E K Engle1, D A C Fisher1, C A Miller2, M D McLellan2, R S Fulton2, D M Moore1, R K Wilson2, T J Ley3, S T Oh1. 1. Division of Hematology, Washington University School of Medicine, St Louis, MO, USA. 2. The Genome Institute, Washington University School of Medicine, St Louis, MO, USA. 3. The Genome Institute, Division of Oncology, Washington University School of Medicine, St Louis, MO, USA.
Abstract
Clonal architecture in myeloproliferative neoplasms (MPNs) is poorly understood. Here we report genomic analyses of a patient with primary myelofibrosis (PMF) transformed to secondary acute myeloid leukemia (sAML). Whole genome sequencing (WGS) was performed on PMF and sAML diagnosis samples, with skin included as a germline surrogate. Deep sequencing validation was performed on the WGS samples and an additional sample obtained during sAML remission/relapsed PMF. Clustering analysis of 649 validated somatic single-nucleotide variants revealed four distinct clonal groups, each including putative driver mutations. The first group (including JAK2 and U2AF1), representing the founding clone, included mutations with high frequency at all three disease stages. The second clonal group (including MYB) was present only in PMF, suggesting the presence of a clone that was dispensable for transformation. The third group (including ASXL1) contained mutations with low frequency in PMF and high frequency in subsequent samples, indicating evolution of the dominant clone with disease progression. The fourth clonal group (including IDH1 and RUNX1) was acquired at sAML transformation and was predominantly absent at sAML remission/relapsed PMF. Taken together, these findings illustrate the complex clonal dynamics associated with disease evolution in MPNs and sAML.
Clonal architecture in myeloproliferative neoplasms (MPNs) is poorly understood. Here we report genomic analyses of a patient with primary myelofibrosis (PMF) transformed to secondary acute myeloid leukemia (sAML). Whole genome sequencing (WGS) was performed on PMF and sAML diagnosis samples, with skin included as a germline surrogate. Deep sequencing validation was performed on the WGS samples and an additional sample obtained during sAML remission/relapsed PMF. Clustering analysis of 649 validated somatic single-nucleotide variants revealed four distinct clonal groups, each including putative driver mutations. The first group (including JAK2 and U2AF1), representing the founding clone, included mutations with high frequency at all three disease stages. The second clonal group (including MYB) was present only in PMF, suggesting the presence of a clone that was dispensable for transformation. The third group (including ASXL1) contained mutations with low frequency in PMF and high frequency in subsequent samples, indicating evolution of the dominant clone with disease progression. The fourth clonal group (including IDH1 and RUNX1) was acquired at sAML transformation and was predominantly absent at sAML remission/relapsed PMF. Taken together, these findings illustrate the complex clonal dynamics associated with disease evolution in MPNs and sAML.
Myeloproliferative neoplasms (MPNs) are clonal myeloid malignancies that are derived from hematopoietic stem/progenitor cells (HSPCs).(1) These chronic disorders are characterized by unrestrained cellular proliferation leading to overproduction of one or more myeloid lineages. Primary myelofibrosis (PMF) is a subtype of MPN characterized by megakaryocyte hyperplasia and atypia, bone marrow fibrosis, extramedullary hematopoiesis, and splenomegaly.(2) The overall prognosis for PMF is poor, with expected survival ranging from months to several years.(3) In addition, patients with PMF exhibit a propensity for transformation to secondary acute myeloid leukemia (sAML), for which the prognosis is dismal.(4, 5)The genetic basis of MPNs has been an area of intense investigation, notably marked by the identification of the JAK2 V617F mutation.(6-9) Approximately 50-60% of patients with PMF harbor the JAK2 V617F mutation, and an additional subset of patients (∼5-10%) exhibit mutations in other members of the JAK-STAT signaling axis such as MPL(10, 11) or LNK (SH2B3).(12, 13) These findings indicate that dysregulated JAK-STAT signaling is a hallmark of MPN pathogenesis. In support of this notion, both JAK2 V617F-positive and JAK2 V617F-negative MF patients have exhibited clinical responses to treatment with targeted inhibitors of JAK2.(14, 15)Despite these findings, recent studies have demonstrated that JAK2 (or MPL or LNK) mutations are not the sole genetic lesion in many MPN cases.(16) TET2 mutations may be acquired prior to the JAK2 V617F mutation, indicating that at least in some MPNs there is a “pre-JAK2” event leading to clonal hematopoiesis.(17) This notion is supported by recent exome sequencing studies in which a subset of MPN patients were found to harbor pre-JAK2 mutations.(18) Alterations in several genes (e.g. IKZF1, p53) are specifically associated with transformation to sAML.(16) Interestingly, sAML arising from a JAK2 V617F-positive MPN frequently lacks the JAK2 V617F mutation, suggesting that the leukemic clone in these cases originated from a pre-JAK2 clone.(19) Recurrent mutations in several other genes (e.g. ASXL1, EZH2, DNTM3A, IDH1/2, CBL, SRSF2, CALR) have also recently been identified in MPNs.(20-22) Many of these mutations have been identified in chronic as well as blast phase MPNs. The specific role of these genes in disease initiation and/or progression remains incompletely understood.Clonal hierarchy in MPNs, particularly in the context of disease progression, is not well defined. While exome sequencing studies can suggest possible clonal populations,(18, 22) this approach lacks the resolution to confidently define subclonal populations, primarily due to the low number of coding mutations typically found in myeloid malignancies.(23, 24) In addition, small subclonal populations may only be detected when multiple timepoints are assessed. Previous studies investigating clonal evolution in MPNs have primarily focused on selected gene mutations or chromosome 9p UPD encompassing JAK2.(25-28) The only whole genome sequencing (WGS) study in MPNs published to date examined a single patient with early stage PMF and did not examine multiple timepoints or disease evolution.(29)Here we report comprehensive genomic analyses performed on an individual patient with PMF transformed to sAML. WGS in conjunction with deep sequencing validation enabled clonal modeling of multiple disease stages, thereby inferring mechanisms of disease evolution.
