Literature DB >> 25215500

Replication of the 4p16 susceptibility locus in congenital heart disease in Han Chinese populations.

Bijun Zhao1, Yuan Lin2, Jing Xu3, Bixian Ni4, Min Da5, Chenyue Ding6, Yuanli Hu5, Kai Zhang2, Shiwei Yang7, Xiaowei Wang3, Shiqiang Yu1, Yijiang Chen3, Xuming Mo5, Jiayin Liu8, Hongbing Shen2, Jiahao Sha9, Hongxia Ma4.   

Abstract

Congenital heart disease (CHD) is the most common form of congenital human birth anomalies and a leading cause of perinatal and infant mortality. Some studies including our published genome-wide association study (GWAS) of CHD have indicated that genetic variants may contribute to the risk of CHD. Recently, Cordell et al. published a GWAS of multiple CHD phenotypes in European Caucasians and identified 3 susceptibility loci (rs870142, rs16835979 and rs6824295) for ostium secundum atrial septal defect (ASD) at chromosome 4p16. However, whether these loci at 4p16 confer the predisposition to CHD in Chinese population is unclear. In the current study, we first analyzed the associations between these 3 single nucleotide polymorphisms (SNPs) at 4p16 and CHD risk by using our existing genome-wide scan data and found all of the 3 SNPs showed significant associations with ASD in the same direction as that observed in Cordell's study, but not with other subtypes- ventricular septal defect (VSD) and ASD combined VSD. As these 3 SNPs were in high linkage disequilibrium (LD) in Chinese population, we selected one SNP with the lowest P value in our GWAS scan (rs16835979) to perform a replication study with additional 1,709 CHD cases with multiple phenotypes and 1,962 controls. The significant association was also observed only within the ASD subgroup, which was heterogeneous from other disease groups. In combined GWAS and replication samples, the minor allele of rs16835979 remained significant association with the risk of ASD (OR = 1.22, 95% CI = 1.08-1.38, P = 0.001). Our findings suggest that susceptibility loci of ASD identified from Cordell's European GWAS are generalizable to Chinese population, and such investigation may provide new insights into the roles of genetic variants in the etiology of different CHD phenotypes.

Entities:  

Mesh:

Substances:

Year:  2014        PMID: 25215500      PMCID: PMC4162603          DOI: 10.1371/journal.pone.0107411

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Congenital heart disease (CHD) usually refers to abnormalities in the heart’s structure or function that arise before birth [1]. As the most frequent birth defect, CHD affects about 0.8% of live births [2], [3], and it is also a leading cause of perinatal and infant mortality, causing more than 220,000 deaths globally every year [4]. In China, epidemiological studies suggest an obvious increasing trend of CHD mortality with the overall mortality rate increasing from 141 in 2003 to 229 in 2010 per 10,000,000 person-years [5]. CHD can be classified into three broad categories: cyanotic heart disease, left-sided obstruction defects and septation defects [1]. Among them, septation defects are most common and can affect septation of the atria (atrial septal defect, ASD), septation of the ventricle (ventricular septal defect, VSD) or formation of structures in the central part of the heart (atrioventricular septal defect, AVSD) [1]. CHD may occur as part of recognized chromosomal and Mendelian syndromes [6], [7]; however, it manifests as a non-syndromic, non-Mendelian condition in 80% of cases and may result from a multifactorial inheritance model that involves environmental factors and genetic predisposition [8]. In the past years, several genes linked to CHD have been identified, including T-box transcription factors (TBX1, TBX5 and TBX20), homobox transcription factors (NKX2.5 and NKX2.6), basic helix-loop-helix transcription factors (HAND1 and HAND2), and GATA binding protein 4 (GATA4) [9]. More recently, genome-wide association studies (GWAS) have emerged as a powerful tool to identify novel susceptibility loci or genes of disease [10]. In May 2013, our research group conducted a GWA scan with 945 patients of ASD, VSD and ASD combined VSD cases and 1,246 non-CHD controls, followed by a two-stage validation with 2,160 ASD, VSD and ASD combined VSD cases and 3,866 controls [11]. We identified 2 loci at 1p12 (rs2474937 near TBX15 gene, odds ratio (OR)  = 1.40, P = 8.44×10−10) and 4q31.1 (rs1531070 in MAML3 gene, OR = 1.40, P = 4.99×10−12) associated with CHD significantly (P<5.0×10−8). However, these variants may represent only a very small proportion of SNPs contributing to CHD risk because of the strict criteria of the GWAS significance level (P = 10−7 or P = 10−8). Simultaneously, a GWAS of multiple CHD phenotypes in European Caucasians was conducted by Cordell et al. In that GWAS, when all CHD phenotypes were considered together, no region achieved genome-wide significant association. However, 3 SNPs were identified to be associated with ASD risk significantly after the stratification analysis was performed in different diagnostic groups (rs870142, P combined = 2.61×10−10, odds ratio (OR) = 1.456; rs16835979, P combined = 2.94×10−10, OR = 1.452 and rs6824295, P combined = 9.73×10−10, OR = 1.437) [12]. However, it is uncertain whether these associations could be applicable to diverse populations. Therefore, we first investigated the association between the 3 SNPs (rs870142, rs16835979 and rs6824295) and CHD risk by using our existing genome-wide scan data and then performed a replication study with additional 1,709 CHD cases with multiple phenotypes and 1,962 controls.

