binding protein (FCGBP), fms-related tyrosine kinase 3-like (FLT3), heat shock 70 kDa protein 1-like (HSPA1L), HLX H2.0-like homeobox (HLX), IFN-alpha C (IFNAC), integrin, alpha M (complement component 3 receptor 3 subunit) (ITGAM), interferon alpha G (IFNAG), interferon-alphaomega-like (LOC787343), interleukin 1 family, member 6 (epsilon)-like (IL1F6), interleukin (IL15), interleukin 2 receptor, alpha (IL2RA), mitogen-activated protein kinase 14 (MAPK14),MPV17 mitochondrial membrane protein-like, nuclear gene encoding mitochondrial protein (MPV17L), N-myc downstream regulated 1 (NDRG1), pellino homolog 2 (PELI2), peptidoglycan recognition protein 1 (PGLYRP1), PIGR polymeric immunoglobulin receptor (PIGR), platelet/endothelial cell adhesion molecule (PECAM1), radical S-adenosyl methionine domain containing 2 (RSAD2), rCG28728-like (GBP4), serine peptidase inhibitor, Kazal type 5 (SPINK5), toll-like receptor 6 (TLR6), TRAF2 and NCK interacting kinase (TNIK), transient receptor potential cation channel subfamily V member 1-like, transcript, variant 2 (TRPV1), transmembrane 4 L six family member 19 (TM4SF19), tumor necrosis factor (ligand) superfamily, member 10-like (TNFSF10), tumor necrosis factor receptor superfamily, member 13C (TNFRSF13C), tumor necrosis factor receptor superfamily, member 9 (TNFRSF9).

Changes in transcript abundance of defense and inflammation genes during infection of bovine trophoblastic cells with wild type, ΔvirB2 and ΔbtpB B. abortus, compared to mock-infected controls.

(A) Heat map of transcription changes during infections with wild type, ΔvirB2 and ΔbtpB B. abortus. (B–D) Fold changes in gene transcription of genes classified as defense and inflammation that were significantly (P<0.05) up or downregulated during wild type (B), ΔvirB2 (C), and ΔbtpB (D) B. abortus, compared to mock-infected controls. Fold changes >2 with P<0.05 were considered significant. Abbreviations: apolipoprotein L, 3 (APOL3), butyrophilin-like 9 (BTNL9), cathelicidin 4 (CATHL4), CCAAT/enhancer binding protein (C/EBP), epsilon (CEBPE), CD200 molecule (CD200), chemokine (C-C motif) ligand 5 (CCL5), chemokine (C-C motif) receptor-like 2 (CCRL2), chemokine (C-X-C motif) ligand 12 (CXCL12), chemokine (C-X-C motif) receptor 5 (CXCR5), chemokine binding protein 2 (CCBP2), complement component 3a receptor 1 (C3AR1), complement factor H (CFH), complement factor I (CFI), family with sequence similarity 19 (chemokine (C-C motif)-like), member A4 (FAM19A4), Fc fragment of IgG binding protein (FCGBP), fms-related tyrosine kinase 3-like (FLT3), heat shock 70 kDa protein 1-like (HSPA1L), HLX H2.0-like homeobox (HLX), IFN-alpha C (IFNAC), integrin, alpha M (complement component 3 receptor 3 subunit) (ITGAM), interferon alpha G (IFNAG), interferon-alphaomega-like (LOC787343), interleukin 1 family, member 6 (epsilon)-like (IL1F6), interleukin (IL15), interleukin 2 receptor, alpha (IL2RA), mitogen-activated protein kinase 14 (MAPK14),MPV17 mitochondrial membrane protein-like, nuclear gene encoding mitochondrial protein (MPV17L), N-myc downstream regulated 1 (NDRG1), pellino homolog 2 (PELI2), peptidoglycan recognition protein 1 (PGLYRP1), PIGR polymeric immunoglobulin receptor (PIGR), platelet/endothelial cell adhesion molecule (PECAM1), radical S-adenosyl methionine domain containing 2 (RSAD2), rCG28728-like (GBP4), serine peptidase inhibitor, Kazal type 5 (SPINK5), toll-like receptor 6 (TLR6), TRAF2 and NCK interacting kinase (TNIK), transient receptor potential cation channel subfamily V member 1-like, transcript, variant 2 (TRPV1), transmembrane 4 L six family member 19 (TM4SF19), tumor necrosis factor (ligand) superfamily, member 10-like (TNFSF10), tumor necrosis factor receptor superfamily, member 13C (TNFRSF13C), tumor necrosis factor receptor superfamily, member 9 (TNFRSF9).