Materials and Methods
Patient samples
Bone marrow, peripheral blood, and skin samples were obtained from a single patient at three different disease stages (PMF, sAML, sAML remission/relapsed PMF). Genomic DNA was extracted from PMF and sAML bone marrow mononuclear cells, as well as from peripheral blood mononuclear cells obtained during sAML remission/relapsed PMF. Genomic DNA was extracted from a skin biopsy collected at PMF diagnosis. The patient provided written consent on a protocol approved by the Washington University Human Studies Committee (WU #01-1014) that includes specific language authorizing WGS.
Whole genome sequencing and variant detection
WGS was performed on the PMF, sAML, and skin (normal) samples. For WGS, paired-end sequencing was performed using the Illumina HiSeq platform with 100 bp read length (San Diego, CA). For the PMF and sAML samples, 211.9 to 212.9Gb of WGS sequence was generated (corresponding to 63.9x and 60.2x haploid coverage of the reference genome, respectively), and for the normal sample 127.1Gb was generated (corresponding to 37.5x haploid coverage). Alignment of reads and detection of somatic mutations (single nucleotide, indel, and structural variants) was performed as described previously(24), with updates to the versions of the following tools: BWA v0.5.9(30), Picard v1.46 (http://picard.sourceforge.net/), dbSNP build 132(31), Samtools svn rev 963(32), and Pindel v0.5.(33) Single nucleotide variants (SNVs) and indels were binned into tiers as previously described (34), where tier 1 includes mutations in the coding regions of exons, consensus splice sites, and RNA genes, tier 2 includes mutations in highly conserved genomic regions and regions with regulatory potential, tier 3 includes mutations in the nonrepetitive portion of the genome not included in tier 2, and tier 4 mutations are in the remainder of the genome.Somatic copy number alterations were detected using copyCat version 1.5 (https://github.com/chrisamiller/copycat). Possible regions of copy number alteration were investigated by plotting the ratio of tumor to reference WGS reads normalized to the average tumor: reference ratio across the chromosome for all SNVs in the candidate region. Copy number neutral loss of heterozygosity was detected on chromosome 9 from bases 1 to 8783029 in both the PMF and sAML samples using SNP calls from Varscan and segmented with the DNAcopy package for R.(35)
RNA sequencing and analysis
RNA sequencing was performed on the PMF and sAML samples. Paired-end sequencing was performed on poly-A selected RNA using the Illumina HiSeq2000 platform with 100 bp read length. For the PMF and sAML samples, 397 and 393 million total reads were generated, respectively. Reads were aligned with TopHat v1.3.1 (36) and analyzed with Cufflinks v1.0.3.(37) The resulting transcript abundance estimates are expressed in fragments per kilobase of exon per million fragments mapped (FPKM), as proposed by Mortazavi et al.(38) Gene fusions were detected from RNA sequencing data using BreakFusion version 1.0.(39)
Validation sequencing and variant detection
A capture panel was designed for validation resequencing. A customized capture array design targeting 10,307,042 bases was made by Roche NimbleGen (Madison, WI), and libraries were hybridized according to the manufacturer's protocol. The array included all tier 1-3 high confidence SNVs (1,351), tier 1 low confidence SNVs (48,884), tier 1-3 indels (5,549) and structural variants (22,442) identified in the WGS. In addition, capture probes targeting SNVs and exons in genes known or predicted to be associated with MPN pathogenesis (Supplementary Table 1) were obtained from Integrated DNA Technologies (Coralville, IA). These additional probes targeting 80,880 bases were spiked into the Roche Nimblegen (Madison, WI) capture panel at a 2:1 ratio.Validation sequencing was performed on the three WGS samples as well as a fourth sample obtained during sAML remission/relapsed PMF. Sequence was produced on the Illumina HiSeq2000 platform and runs were completed according to the manufacturer's recommendations (Illumina Inc, San Diego, CA). Between 2.7 and 4.9 Gb of sequence was produced for each sample, giving a median target coverage of 216x to 388x. Variants were detected using Somatic Sniper v0.7.3 (40), GATK (41), Pindel v0.5, and Varscan v2.2.6 (42), then validated as described previously.(24) All validated SNVs had a VAF of at least 11% in the sample in which it was validated. In order to follow the frequency of a SNV or indel across disease progression, if a mutation was validated in at least one sample, the frequency of that mutation in other samples was retained regardless of individual sample validation results. In some instances this led to the retention of mutations with extremely low VAFs. In these cases it could not be completely excluded that the low VAFs were in fact due to base calling errors.