Materials and Methods

Ethics Statement

This study was approved by the institutional review board of Nanjing Medical University. The design and performance of current study involving human subjects were clearly described in a research protocol. All participants over the age of 18 would complete the informed consent in writing before taking part in this research. For the participants under the age of 18, parental written consent was obtained.

Study populations

Study population of GWAS scan has been described previously [11]. For the replication stage, 1,709 CHD cases and 1,962 controls were recruited from the First Affiliated Hospital of Nanjing Medical University and the Affiliated Nanjing Children’s Hospital of Nanjing Medical University, Nanjing, China, between March 2009 and May 2013. CHD were diagnosed based on echocardiography, some of which were further confirmed by cardiac catheterization and/or surgery. Cases that had clinical features of developmental syndromes, multiple major developmental anomalies or known chromosomal abnormalities were excluded. Exclusion criteria also included a positive family history of CHD in a first-degree relative (parents, siblings and children), maternal diabetes mellitus, phenylketonuria, maternal teratogen exposures (e.g., pesticides and organic solvents), and maternal therapeutic drugs exposures during the intrauterine period. Controls were non-CHD outpatients from the same geographic areas. They were recruited from the hospitals listed above during the same time period. Controls with congenital anomalies or cardiac disease were excluded. For each participant, approximately 2-ml whole blood was obtained to extract genomic DNA for genotyping analysis.

Quality control for GWAS scan and genotyping of replication study

The GWA scan was conducted using Illumina Omni zhonghua chips followed by a systematic quality control before association analysis [11]. In brief, we removed samples with low call rates, ambiguous gender, familial relationships, and extreme heterozygosity rate. We also detected population outliers and stratification using a PCA-based method. Our PCA analysis showed that the cases and controls were genetically matched, and the genomic control inflation factor (λ) was 1.065 [11]. SNPs were excluded if they are not mapped on autosomal chromosomes, or have a call rate <95%, minor allele frequency (MAF)<0.05 or P<1.00×10−5 for Hardy-Weinberg equilibrium. After quality control procedures, a total of 708,275 SNPs in 945 CHD cases and 1,246 controls were included in the final GWA analysis [11]. The genotyping analyses in the replication study were performed by using the TaqMan allelic discrimination Assay (Applied Biosystems, Inc, USA). The information of the primers and probes were provided in . A series of methods were used to control the quality of genotyping: (i) case and control samples were mixed on each plate; (ii) genotyping was performed without knowing the case or control status; (iii) two water controls were used in each plate as blank control; (iv) five percent of the samples were randomly selected for repeat genotyping. The accurate concordance rate of genotyping for the SNP rs16835979 was 100.00% in the replication stage.
Table 1