Validation of the microarray data with qRT-PCR

In order to validate the results obtained with the microarrays analysis, selected differentially expressed transcripts were evaluated by qRT-PCR. Genes encoding IL15, HSPA1L, TNFRSF9, APOL3, PECAM1, PELI2, IL1F6, and TM4SF19 were amplified. Six of the eight selected genes had results that were parallel to those observed by microarray analysis (Figure 6).
Figure 6

Validation of the microarray results by real-time qRT-PCR.

Bars represent the average of fold change values from three independent experiments. Chorioallantoic membranes were infected with wild type B. abortus for evaluation of HSPA1L and PELI2 expression; with the ΔvirB2 Brucella abortus strain for evaluation of IL15, TNFRSF9, IL1F6, and TM4SF19; and with ΔbtpB Brucella abortus strain for evaluation of PECAM1. Abbreviations: interleukin 15 (IL15), heat shock 70 kDa protein 1-like (HSPA1L), tumor necrosis factor receptor superfamily, member 9 (TNFRSF9), apolipoprotein L, 3 (APOL3), pellino homolog 2 (PELI2), platelet/endothelial cell adhesion molecule (PECAM1), interleukin 1 family, member 6 (epsilon)-like (IL1F6), transmembrane 4 L six family member 19 (TM4SF19).

Validation of the microarray results by real-time qRT-PCR.

Bars represent the average of fold change values from three independent experiments. Chorioallantoic membranes were infected with wild type B. abortus for evaluation of HSPA1L and PELI2 expression; with the ΔvirB2 Brucella abortus strain for evaluation of IL15, TNFRSF9, IL1F6, and TM4SF19; and with ΔbtpB Brucella abortus strain for evaluation of PECAM1. Abbreviations: interleukin 15 (IL15), heat shock 70 kDa protein 1-like (HSPA1L), tumor necrosis factor receptor superfamily, member 9 (TNFRSF9), apolipoprotein L, 3 (APOL3), pellino homolog 2 (PELI2), platelet/endothelial cell adhesion molecule (PECAM1), interleukin 1 family, member 6 (epsilon)-like (IL1F6), transmembrane 4 L six family member 19 (TM4SF19).