Clustering
Validated SNVs in the PMF and sAML samples enabled the identification of clonal groups using a clustering strategy similar to Walter et al.(43) The variant allele frequencies (VAFs) of three SNVs in a region of uniparental disomy (UPD) on chromosome 9 (first 8.7 MB) were divided in half prior to clustering. Outlier VAFs were detected by dbscan (44), with a reachability index of 0.5. VAF data along with outlier points submitted as potential noise were submitted for unsupervised clustering using the Mclust algorithm (45) with default parameters. The maximum number of clusters was limited to four (G=1:4), and each cluster had to contain at least seven SNVs (1% of the total number of SNVs). Out of 10 available models in Mclust, an ellipsoidal model with variable volume and orientation but equal shape was selected as the best model and contained three groups.Validated SNVs in the sAML remission/relapsed PMF sample refined the clusters. Initial unsupervised clustering of the PMF and sAML samples identified a single group with high sAML VAFs and low PMF VAFs. Based on the VAFs in the sAML remission/relapsed PMF sample, the cluster was divided into two groups: “Low PMF” or “sAML only”. The SNVs in the “Low PMF” group had VAFs > 19% in the sAML remission/relapsed PMF sample. The “sAML only” SNVs were characterized by VAFs < 2.6% in the PMF stage and < 2% in the sAML remission/relapsed PMF sample. The result was four clusters of SNVs that corresponded to the founding clone and three subclones observed across the three samples.
Genotyping JAK2 and U2AF1 mutations in individual colonies
Peripheral blood from the PMF stage was stained with antibodies against CD34, CD38, CD3, CD19, CD14, and CD16. Lineage-negative CD34+ cells were sorted on a Dako MoFlo flow cytometer (Beckman-Coulter Inc, Indianapolis, IN) and plated at one cell per well into 96-well plates containing a monolayer of AFT024 mouse bone marrow stromal cells. After growth for 28-35 days in vitro, DNA from individual colonies was extracted using the QiaAmp DNA mini kit (Qiagen, Bergisch Gladbach, Germany). Colony DNA was genotyped for JAK2 V617F and U2AF1Q157P mutations by TaqMan real time PCR on a StepOne Plus real time thermal cycler (Applied Biosystems/Life Technologies, Grand Island, NY). The JAK2 V617F PCR was a modified version of the protocol by Levine et al.(46) The U2AF1Q157P TaqMan PCR assay utilized forward primer = CCGTGACGGACTTCAGAGAA, reverse primer = ACTGGCCACTCCTCACTCA, WT probe = VIC-CTGCCGTCAGTATGAG-MGB, and Q157P probe = 6FAM-TGCCGTCCGTATGAG-MGB, with an annealing temperature of 60°C. Genotyping was calibrated with HEL cell line DNA (JAK2 V617F homozygous) mixed in a titration series with control JAK2 wild-type human genomic DNA, and whole bone marrow DNA from the PMF stage. Genotyping for each colony was considered successful if consistent genotype results were obtained for both JAK2 and U2AF1 PCRs. Of 202 CD34+ cell derived colony DNAs genotyped, 42 had consistent genotype results for both the JAK2 V617F and U2AF1Q157P mutations.