Primers and probes of rs16835979.

rs16835979
F-primer TGTGGACTCTAGAATGGACTTCCA
R-primer TGTCAGATTAGGACCATCTCCATCT
FAM-probeFAM-AGTGACTTTACTGTCCTC-MGB
HEX-probeHEX-AAGTGACTTTAATGTCC-MGB

Statistical analysis

Population structure was evaluated by PCA as implemented in the software package EIGENSTRAT 3.1. The significant (P<0.05) top eigenvector was included in the logistic regression model as a covariate for genetic association analysis [11]. Hardy-Weinberg equilibrium was evaluated using the χ2 test in all of the controls. The genome-wide association analysis was performed using an additive model in a logistic regression analysis in PLINK 1.07 (http://pngu.mgh.harvard.edu/~purcell/plink/). The statistical significance was declared at α  = 0.05. P values were two-sided, and ORs were estimated with an additive model by logistic regression analyses. The linkage disequilibrium (LD) analysis of the 3 SNPs (rs870142, rs16835979 and rs6824295) was performed in the controls of GWAS by using PLINK 1.07. Other analyses were performed using Stata version 9.2 (StataCorp LP, TX). The Chi-squared based Cochran’s Q statistic was calculated to test for heterogeneity between groups in stratified analysis. We used inverse-variance-weighted model for meta-analysis when performing combined analysis. Random-effects model was used when heterogeneity between studies exists, that is, P value for heterogeneity test was less than 0.05; otherwise, fixed-effect model was used.

Results

The characteristics of the 945 CHD cases and the 1,246 non-CHD controls in GWA scan have been described previously [11]. Moreover, selected characteristics of the 1,709 cases and 1,962 non-CHD controls in the replication study were shown in and there were similar distributions of age and sex between cases and controls (P = 0.221 and 0.870, respectively).
Table 2

Characteristics of CHD cases in validation stage.

VariablesCase (N = 1,709)Control (N = 1,962) P
Age (mean±SD)3.21±8.703.45±7.930.221
Sex
Male738 (43.2%)842 (42.9%)0.870
Female971 (56.8%)1,120 (57.1%)
Phenotype
ASD367
VSD432
TOF211
Other CHDs699

ASD: ostium secundum atrial septal defect; VSD: ventricular septal defect; TOF: tetralogy of fallot; Other CHDs included patent ductus arteriosus, ebstein anomaly, double-chambered right ventricle, bicuspid aortic valve, aortic insufficlency, aortic stenosis, mitral insufficiency, rupture of valsalva sinus aneurysm, etc.

P-values were derived from the χ2 test for the categorical variable (sex) and t-test for the continuous variable (age).

ASD: ostium secundum atrial septal defect; VSD: ventricular septal defect; TOF: tetralogy of fallot; Other CHDs included patent ductus arteriosus, ebstein anomaly, double-chambered right ventricle, bicuspid aortic valve, aortic insufficlency, aortic stenosis, mitral insufficiency, rupture of valsalva sinus aneurysm, etc. P-values were derived from the χ2 test for the categorical variable (sex) and t-test for the continuous variable (age). The genotype distributions of these 3 SNPs in cases and controls of GWA scan were shown in . The observed genotype frequencies were all in Hardy-Weinberg equilibrium in controls (P = 0.337 for rs870142, P = 0.370 for rs16835979 and P = 0.385 for rs6824295). Logistic regression analyses showed that no obvious associations were found between the 3 SNPs and overall risk of CHD in an additive model ( ). Then, we performed stratification analysis by different diagnostic groups (ASD, VSD and ASD combined VSD) and found that all 3 SNPs showed significant associations with ASD risk (N = 334 cases) in the same direction as that observed in Cordell’s study (rs870142: OR = 1.24, 95% CI = 1.04–1.49, P = 0.016; rs16835979: OR = 1.25, 95% CI = 1.05–1.50, P = 0.014; rs6824295: OR = 1.24, 95% CI = 1.04–1.48, P = 0.019). However, no significant association was observed in the other two disease groups ( ).
Table 3

Associations of the 3 SNPs with CHD in our GWA scan.