Discussion

This study provided further evidence that B. abortus is capable of actively modulating the host innate immune response during the early stages of infection in target cells that are highly relevant for disease transmission, i.e. bovine trophoblasts. A previous study from our group demonstrated that B. abortus is able to modulate the innate immune response of bovine trophoblastic cells by suppressing the expression of proinflammatory cytokines and chemokines at early stages of infection [13]. In this study we expanded this notion by demonstrating that the absence of a functional T4SS due to deletion of virB2 as well as deletion of the btpB gene impairs the ability of B. abortus to suppress transcription of proinflammatory genes at early stages of infection in bovine trophoblasts. Although suppression of a proinflammatory response by trophoblastic cells may conflict with the fact that B. abortus causes acute placentitis in pregnant cows [7], our previous study [13] also demonstrated expression of proinflammatory chemokines at later stages of infection (i.e., 12 h after inoculation) in B. abortus-infected CAM explants, with a pattern that is similar to that observed in vivo in the placentomes of experimentally infected pregnant cows [13]. BtpB is known to interfere with innate immunity, since it inhibits TLR signaling in dendritic cells [19]. Our results suggest that BtpB could play a similar role in trophoblastic cells, suppressing an innate immune response. The virB operon- encoded T4SS is required for Brucella spp. to interfere with intracellular trafficking, which mediates exclusion of lysosomal markers from the Brucella-containing vacuole, and ultimately allows the pathogen to reach its intracellular replication niche [26]–[28]. Therefore, we hypothesize that the marked differences in host transcriptional profile when trophoblastic cells are infected with a Brucella strain lacking a functional T4SS is likely to be a result of differences in intracellular trafficking. Since virB mutants are killed and degraded, liberation of TLR ligands from degraded virB mutant bacteria couldcontribute to the increased proinflammatory transcriptional profile observed in our study [29]. Alternatively, since the VirB T4SS was recently shown to promote translocation of BtpB into host cells, the increased inflammatory signature in cells infected with the virB2 mutant could result from reduced translocation of BtpB to the cytosol of infected trophoblasts within the CAM explants, and consequently, reduced suppression of TLR signaling. Confirming previous results from our group that demonstrated that B. abortus inhibits a proinflammatory responses in infected bovine CAM at early stages of infection [13], microarray analysis revealed decreased transcription of genes related to immune response and cellular stress such as chemokine (CXC motif) ligand 12 (CXCL12), Pellino homolog 2 (PELI2), TRAF2 and NCK interacting kinase (TNIK), N-myc downstream regulated 1 (NDRG1) and serine peptidase inhibitor, Kazal type 5 (SPINK5). CXCL12, or stromal-derived factor 1 (SDF-1), is the only ligand for CXCR4 and its decrease may affect various biological processes, including hematopoiesis, cardiogenesis, vascular and neuronal development (processes that may be relevant for fetal development), and traffic of immune cells [30]. In trophoblastic cells infected with B. abortus, the reduction of CXCL12 can also cause decreased interaction with CXCR4, which can be deleterious for the developing fetus and affect immune responses. PELI2 is involved in signaling pathways by TLR1, TLR2, TLR4 and IL-1 by interaction with the complex containing IRAK kinases and TRAF6. It mediates polyubiquination of IRAK1 and can activate MAP (mitogen activated protein) kinase pathways. TNIK, in turn, is regulated by TRAF2, and it is induced by stress, external stimuli and by signal transducers like JNK and NF-κB after stimulation by TNF-α. It also acts protecting cells from apoptosis [31]. NDRG1 is involved in regulation of cellular proliferation and differentiation, as well as cellular response to stress. In human trophoblastic cells, this gene promotes cell viability and protection against injury due to hypoxia, a condition that is commonly associated with placental injury and impaired fetal development [32]. SPINK5 is a serine protease inhibitor, probably related to an anti-inflammatory response. In humans, it is important for protection against pathogens, and it plays a role in formation and physiological renewal of the epidermal barrier [33]–[35]. Decreased transcription of these genes confirms the notion of a negative modulation of the immune response at early stages of infection of bovine trophoblastic cells with B. abortus. Conversely, two genes within this category had increased transcription in bovine trophoblastic cells infected with B. abortus: TLR6 and HSPA1L. Recently, a study showed the importance of TLR6 in triggering the innate immune response against B. abortus in vivo and activation of dendritic cells and production of proinflammatory cytokine [36]. HSPA1L (70 kDa heat shock protein 1-like - Hsp70) is a chaperone that may play a role in the internalization of Brucella sp. Tropism of B. abortus for placental tissues has important implications for the occurrence of B. abortus-induced abortion, although the molecular mechanism for this tropism is unknown. Watanabe et al. [37] demonstrated that heat shock cognate protein (Hsc70) plays a role in Brucella sp. internalization in trophoblastic cells. The administration of anti-Hsc 70 to pregnant mice prevents abortion [37]. In this study there was increased transcription of this gene in trophoblastic cells infected with the ΔvirB strain, supporting the notion that Hsp70 may be involved at early stages of Brucella infection (4 hpi). The virB operon encodes structural components of the T4SS, and therefore it is required for secretion of effector molecules. The T4SS is required for persistence of Brucella spp. in vivo, and for intracellular survival in macrophages, which are considered one of the primary target cells for Brucella infection. Induction of the T4SS expression occurs after the initial acidification of the Brucella-containing vacuole (BCV). Moreover, the absence of markers of phagolysosomes in BCVs as well as the maturation of compartments derived from the endoplasmic reticulum are mediated by the T4SS of Brucella [15], [26]–[28]. Thus, the virB operon is related to survival and multiplication of Brucella in host cells, since virB mutant strains fail to multiply and localize to a lysosomal compartment [38], [39]. This study demonstrated that bovine trophoblastic cells infected with the ΔvirB mutant strain had significant increases in transcription of several proinflammatory genes at early stages of infection, when compared to trophoblastic cells infected with the wild type strain, although the elucidation of the mechanism of this phenotype is beyond the scope of this study, our data support the notion that suppression of proinflammatory responses by trophoblastic cells that is induced by B. abortus apparently requires a functional T4SS. Transcripts of several proinflammatory cytokines and chemokines were significantly increased in trophoblastic cells infected with B. abortus ΔvirB compared to uninfected cells. These transcripts included interleukin 15 (IL15), interleukin 1 family, member 6 (epsilon)-like (IL1F6), interleukin 2 receptor alpha (IL2RA), tumor necrosis factor receptor superfamily, member 9 (TNFRSF9) and chemokines such as chemokine (CC motif) receptor-like 2 (CCRL2), chemokine (CC motif) ligand 5 (CCL5), chemokine binding protein 2 epsilon (CCBP2), chemokine (CXC motif) receptor 5 (CXCR5). CXC chemokines act primarily on neutrophil chemotaxis, whereas CC chemokines are chemoattractants for monocytes, lymphocytes, and eosinophils [40]. There was also an increased transcription of the gene encoding Complement component 3a receptor 1 (C3AR1), which is the 3a peptide receptor, one of the proteins of the complement cascade that opsonizes pathogens, and induces a series of inflammatory responses that help fight infection [41]. Opsonization of B. abortus influences the internalization of this pathogen by phagocytic cells [42], [43]. Opsonized bacteria are internalized via receptors for complement and Fc and are more susceptible to the bactericidal action of the macrophages than non-opsonized bacteria which, in turn, are internalized via fibronectin receptor [42], [43]. In the first case, most of the internalized bacteria are destroyed within phagolysosomes before reaching the sites of intracellular multiplication [42], [43]. Therefore, the route of internalization interferes with the intracellular traffic in professional phagocytic cells [43], although opsonized B. abortus is capable of surviving intracellularly in human macrophages [44]. Apolipoprotein L, 3 (APOL3) transcripts were also increased in ΔvirB B. abortus -infected trophoblasts. APOL3 is part of the apolipoproteins family. Increase in APOL proteins is related to signaling by different pro-inflammatory molecules including IFN-α [45], IFN-β [46], IFN-γ [47], and TNF-α [48], which suggests that APOL proteins are involved in immune response. To a lesser extent when compared to ΔvirB B. abortus infection, bovine trophoblastic cells infected with ΔbtpB B. abortus also had increased mRNA levels of genes related to inflammation. When compared to non-infected controls, there was increased transcription of genes related to complement and also of the TNF family. Interestingly, these results contrast with the transcription profile of the spleen from mice infected with B. abortus or B. melitensis at 3 days post infection, in which there is a T4SS-dependent proinflammatory response [49]. The btpB gene is present in Brucella and encodes a protein with a TIR-domain, and it inhibits innate immune response probably by binding to MyD88, restricting the TLR signaling and therefore, it contributes to the control of inflammation and establishment of infection [19]. Salcedo et al. [19] reported that a virB mutant translocated less of BtpA and BtpB into mouse macrophages. Therefore, the increased expression of inflammation-related transcripts could be related to reduced translocation of the Btp proteins into infected trophoblasts. Furthermore, since virB mutants are killed more efficiently after uptake by cells, this could release more microbe associated molecular patterns (MAMPs) into the phagolysosome where they can be detected by TLRs. Two genes belonging to the TNF family had significant increases in transcription: tumor necrosis factor receptor superfamily, member 13C (TNFRSF13C), which is associated with increased survival of B cells in vitro and regulating the population of peripheral B cells, and tumor necrosis factor (ligand) superfamily, member 10-like (TNFSF10), is a member of TNF family of cytokines and primarily related to apoptosis. TNFSF10 playing important roles in regulating cell death, immune response, and inflammation. TNFSF10 binding to its receptors promotes activation of MAPK8/JNK, caspase 8, and caspase 3 [50]–[52]. There was also an increased transcription of the complement factor H (CFH), which is a member of the Regulator of Complement Activation (RCA) cluster. It plays an essential role in the regulation of complement activation, restricting the activation of the complement cascade innate immune response against pathogens and CCAAT/enhancer binding protein (C/EBP) epsilon (CEBPE). It is also a critical mediator of myelopoiesis and it is related to the functional maturation of neutrophils and monocytes/macrophages [53]–[55]. In conclusion, our study demonstrated that infection with B. abortus induces a downregulation of the bovine trophoblastic innate immune response during the first hours of infection. The virB-encoded T4SS, and to a lesser extent the btpB gene, play a direct or indirect role in this mechanism.
  51 in total