Results
Case history
A 51 year-old woman initially presented with splenomegaly, pancytopenia, and leukoerythroblastosis (Supplementary Table S2). A bone marrow biopsy demonstrated severe fibrosis, consistent with a diagnosis of PMF. Cytogenetics were normal. Bone marrow and skin samples were banked at that time. The patient had an excellent response to treatment with thalidomide, ultimately achieving a complete hematologic remission. Due to the development of neuropathy, therapy was eventually switched to lenalidomide. Seven years after initial PMF diagnosis, the patient transformed to sAML. A bone marrow biopsy revealed 49% blasts, and cytogenetics were normal. Testing for JAK2 V617F was positive. Bone marrow samples were again banked. The patient received induction chemotherapy with IDA-FLAG (idarubicin, fludarabine, cytarabine, G-CSF) and attained a complete remission, followed by consolidation chemotherapy with four cycles of high-dose cytarabine. Subsequently, the patient declined bone marrow transplantation. Approximately 1.5 years after sAML diagnosis, the patient again developed pancytopenia with leukoerythroblastosis, consistent with relapsed PMF, but with no evidence of sAML relapse. Peripheral blood samples were banked approximately two years after sAML diagnosis. Samples were thus banked at three stages: PMF diagnosis, sAML diagnosis, and sAML remission/relapsed PMF.
Whole genome sequencing and capture validation
WGS was performed on the PMF and sAML patient samples, as well as a skin sample obtained at PMF diagnosis. The latter served as a normal control to exclude potential germline variants. Haploid coverage was 64x, 60x, and 38x for the PMF, sAML, and skin samples, respectively. Potential somatic mutations were identified and divided into four tiers as previously described.(34) Tier 1 mutations included mutations in protein coding sequences, consensus splice sites and RNA genes. Somatic single nucleotide mutations (SNVs) and insertions and deletions (indels) were validated using custom capture to enable deep sequencing of each mutation. A fourth sample, the sAML remission/relapsed PMF sample, was included in the validation analysis, thereby adding a third timepoint to compare mutation frequencies over time with disease progression.A total of 649 SNVs were validated in at least one of the three tumor samples (Table 1, Supplementary Table S3 and S4). Of the 649 SNVs, all had over 100x coverage with the exception of three SNVs with just under 100 reads in the sAML sample. An average of 398, 302, and 537 reads spanned the validated mutations in the PMF, sAML, and sAML remission/relapsed PMF samples, respectively. In addition, two tier 1 indels were validated, along with 127 tier 2 and 3 indels (Supplementary Table S3 and S4) No structural variants (Supplementary Table S5) or gene fusions (Supplementary Table S6) were identified that likely contributed to disease progression due to the absence of either in the sAML sample.
Table 1
Somatic single nucleotide variant (SNV) mutations per tier
The number of SNV mutations validated for each sample per tier. sAML specific mutations are the mutations gained between the PMF sample and the sAML sample. Abbreviations: PMF, primary myelofibrosis; sAML, secondary acute myeloid leukemia.
PMF
sAML
sAML specific
sAML Remission/Relapsed PMF1
Total
Tier 1
25
33
13
27
38
Tier 2
81
96
28
80
109
Tier 3
334
433
168
327
502
Overall
440
562
209
434
649
Only includes SNVs identified in WGS sequencing of the PMF or sAML samples
Seven years passed between the collection of the PMF sample and the sAML sample, and a corresponding increase in the total number of SNVs from 440 to 562 was observed (Table 1). The proportion of SNVs in tiers 1-3 was similar between the PMF and sAML samples and for the SNVs that were gained between PMF and sAML, suggesting that the majority of SNVs were randomly distributed across the genome. There was no overrepresentation of tier 1 SNVs gained in the sAML sample, indicating that disease progression was not accompanied by a specific increase in coding mutations. The observed number of coding SNVs per sample fell within the calculated range of coding mutations expected to accumulate in HSPCs each year as a result of errors during DNA replication,(23) suggesting that the majority of the mutations were due to the aging process. This was also consistent with genome-wide studies in MDS and AML which concluded that the majority of somatic SNVs are passenger mutations that accumulate over time (23, 34, 43).An increased proportion of transversion mutations may be indicative of therapy-related DNA changes.(23, 47) For the PMF and sAML samples, the transition and transversion frequencies were roughly similar to previously published studies of AML, MDS, and MPNs (Figure 1).(22, 23, 43) sAML-specific mutations from the patient examined in this study also had a similar distribution. These findings indicate that there was no obvious therapy-related effect on mutation distribution in this case.
Figure 1
Spectrum of transition and transversion mutations per sample
The percentage of somatic single nucleotide variants (SNVs) in the PMF, sAML, or specific for the sAML sample are categorized by transition and transversion mutation types.
Putative MPN and sAML driver mutations
A total of 38 tier 1 SNVs were validated across the three tumor samples (Figure 2, Supplementary Table 3). Of the validated tier 1 SNVs, six were identified as putative driver mutations (JAK2, U2AF1, MYB, ASXL1, RUNX1, IDH1) based on prior studies demonstrating mutations in each of these genes in MPNs and/or sAML (Table 2).(20, 48-51) The JAK2 and U2AF1 mutations were identified in all three samples with a variant allele frequency (VAF) of approximately 75% and 40%, respectively. The MYB mutation was present in the PMF sample at a VAF of 20%, but was not detectable in the sAML or sAML remission/relapsed PMF samples. A mutation in ASXL1 was found at a low frequency (6%) in the PMF sample, but was substantially enriched in the sAML (44%) and sAML remission/relapsed PMF (32%) samples. RUNX1 and IDH1 mutations were validated only in the sAML sample at VAFs of 35 and 30%, respectively. Amongst the remaining 32 tier 1 SNVs, a mutation in the HCFC1 gene was identified as an additional possible driver based on its expression, known function and interaction in pathways also involving ASXL1.(52-54) This mutation followed a VAF pattern across the three different disease stages that was quite similar to ASXL1, suggesting a possible synergy between the two mutations.