Chr. (cytoband)Position (bp)SNPStudyCasesb Controlsb MAFc (Cases)MAFc (Controls)OR (95% CI)d P d
4p16.24698948rs870142Combined All (945 cases, 1,246 controls)116/428/399145/534/5580.350.331.08 (0.95–1.22)0.259
G/Aa ASD (334 cases, 1,246 controls)45/164/123145/534/5580.380.33 1.24 (1.04–1.49) 0.016
VSD (534 cases, 1,246 controls)63/230/241145/534/5580.330.331.00 (0.86–1.17)0.969
ASD/VSD (77 cases, 1,246 controls)8/34/35145/534/5580.320.330.97 (0.69–1.38)0.876
4p16.24686177rs16835979Combined All (945 cases, 1,246 controls)116/426/396144/536/5600.350.331.08 (0.95–1.23)0.212
C/Aa ASD (334 cases, 1,246 controls)44/164/121144/536/5600.380.33 1.25 (1.05–1.50) 0.014
VSD (534 cases, 1,246 controls)64/228/241144/536/5600.330.331.01 (0.87–1.18)0.896
ASD/VSD (77 cases, 1,246 controls)8/34/34144/536/5600.330.331.00 0.70–1.41)0.986
4p16.24665181rs6824295Combined All (945 cases, 1,246 controls)127/445/372163/554/5250.370.351.07 (0.94–1.21)0.298
G/Aa ASD (334 cases, 1,246 controls)46/177/111163/554/5250.400.35 1.24 (1.04–1.48) 0.019
VSD (534 cases, 1,246 controls)71/232/230163/554/5250.350.350.99 (0.85–1.15)0.878
ASD/VSD (77 cases, 1,246 controls)10/36/31163/554/5250.360.351.05 (0.75–1.48)0.765

major/minor alleles.

variant homozygote/heterozygote/wild type homozygote.

minor allele frequency (MAF).

OR and P were derived from logistic regression analysis in additive model adjusting for the first principal component in GWAS.

major/minor alleles. variant homozygote/heterozygote/wild type homozygote. minor allele frequency (MAF). OR and P were derived from logistic regression analysis in additive model adjusting for the first principal component in GWAS. As these 3 SNPs were in high LD (r = 0.86–0.99) in Chinese population, we selected one SNP with the lowest P value in our GWAS scan (rs16835979) to perform a replication study with additional 1,709 CHD cases of multiple phenotypes (ASD: N = 367; VSD: N = 432, Tetralogy of Fallot (TOF): N = 211, other CHDs: N = 699) and 1,962 controls. Similarly, no significant association was observed when all phenotypes were combined together. In the stratification analysis by disease groups, rs16835979 only showed significant association with the risk of ASD (OR = 1.20, 95% CI = 1.02–1.42, P = 0.030), which was heterogeneous from the other subgroups significantly (P for heterogeneity = 0.046) ( ). In combined GWAS and replication samples, the minor allele of rs16835979 remained significantly associated with ASD risk (OR = 1.22, 95%CI = 1.08–1.38, P = 0.001) ( ).
Table 4

Associations of rs16835979 with CHD in replication study.