Review 1.  Type IV secretion and Brucella virulence.

Authors:  Maria Laura Boschiroli; Safia Ouahrani-Bettache; Vincent Foulongne; Sylvie Michaux-Charachon; Gisele Bourg; Annick Allardet-Servent; Chantal Cazevieille; Jean-Phillipe Lavigne; Jean Pierre Liautard; Michel Ramuz; David O'Callaghan
Journal:  Vet Microbiol       Date:  2002-12-20       Impact factor: 3.293

Review 2.  Brucella intracellular life: from invasion to intracellular replication.

Authors:  Jean Pierre Gorvel; Edgardo Moreno
Journal:  Vet Microbiol       Date:  2002-12-20       Impact factor: 3.293

3.  Differential requirements for VirB1 and VirB2 during Brucella abortus infection.

Authors:  Andreas B den Hartigh; Yao-Hui Sun; David Sondervan; Niki Heuvelmans; Marjolein O Reinders; Thomas A Ficht; Renée M Tsolis
Journal:  Infect Immun       Date:  2004-09       Impact factor: 3.441

4.  Prenatal development of domestic and laboratory mammals: growth curves, external features and selected references.

Authors:  H E Evans; W O Sack
Journal:  Zentralbl Veterinarmed C       Date:  1973-03

5.  Evaluation of novel Brucella melitensis unmarked deletion mutants for safety and efficacy in the goat model of brucellosis.