Figure 2
Comparison of variant allele frequencies across tier 1 somatic single nucleotide variants (SNVs)
The variant allele frequency for each tier 1 SNV across the PMF, sAML, and sAML remission/relapsed PMF samples is shown. The genes with the SNVs are divided based on whether the SNV was present predominantly in all three samples (Shared SNVs), only the PMF sample (PMF SNVs), low in the PMF sample but high in sAML and sAML remission/relapsed PMF samples (Low PMF SNVs), and only in the sAML sample (sAML SNVs).
Table 2
Putative driver somatic single nucleotide variants (SNVs) validated following whole genome sequencing
For each SNV, the normal gene function, effect of the mutation (if known), and the variant allele frequency (VAF) at each of the three disease stages is shown. Abbreviations: PMF, primary myelofibrosis; sAML, secondary acute myeloid leukemia.
Transcription factor, essential regulator of hematopoiesis
20.2%
0.2%
0.1%
ASXL1
Q692*
Transcriptional regulator, member of PRC2 complex, binds BAP1
5.7%
43.9%
32.3%
HCFC1
S2025Y
Transcriptional regulator, regulated by BAP1
4.7%
35.0%
34.5%
IDH1
R132C
Aberrant 2-HG production, altered DNA methylation
0.3%
30.3%
0.0%
RUNX1
D198N
Transcription factor, CBF subunit
0.2%
35.3%
0.7%
RNA sequencing data confirmed that all candidate driver mutations (Table 2) were expressed in the corresponding PMF and/or sAML samples (Supplementary Table 3). Out of the 40 tier 1 mutations inclusive of SNVs and indels, 18 were expressed in the PMF and/or sAML samples. Most mutations had a similar VAF in the validated whole genome sequencing data compared to the RNA sequencing data (Supplementary Figure 1).
JAK2 V617F homozygosity is an early event
The JAK2 V617F mutation may initially be acquired as a heterozygous mutation and subsequently become homozygous via mitotic recombination (27, 55, 56). To establish whether the VAF observed for the JAK2 V617F mutation corresponded primarily to a dominant JAK2 V617F homozygous clone, or to a mixture of JAK2 V617F homozygous and heterozygous clonal populations, colonies derived from individual CD34+ cells from the PMF stage were grown in vitro to identify the predominant genotypes among individual clones. Genotyping by real-time PCR verified that the observed CD34+-derived cell population was predominantly JAK2 V617F homozygous, with 69% of colonies homozygous, less than 5% heterozygous for JAK2 V617F, and 26% JAK2 homozygous wild-type (Table 3). Based on these results, the imputed JAK2 V617F allele frequency in the genotyped colonies was 71.4%. This was similar to the 71.2% from bulk sorted CD34+ cells, suggesting that culturing the CD34+ cells did not significantly alter the JAK2 V617F VAF. Both VAFs were similar to the 74.4% observed by deep sequencing of the bone marrow from the PMF stage. Thus, the single cell-derived clones observed in vitro appeared to be representative of those in vivo, implying that the in vivo cell population was predominantly JAK2 V617F homozygous. By the overt establishment of PMF, the homozygous mutant cell population was already dominant over the heterozygous population.
Table 3
JAK2 V617F and U2AF1 Q157P genotypes from cultured CD34+ cell derived colonies
Colonies were isolated from the peripheral blood at the PMF stage and were genotyped for JAK2 V617F and U2AF1 Q157P mutations. The number of colonies with each genotype is shown. Abbreviations: WT, Het, and Hom correspond to colonies that are wildtype, heterozygous, or homozygous for the mutation, respectively. PMF, primary myelofibrosis.