Chr.(cytoband)Position (bp)SNPStudyCasesb Controlsb MAFc(Cases)MAFc(Controls)OR (95% CI)d P d P f
4p16.24686177rs16835979ASD (367 cases, 1,962 controls)52/165/139215/888/8590.380.34 1.20 (1.02–1.42) 0.030 0.046
C/Aa VSD (432 cases, 1,962 controls)56/178/187215/888/8590.340.341.04 (0.89–1.22)0.635
TOF (211 cases, 1,962 controls)23/76/110215/888/8590.290.340.81 (0.65–1.02)0.070
Other CHDs (699 cases, 1,962 controls)91/312/287215/888/8590.360.341.10 (0.97–1.26)0.136
Combined subjectse (1,709 cases, 1,962 controls)222/731/723215/888/8590.350.341.05 (0.91–1.20)0.521

major/minor alleles.

variant homozygote/Heterozygote/Wild type homozygote.

minor allele frequency (MAF).

estimated in additive model.

combined via random-effects meta-analysis.

P values for heterogeneity test between groups.

Table 5

Associations of rs16835979 with ASD.

Chr.(cytoband)Position (bp)SNPStudyCasesb Controlsb MAFc(Cases)MAFc(Controls)OR (95% CI)d P d P e
4p16.24686177rs16835979 GWAS (334 ASD cases, 1,246 controls)44/164/121144/536/5600.380.33 1.25 (1.05–1.50) 0.014 0.742
C/Aa Replication (367 ASD cases, 1,962 controls)52/165/139215/888/8590.380.34 1.20 (1.02–1.42) 0.030
Combined analysis (combined via fixed-effects meta-analysis)96/329/260359/1424/14190.380.33 1.22 (1.08–1.38) 0.001

major/minor alleles.

variant homozygote/heterozygote/wild type homozygote.

minor allele frequency (MAF).

estimated in additive model.

P values for heterogeneity test between group.

major/minor alleles. variant homozygote/Heterozygote/Wild type homozygote. minor allele frequency (MAF). estimated in additive model. combined via random-effects meta-analysis. P values for heterogeneity test between groups. major/minor alleles. variant homozygote/heterozygote/wild type homozygote. minor allele frequency (MAF). estimated in additive model. P values for heterogeneity test between group.