Authors:  Melissa M Kahl-McDonagh; Philip H Elzer; Sue D Hagius; Joel V Walker; Quinesha L Perry; Christopher M Seabury; Andreas B den Hartigh; Renee M Tsolis; L Garry Adams; Donald S Davis; Thomas A Ficht
Journal:  Vaccine       Date:  2006-04-27       Impact factor: 3.641

6.  Brucella coopts the small GTPase Sar1 for intracellular replication.

Authors:  Jean Celli; Suzana P Salcedo; Jean-Pierre Gorvel
Journal:  Proc Natl Acad Sci U S A       Date:  2005-01-04       Impact factor: 11.205

7.  Dynamic change of TNIK in response to tumor necrosis factor alpha in a TRAF2-dependent manner.

Authors:  Jinghua Gui; Zhenhai Li; Xiumei Zhou
Journal:  Hum Cell       Date:  2013-01-26       Impact factor: 4.174

Review 8.  Transducers of life and death: TNF receptor superfamily and associated proteins.

Authors:  S J Baker; E P Reddy
Journal:  Oncogene       Date:  1996-01-04       Impact factor: 9.867

9.  Brucella control of dendritic cell maturation is dependent on the TIR-containing protein Btp1.

Authors:  Suzana P Salcedo; María Ines Marchesini; Hugues Lelouard; Emilie Fugier; Gilles Jolly; Stephanie Balor; Alexandre Muller; Nicolas Lapaque; Olivier Demaria; Lena Alexopoulou; Diego J Comerci; Rodolfo A Ugalde; Philippe Pierre; Jean-Pierre Gorvel
Journal:  PLoS Pathog       Date:  2008-02-08       Impact factor: 6.823

10.  BtpB, a novel Brucella TIR-containing effector protein with immune modulatory functions.

Authors:  Suzana P Salcedo; María I Marchesini; Clara Degos; Matthieu Terwagne; Kristine Von Bargen; Hubert Lepidi; Claudia K Herrmann; Thais L Santos Lacerda; Paul R C Imbert; Philippe Pierre; Lena Alexopoulou; Jean-Jacques Letesson; Diego J Comerci; Jean-Pierre Gorvel
Journal:  Front Cell Infect Microbiol       Date:  2013-07-08       Impact factor: 5.293

View more
  5 in total

1.  Proteomic Profile of Brucella abortus-Infected Bovine Chorioallantoic Membrane Explants.

Authors:  Juliana P S Mol; Simone F Pires; Alexander D Chapeaurouge; Jonas Perales; Renato L Santos; Hélida M Andrade; Andrey P Lage
Journal:  PLoS One       Date:  2016-04-22       Impact factor: 3.240

2.  Guanylate-binding protein 5 licenses caspase-11 for Gasdermin-D mediated host resistance to Brucella abortus infection.

Authors:  Daiane M Cerqueira; Marco Túlio R Gomes; Alexandre L N Silva; Marcella Rungue; Natan R G Assis; Erika S Guimarães; Suellen B Morais; Petr Broz; Dario S Zamboni; Sergio C Oliveira
Journal:  PLoS Pathog       Date:  2018-12-27       Impact factor: 6.823

Review 3.  Uncovering the Hidden Credentials of Brucella Virulence.

Authors:  R Martin Roop; Ian S Barton; Dariel Hopersberger; Daniel W Martin
Journal:  Microbiol Mol Biol Rev       Date:  2021-02-10       Impact factor: 11.056

4.  The abcEDCBA-Encoded ABC Transporter and the virB Operon-Encoded Type IV Secretion System of Brucella ovis Are Critical for Intracellular Trafficking and Survival in Ovine Monocyte-Derived Macrophages.

Authors:  Auricelio A Macedo; Ana P C Silva; Juliana P S Mol; Luciana F Costa; Luize N N Garcia; Marcio S Araújo; Olindo A Martins Filho; Tatiane A Paixão; Renato L Santos
Journal:  PLoS One       Date:  2015-09-14       Impact factor: 3.240

Review 5.  Brucella - Virulence Factors, Pathogenesis and Treatment.

Authors:  Patrycja Głowacka; Dorota Żakowska; Katarzyna Naylor; Marcin Niemcewicz; Agata Bielawska-Drózd
Journal:  Pol J Microbiol       Date:  2018-06-30
  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.