JAK2 WT
JAK2 Het
JAK2 Hom
Total colonies
U2AF1 WT
11
1
1
13 (31%)
U2AF1 Het
0
1
28
29 (69%)
U2AF1 Hom
0
0
0
0 (0%)
Total colonies
11 (26%)
2 (5%)
29 (69%)
42
Since the JAK2 and U2AF1 mutations were the most abundant candidate driver mutations identified at the PMF stage, either could represent the founding mutation of the PMF propagating clone. To establish which mutation may have arisen first, colony DNAs were also genotyped for the U2AF1Q157P mutation. As shown in Table 3, the U2AF1 mutation was present only in cells also containing JAK2 V617F. The predominant JAK2 V617F homozygous cell population was almost entirely U2AF1Q157P heterozygous, consistent with an observed VAF for U2AF1Q157P roughly half of that observed for JAK2 V617F. There were too few JAK2 heterozygous cells observed to determine definitively which mutation, JAK2 or U2AF1, preceded the other. It can only be concluded that by the onset of PMF, a JAK2 V617F homozygous, U2AF1Q157P heterozygous clone had outcompeted all previous mutant clonal populations.
Clonal architecture
With over four hundred SNVs per sample, the clonal architecture during disease progression could be inferred. The VAFs of copy neutral mutations were clustered to identify the predominant clone and subclonal populations accompanying disease evolution. Since there was no evidence for copy number variation around any of the validated SNVs, all validated SNVs were considered copy number neutral and were included in modeling clonality.The JAK2 V617F mutation and two additional SNVs were located in a region of uniparental disomy (UPD) in the first 8.78 Mb of chromosome 9 and had apparent copy number neutral loss of heterozygosity. Consistent with the observation of UPD, all three SNVs had VAFs of approximately 75% across samples, and genotyping indicated that the majority of cells were homozygous for the JAK2 V617F mutation. As a result, the VAFs for each of the three mutations (including JAK2 V617F) were divided in half for clonal modeling, resulting in VAFs of approximately 37%.Using the assumption that mutations with similar VAFs represented a clonal group and traveled together, clonal groups were identified based on clusters of VAFs. Unsupervised clustering of the VAFs from the PMF and sAML sample identified a founding clone and two subclones (Figure 3A). The frequency of variants in the sAML remission/relapsed PMF sample provided a third timepoint to resolve clonal groups and showed that there was a founding clone and three subclones (Figure 3B). The sAML remission/relapsed PMF sample distinguished between a sAML-only clonal group and a clonal group that had a high VAF at both sAML and sAML remission/relapsed PMF. Based on the clustering results, a model of clonal progression was developed demonstrating the dynamics of clonal evolution across disease progression (Figure 3C).
Figure 3
Clustering and clonal evolution across disease progression
Unsupervised clustering of 649 SNVs identified clusters of mutations with similar variant allele frequencies corresponding to the founding clone (green), subclone 1 (light blue), subclone 2 (red), and subclone 3 (dark blue). (A) Frequency of mutations in PMF versus sAML. (B) Frequency of mutations in sAML remission/relapsed PMF versus sAML. (C) A model of clonal evolution based on the median values for the VAFs in each of the four clusters at each stage of progression in (A) and (B) as shown below the plot. Abbreviations: PMF, primary myelofibrosis; sAML, secondary acute myeloid leukemia; sAML REM, secondary acute myeloid leukemia remission/relapsed PMF.
Discussion
This study delineates clonal evolution in a patient who initially presented with PMF, transformed to sAML, and subsequently experienced prolonged sAML remission despite PMF relapse. Bone marrow genomic DNA was cytogenetically normal at both PMF and sAML stages, and no large structural variant or gene fusion contributing to disease progression was detected. Therefore, the total somatic mutational burden identified at the PMF and sAML stages could be attributed to a combination of SNVs and small indels. Seven candidate driver SNVs were identified in the PMF and/or sAML samples. These candidate driver mutations corresponded to the founding clone and subsequent subclones identified in the PMF and sAML disease stages.The overall burden of acquired mutations in this patient was similar to those previously reported for de novo AML and normal aging of the hematopoietic system.(23) The transversion frequency and the ratio of tier 1:2:3 mutations was consistent with healthy aging(23) as well as previous observations in de novo AML(23), myelodysplastic syndromes (MDS), and post-MDS sAML(43). With respect to MPNs, a single published WGS study describing a patient with PMF at chronic phase(29) and recently published exome sequencing studies(21, 22, 57) have not suggested a substantially different mutational burden in MPNs from what has been observed in this study or in normal aging. Taken together, these observations indicate that the majority of somatic mutations in this patient were most likely passenger mutations acquired in the context of normal aging of the HSPC population.A total of 40 tier 1 SNVs and indels were identified via WGS and validated by custom capture sequencing. The majority of these were categorized as likely passenger mutations based on absence of expression by RNA sequencing, codon synonymity, and/or predicted benign alteration in a protein (Supplementary table 3). However, it could not be definitively excluded that a subset of these mutations may have pathogenetic relevance. Six genes (JAK2, U2AF1, MYB, ASXL1, IDH1, and RUNX1) were identified as likely candidate driver mutations, largely based on known recurrence of mutations in these genes in MPNs and/or sAML.