Discussion

In this study, we attempted to replicate the 4p16 ASD susceptibility loci in Han Chinese population and found that our results were consistent with the results presented by Cordell et al to a certain extent. These findings suggest that the susceptibility loci of diseases may have some similarities among different races and ethnicities. In Cordell’s study, 3 SNPs (rs870142, rs16835979 and rs6824295) were identified to be significantly associated with ASD risk [12]. We performed a LD analysis among the 3 SNPs by the online software of SNAP (http://www.broadinstitute.org/mpg/snap/ldsearchpw.php) and found strong LD between them (r 2 = 0.89 to 0.96) in CEU (CEPH- Utah residents with European ancestry). After evaluating the LD between the 3 SNPs in the controls of our GWAS samples, we found that they were also in high LD in Chinese populations (r = 0.86–0.99). There were 28 other SNPs in the LD plot of the region containing the 3 mentioned SNPs (chr4∶4665181-4698948) and we found that most SNPs were in high LD with the 3 SNPs in European population, while only about half of them were in high LD with the 3 SNPs in Chinese population. Although we included 701 ASD cases and 3,208 controls in this study (334 cases and 1,246 controls in our GWA scan and 367 ASD cases and 1,962 controls in the replication study), the sample size, especially the case sample size was relatively smaller compared to the original Cordell’s GWAS. After performing multiple testing corrections with the Bonferroni single-step method (corrected α: 0.05/3 = 0.017), we found the SNPs rs870142 and rs16835979 remained association with ASD risk; however, the SNP rs6824295 lost its association with ASD. Given the high LD of the 3 SNPs, Bonferroni correction might be too strict. Additionally, owing to the genetic heterogeneity, the allele frequency of the SNP rs16835979 in both populations was different (Chinese population: MAF = 0.380 in cases, MAF = 0.334 in controls; European population: MAF = 0.314 in cases, MAF = 0.235 in controls) and the effect size in the current study was weaker than that in European population (OR = 1.22 in Chinese population vs. OR = 1.46 in European population). Using Levin’s formula [13], we also found that the population-attributable risk of ASD for the SNP rs16835979 was relatively lower in Chinese (7%) than that in Caucasian (9%). All 3 SNPs locate within an intron of the noncoding RNA gene LOC100507266 with unknown function. Meanwhile, they also lie in the 320-kb interval between STX18 (syntaxin 18) and MSX1 (msh homeobox 1) and locate upstream of both genes. The long non-coding RNA gene LOC100507266 is known as STX18 antisense RNA 1 (STX18-AS1). STX18 is principally located in the endoplasmic reticulum, and it plays roles in transport between the endoplasmic reticulum and Golgi [14]; however, no data are available for its function in heart development. MSX1 has been showed to be expressed in mesenchymal structures, including the limb buds, pharyngeal arches, neural crest, and endocardial cushions of the heart [15], [16]. In Cordell’s study, MSX1 was showed to be expressed in the atrial septum during development, both in mouse and chick [12]. MSX1 and MSX2, which belong to the highly conserved Nk family of homeobox genes, display overlapping expression patterns and redundant functions in multiple tissues and organs during vertebrate development [15], [16]. The functions of Msx1 and Msx2 in endocardial activation prior to EMT via upregulation of NFATc1 expression have been documented [15]. In addition, Msx1 has a well-documented role as both a downstream effector and an upstream regulator of Bmp signaling. It has been implicated in regulating epithelial-mesenchymal transition (EMT) during cardiac valve and septa formation [15], [17]. Hand1 and Hand2 are also candidate target genes regulated by Msx1 and Msx2 [18]. Since myocardium-specific Hand1 deficiency leads to thickened atrioventricula (AV) valves, which is associated with impaired valve remodeling [19]–[21], decreasing Hand1 expression in the Msx1/2 double mutant AV myocardium may be associated with defects in remodeling of the AV cushions into mature valve leaflets [15]. In the mouse, loss both of Msx1 and Msx2 leads to a severe endocardial cushion and conotruncal defects [15], [18]. In humans, mutations in MSX1 cause orofacial clefting and tooth agenesis [22], [23]. It is speculated that these 3 SNPs may affect the regulation of above genes and thus have associations with the development of ASD; however, the specific mechanisms of the 3 SNPs affecting the risk of ASD still need to be further investigated. Like Cordell’s study, we did not observe genome-wide significant associations of 4p16 loci with overall CHD risk in our GWAS as well as replication study. The findings suggested that genetic etiology of CHD could have a considerable degree of phenotypic specificity, which was also identified by some recent studies [24], [25]. For the various phenotypes of CHD originated from different part of heart, we believe different genetic factors are involved in their pathogenic process. Interestingly, our previous GWAS has identified 2 susceptibility loci (rs2474937 at 1p12 and rs1531070 at 4q31.1) for CHD in Han Chinese. However, these variants may contribute to the risk of CHD through different pathways. As described previously, the SNP rs2474937 may affect the expression of TBX15, a member of T-box transcription factors that have key roles in the development of the embryonic mesoderm, including of the heart and skeleton. Another SNP rs1531070 is in a LD region overlapping the MAML3 (mastermind-like 3) gene and mastermind (Mam) is one of the essential components of Notch signaling pathway. In the current study, we confirmed the ASD-specific association of SNP rs16835979 in Chinese. This SNP may influence MSX1 (msh homeobox 1), which belongs to the highly conserved Nk family of homeobox genes. MSX1 has functions in endocardial activation prior to epithelial-mesenchymal transition (EMT) as well as Bmp signaling. Thus, the findings in the current study supplemented the existing results of our GWAS. In conclusion, we present evidence for association between the common SNP rs16835979 at 4p16 and the ASD-specific risk in Han Chinese, which extends Cordell’s results in different populations and suggests that the susceptibility loci of disease indeed have some similarities among different races and ethnicities.
  25 in total

Review 1.  Form and function of developing heart valves: coordination by extracellular matrix and growth factor signaling.