(20, 48-51) A seventh gene (HCFC1) was identified as a possible driver mutation based on its known functions and interaction with ASXL1.(52-54)The PMF stage was characterized by a founding clone harboring mutations in JAK2 and U2AF1, a large subclone containing a mutation in MYB, and a minor subclone containing mutations in ASXL1 and HCFC1. The SNVs in JAK2 and U2AF1 were representative of a dominant clone at all disease stages. The high VAF of JAK2 V617F suggested prevalent homozygosity at all stages. Single colony genotyping confirmed that the CD34+ cell population was predominantly JAK2 V617F homozygous at the PMF stage, with the residual population being wild-type for JAK2, and JAK2 V617F heterozygous clones being rare.Based on single colony genotyping, it could not be resolved which of the mutations in JAK2 and U2AF1 preceded the other in the evolution of the malignant clone. Given the dominance of the clone containing these mutations at the PMF stage, both mutations were likely early events. Based on the stage-specific clonality or subclonality of the candidate driver mutations, the PMF dominant clone was driven predominantly if not exclusively by the JAK2 and U2AF1 mutations, with the MYB mutation being a likely subclonal driver, albeit one that was extinct by the time of sAML diagnosis. Since the MYB mutation was not identified in the relapsed MF, these observations suggest that the combination of JAK2 V617F homozygosity and U2AF1Q157P heterozygosity was sufficient to initiate PMF in this patient.ASXL1 and HCFC1 mutations were present in a small subclone at the PMF stage that expanded with transformation and remained at high frequency at sAML remission/relapsed PMF. The combination of mutations in ASXL1 and HCFC1 was particularly notable because their protein products are known bind to each other and are present together in complexes with several other known oncogenes and tumor suppressors with diverse biological roles including regulation of histone methylation.(52-54) In a mouse model, absence of one such shared binding partner, BAP1, led to a lack of HCFC1 protein (since BAP1 normally prevents HCFC1 degradation), and these mice exhibited features of myeloproliferative disease.(52) Although recurrent HCFC1 mutations have not been identified thus far in large-scale exome sequencing studies in MPNs,(18, 21, 22) a mutation in HCFC1 was found in one case of de novo AML.(24). Collectively, these findings support the notion that HCFC1 mutations may be pathogenic, and that ASXL1 and HCFC1 mutations could plausibly interact to contribute to disease evolution. However, the possibility that the HCFC1 mutation in this case was a passenger mutation that randomly coincided with the mutation in ASXL1 cannot be excluded.The clone containing ASXL1 and HCFC1 mutations proliferated at the expense of the MYB mutant clone, and was parental to the sAML clone harboring RUNX1 and IDH1 mutations. The persistence of the ASXL1 and HCFC1 mutations at sAML remission/relapsed PMF suggests that the addition of these mutations to the JAK2/U2AF1 mutant founding clone was not sufficient to induce transformation to sAML, which was likely precipitated by mutations in RUNX1 and IDH1. The ASXL1/HCFC1 mutant clone, however, was likely dominant over the parental JAK2/U2AF1 mutant clone lacking these later mutations.The sAML stage was characterized by the founding clone and two nested subclones, with one clone harboring ASXL1 and HCFC1 mutations and the sAML-specific subclone additionally containing mutations in RUNX1 and IDH1. The near total absence in the sAML remission/relapsed PMF sample of the IDH1 and RUNX1 mutations indicates that treatment predominantly eradicated the sAML specific subclone. However, the RUNX1 mutation was identified at a very low frequency (0.7%) in the sAML remission/relapsed PMF sample, suggesting the presence of minimal residual disease and a potential for sAML relapse. Approximately one year following sAML remission, the patient did experience clinical sAML relapse. Biological samples were not available from the relapsed sAML stage to confirm that the RUNX1 mutation was present, as would be predicted.The availability of matched serial samples provided additional resolution regarding subclonal populations present at the PMF disease stage. Based only on the PMF validation data, there appeared to be a founding clone driven by mutations in JAK2 and U2AF1 and a subclone characterized by a mutation in MYB. However, by including the sAML data it became clear that while the ASXL1 mutation was only present at low frequency in the PMF stage, it represented an additional subclone that expanded and likely contributed to leukemic transformation. As ASXL1 is considered to be a high-risk mutation, its presence, even in a rare subclone, in the PMF stage is relevant to the biology of the patient's disease course.To our knowledge, this represents the first study to analyze the progression from a chronic phase MPN to sAML by WGS and utilize deep sequencing validation to model clonal evolution across the disease stages. Future studies with this approach are needed to determine whether consistent patterns of clonal evolution that drive MPN disease progression can be identified.