Authors:  Joyce A Schroeder; Leslie F Jackson; David C Lee; Todd D Camenisch
Journal:  J Mol Med (Berl)       Date:  2003-06-25       Impact factor: 4.599

Review 2.  ErbB and HB-EGF signaling in heart development and function.

Authors:  Ryo Iwamoto; Eisuke Mekada
Journal:  Cell Struct Funct       Date:  2006       Impact factor: 2.212

3.  Evidence of a sex-dependent association between the MSX1 locus and nonsyndromic cleft lip with or without cleft palate in the Chilean population.

Authors:  R Blanco; R Chakraborty; S A Barton; H Carreño; M Paredes; L Jara; H Palomino; W J Schull
Journal:  Hum Biol       Date:  2001-02       Impact factor: 0.553

Review 4.  Genetic basis for congenital heart defects: current knowledge: a scientific statement from the American Heart Association Congenital Cardiac Defects Committee, Council on Cardiovascular Disease in the Young: endorsed by the American Academy of Pediatrics.

Authors:  Mary Ella Pierpont; Craig T Basson; D Woodrow Benson; Bruce D Gelb; Therese M Giglia; Elizabeth Goldmuntz; Glenn McGee; Craig A Sable; Deepak Srivastava; Catherine L Webb
Journal:  Circulation       Date:  2007-05-22       Impact factor: 29.690

Review 5.  The genetics of congenital heart disease: a review of recent developments.

Authors:  Constance G Weismann; Bruce D Gelb
Journal:  Curr Opin Cardiol       Date:  2007-05       Impact factor: 2.161

6.  Phenotype-specific effect of chromosome 1q21.1 rearrangements and GJA5 duplications in 2436 congenital heart disease patients and 6760 controls.

Authors:  Rachel Soemedi; Ana Topf; Ian J Wilson; Rebecca Darlay; Thahira Rahman; Elise Glen; Darroch Hall; Ni Huang; Jamie Bentham; Shoumo Bhattacharya; Catherine Cosgrove; J David Brook; Javier Granados-Riveron; Kerry Setchfield; Frances Bu'lock; Chris Thornborough; Koenraad Devriendt; Jeroen Breckpot; Michael Hofbeck; Mark Lathrop; Anita Rauch; Gillian M Blue; David S Winlaw; Matthew Hurles; Mauro Santibanez-Koref; Heather J Cordell; Judith A Goodship; Bernard D Keavney
Journal:  Hum Mol Genet       Date:  2011-12-22       Impact factor: 6.150

7.  Human genome epidemiology, progress and future.

Authors:  Hongbing Shen; Guangfu Jin
Journal:  J Biomed Res       Date:  2013-05-25

8.  FGFs and BMP4 induce both Msx1-independent and Msx1-dependent signaling pathways in early tooth development.

Authors:  M Bei; R Maas
Journal:  Development       Date:  1998-11       Impact factor: 6.868

9.  An illustration of and programs estimating attributable fractions in large scale surveys considering multiple risk factors.

Authors:  Simon Rückinger; Rüdiger von Kries; André Michael Toschke
Journal:  BMC Med Res Methodol       Date:  2009-01-23       Impact factor: 4.615

10.  Msx1 and Msx2 are required for endothelial-mesenchymal transformation of the atrioventricular cushions and patterning of the atrioventricular myocardium.

Authors:  Yi-Hui Chen; Mamoru Ishii; Henry M Sucov; Robert E Maxson
Journal:  BMC Dev Biol       Date:  2008-07-30       Impact factor: 1.978

View more
  9 in total

1.  A genome-wide association study of obstructive heart defects among participants in the National Birth Defects Prevention Study.

Authors:  Sara R Rashkin; Mario Cleves; Gary M Shaw; Wendy N Nembhard; Eirini Nestoridi; Mary M Jenkins; Paul A Romitti; Xiang-Yang Lou; Marilyn L Browne; Laura E Mitchell; Andrew F Olshan; Kevin Lomangino; Sudeepa Bhattacharyya; John S Witte; Charlotte A Hobbs
Journal:  Am J Med Genet A       Date:  2022-04-22       Impact factor: 2.578

2.  Association Between the 4p16 Susceptibility Locus and the Risk of Atrial Septal Defect in Population from Southeast China.