Authors: Daniel C Koboldt; Qunyuan Zhang; David E Larson; Dong Shen; Michael D McLellan; Ling Lin; Christopher A Miller; Elaine R Mardis; Li Ding; Richard K Wilson Journal: Genome Res Date: 2012-02-02 Impact factor: 9.043
Authors: Srdan Verstovsek; Ruben A Mesa; Jason Gotlib; Richard S Levy; Vikas Gupta; John F DiPersio; John V Catalano; Michael Deininger; Carole Miller; Richard T Silver; Moshe Talpaz; Elliott F Winton; Jimmie H Harvey; Murat O Arcasoy; Elizabeth Hexner; Roger M Lyons; Ronald Paquette; Azra Raza; Kris Vaddi; Susan Erickson-Viitanen; Iphigenia L Koumenis; William Sun; Victor Sandor; Hagop M Kantarjian Journal: N Engl J Med Date: 2012-03-01 Impact factor: 91.245
Authors: Claire Harrison; Jean-Jacques Kiladjian; Haifa Kathrin Al-Ali; Heinz Gisslinger; Roger Waltzman; Viktoriya Stalbovskaya; Mari McQuitty; Deborah S Hunter; Richard Levy; Laurent Knoops; Francisco Cervantes; Alessandro M Vannucchi; Tiziano Barbui; Giovanni Barosi Journal: N Engl J Med Date: 2012-03-01 Impact factor: 91.245
Authors: David E Larson; Christopher C Harris; Ken Chen; Daniel C Koboldt; Travis E Abbott; David J Dooling; Timothy J Ley; Elaine R Mardis; Richard K Wilson; Li Ding Journal: Bioinformatics Date: 2011-12-06 Impact factor: 6.937
Authors: Elaine R Mardis; Li Ding; David J Dooling; David E Larson; Michael D McLellan; Ken Chen; Daniel C Koboldt; Robert S Fulton; Kim D Delehaunty; Sean D McGrath; Lucinda A Fulton; Devin P Locke; Vincent J Magrini; Rachel M Abbott; Tammi L Vickery; Jerry S Reed; Jody S Robinson; Todd Wylie; Scott M Smith; Lynn Carmichael; James M Eldred; Christopher C Harris; Jason Walker; Joshua B Peck; Feiyu Du; Adam F Dukes; Gabriel E Sanderson; Anthony M Brummett; Eric Clark; Joshua F McMichael; Rick J Meyer; Jonathan K Schindler; Craig S Pohl; John W Wallis; Xiaoqi Shi; Ling Lin; Heather Schmidt; Yuzhu Tang; Carrie Haipek; Madeline E Wiechert; Jolynda V Ivy; Joelle Kalicki; Glendoria Elliott; Rhonda E Ries; Jacqueline E Payton; Peter Westervelt; Michael H Tomasson; Mark A Watson; Jack Baty; Sharon Heath; William D Shannon; Rakesh Nagarajan; Daniel C Link; Matthew J Walter; Timothy A Graubert; John F DiPersio; Richard K Wilson; Timothy J Ley Journal: N Engl J Med Date: 2009-08-05 Impact factor: 91.245
Authors: Li Ding; Timothy J Ley; David E Larson; Christopher A Miller; Daniel C Koboldt; John S Welch; Julie K Ritchey; Margaret A Young; Tamara Lamprecht; Michael D McLellan; Joshua F McMichael; John W Wallis; Charles Lu; Dong Shen; Christopher C Harris; David J Dooling; Robert S Fulton; Lucinda L Fulton; Ken Chen; Heather Schmidt; Joelle Kalicki-Veizer; Vincent J Magrini; Lisa Cook; Sean D McGrath; Tammi L Vickery; Michael C Wendl; Sharon Heath; Mark A Watson; Daniel C Link; Michael H Tomasson; William D Shannon; Jacqueline E Payton; Shashikant Kulkarni; Peter Westervelt; Matthew J Walter; Timothy A Graubert; Elaine R Mardis; Richard K Wilson; John F DiPersio Journal: Nature Date: 2012-01-11 Impact factor: 49.962
Authors: Zohra Nooruddin; Nicholas Miltgen; Qi Wei; Jeffrey Schowinsky; Zengang Pan; Jennifer Tobin; Enkhtsetseg Purev; Jonathan A Gutman; William Robinson; Daniel A Pollyea Journal: Haematologica Date: 2017-02-16 Impact factor: 9.941
Authors: Shovik Bandyopadhyay; Jared S Fowles; Liyang Yu; Daniel A C Fisher; Stephen T Oh Journal: Cytometry B Clin Cytom Date: 2018-11-13 Impact factor: 3.058
Authors: G Steven Bova; Heini M L Kallio; Matti Annala; Kati Kivinummi; Gunilla Högnäs; Sergei Häyrynen; Tommi Rantapero; Virpi Kivinen; William B Isaacs; Teemu Tolonen; Matti Nykter; Tapio Visakorpi Journal: Cold Spring Harb Mol Case Stud Date: 2016-05