Authors:  Kaiyan Pei; Qiuyu Huang; Guican Zhang; Cailing Lu; Benzhang Yu; Liping Yang
Journal:  Pediatr Cardiol       Date:  2015-08-19       Impact factor: 1.655

3.  A genome-wide association study of congenital cardiovascular left-sided lesions shows association with a locus on chromosome 20.

Authors:  Neil A Hanchard; Shanker Swaminathan; Kristine Bucasas; Dieter Furthner; Susan Fernbach; Mahshid S Azamian; Xueqing Wang; Mark Lewin; Jeffrey A Towbin; Lisa C A D'Alessandro; Shaine A Morris; William Dreyer; Susan Denfield; Nancy A Ayres; Wayne J Franklin; Henri Justino; M Regina Lantin-Hermoso; Elena C Ocampo; Alexia B Santos; Dhaval Parekh; Douglas Moodie; Aamir Jeewa; Emily Lawrence; Hugh D Allen; Daniel J Penny; Charles D Fraser; James R Lupski; Mojisola Popoola; Lalita Wadhwa; J David Brook; Frances A Bu'Lock; Shoumo Bhattacharya; Seema R Lalani; Gloria A Zender; Sara M Fitzgerald-Butt; Jessica Bowman; Don Corsmeier; Peter White; Kelsey Lecerf; Gladys Zapata; Patricia Hernandez; Judith A Goodship; Vidu Garg; Bernard D Keavney; Suzanne M Leal; Heather J Cordell; John W Belmont; Kim L McBride
Journal:  Hum Mol Genet       Date:  2016-03-09       Impact factor: 6.150

4.  Association between the European GWAS-identified susceptibility locus at chromosome 4p16 and the risk of atrial septal defect: a case-control study in Southwest China and a meta-analysis.

Authors:  Li Zhao; Bei Li; Ke Dian; Binwu Ying; Xiaojun Lu; Xuejiao Hu; Qi An; Chunxia Chen; Chunyan Huang; Bin Tan; Li Qin
Journal:  PLoS One       Date:  2015-04-13       Impact factor: 3.240

5.  A novel RNA-mediated mechanism causing down-regulation of insulating promoter interactions in human embryonic stem cells.

Authors:  Yingjuan Liu; Simon G Williams; Hayden R Jones; Bernard D Keavney; Mun-Kit Choy
Journal:  Sci Rep       Date:  2021-12-01       Impact factor: 4.379

Review 6.  Genome-wide association studies of structural birth defects: A review and commentary.

Authors:  Philip J Lupo; Laura E Mitchell; Mary M Jenkins
Journal:  Birth Defects Res       Date:  2019-10-25       Impact factor: 2.661

7.  Associations between IL-6 Variations and Congenital Heart Disease Incidence among Chinese Han People.

Authors:  Qingjun Zhang; Hui Wang; Jun Xue; Di Wu
Journal:  Med Sci Monit       Date:  2020-06-10

8.  Association between the 4p16 genomic locus and different types of congenital heart disease: results from adult survivors in the UK Biobank.

Authors:  Aldo Córdova-Palomera; James R Priest
Journal:  Sci Rep       Date:  2019-11-11       Impact factor: 4.379

9.  Mapping methylation quantitative trait loci in cardiac tissues nominates risk loci and biological pathways in congenital heart disease.

Authors:  Ming Li; Chen Lyu; Manyan Huang; Catherine Do; Benjamin Tycko; Philip J Lupo; Stewart L MacLeod; Christopher E Randolph; Nianjun Liu; John S Witte; Charlotte A Hobbs
Journal:  BMC Genom Data       Date:  2021-06-10
  9 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.