Development of microsatellite markers in the hexaploid aquatic macrophyte, Myriophyllum spicatum (Haloragaceae).

PREMISE OF THE STUDY: We developed microsatellite primers to investigate genetic diversity and population genetic structure of the cosmopolitan submerged plant Myriophyllum spicatum. • METHODS AND
RESULTS: Twenty microsatellite loci were identified in M. spicatum using the microsatellite-enriched library method. The numbers of alleles per locus ranged from one to 13, and the expected heterozygosity varied from 0 to 0.873 with a mean of 0.504 in two Chinese populations of M. spicatum. All of the loci were also found to be amplifiable in the related species M. verticillatum and M. sibiricum. •
CONCLUSIONS: The results indicate that these markers will be significant for studies of population genetic structure and evolutionary history of M. spicatum as well as some of its related species.

Eurasian watermilfoil (Myriophyllum spicatum L.) is a perennial submerged macrophyte native to Europe, Asia, and northern Africa (Couch and Nelson, 1985). In North America, M. spicatum has been recognized as a noxious invasive plant mainly due to the rapid spread of this species (Reed, 1977; Jacono and Richerson, 2003). Myriophyllum spicatum is hexaploid, and the chromosome number (2n = 6x = 42) was reported for plants from Europe and North America (Löve, 1961; Aiken et al., 1979), whereas there was no report about the polyploid types of M. spicatum because its chromosomes were found to be too small to disclose morphological characteristics for karyotype analysis (Aiken, 1981). There have been numerous studies concerned with the ecology and management of M. spicatum, and only a few studies have revealed DNA sequence variation among different individuals (e.g., Moody and Les, 2007). No investigation has been carried out to examine genetic variation in M. spicatum at the population level; the evolutionary processes of this species are more likely distinctive due to its occurrence in exclusively aquatic habitats (Barrett et al., 1993). Therefore, we isolated 20 microsatellite markers from M. spicatum for use in investigations of genetic variation, population genetic structure, and evolutionary history of this cosmopolitan submerged species.

METHODS AND RESULTS

Total genomic DNA was extracted from the dried leaves of one individual of M. spicatum sampled from the Tai Lake population (Appendix 1) using the DNAsecure Plant Kit (Tiangen Biotech, Beijing, China). A microsatellite-enriched library was developed following the protocol of Glenn and Schable (2005). The genomic DNA was digested into ∼500-bp fragments with RsaI and XmnI (New England Biolabs, Ipswich, Massachusetts, USA) and ligated to the SuperSNX24 adapters (F: 5′-GTTTAAGGCCTAGCTAGCAGAATC-3′, R: 5′-pGATTCTGCTAGCTAGGCCTTAAACAAA-3′). The digestion-ligation mixture was hybridized with 3′ biotinylated oligo probes (AC)18/(AG)18/(ATG)12 and captured by Dynabeads M-280 streptavidin (Invitrogen, Dynal AS, Oslo, Norway) for enrichment of simple sequence repeat (SSR) sequences. The products were recovered by PCR amplification with the SuperSNX24 forward primer, ligated into the pEASY-T1 Simple Cloning Vector (Transgen, Beijing, China), and then transformed into competent cells of E. coli. Eighty-three positive clones were selected and sequenced with the ABI 3730XL DNA analyzer (Applied Biosystems, Foster City, California, USA). Forty-three clones, or approximately 50% of the positive clones, contained SSRs.

Appendix 1.

Geographic location and voucher information of Myriophyllum populations in this study. All voucher specimens are deposited at the Wuhan University Herbarium (WH).

Species	Population	Location	Geographic coordinates	Voucher no.
M. spicatum	FY	Fuyang, Zhejiang	29°59′40″N, 119°41′40″E	Xu et al., 1051
M. spicatum	TJ	Tongjiang, Heilongjiang	47°30′06″N, 133°05′10″E	Xu et al., 201
M. spicatum	BM	Bomi, Tibet	29°54′58″N, 95°38′05″E	Xu et al., 2464
M. spicatum	Tai Lake	Suzhou, Jiangsu	31°13′22″N, 120°26′46″E	Xu et al., 1017
M. spicatum	Liangzi Lake	Ezhou, Hubei	30°15′30″N, 114°33′30″E	Xu et al., 2616
M. spicatum	Bosten Lake	Bohu, Xinjiang	41°54′24″N, 86°43′53″E	Xu et al., 2570
M. verticillatum	Xinkai Lake	Mishan, Heilongjiang	45°20′43″N, 132°22′16″E	Xu et al., 137
M. sibiricum	DQ	Deqin, Yunnan	28°30′22″N, 98°54′41″E	Xu et al., 2450

PCR primers were designed for all 43 sequences using the program Primer Premier 5.0 (PREMIER Biosoft International, Palo Alto, California, USA) and evaluated in 20 individuals from six different populations of M. spicatum (Appendix 1). Twenty pairs of primers (Table 1) that showed single and clear bands were chosen and labeled with the fluorescent dyes 6-FAM, HEX, or ROX. Characterization of the SSR loci was estimated in two distant populations in China (Bosten Lake population and Liangzi Lake population; Appendix 1), each with 20 individuals. PCR amplifications were performed in 15 μL total volume containing ∼50 ng genomic DNA, 0.33 μM of each primer, and 1× PCR Mix (Tiangen Biotech). Microsatellites were amplified under the following conditions: 5 min initial denaturation at 94°C; 35 cycles of 30 s at 94°C, 30 s at 52–60°C (Table 1), and 1 min at 72°C; and a final extension at 72°C for 10 min. PCR products were analyzed on the ABI 3730XL and genotyping was performed using GeneMapper version 4.0 software (Applied Biosystems).

Table 1.

Characteristics of 20 microsatellite markers developed in Myriophyllum spicatum.

Locus	Primer sequences (5′–3′)	Repeat motif	Size range (bp)	Ta (°C)	Fluorescent dyea	GenBank accession no.
Myrsp1	F: GTCAAAGCAGCCACTCGG	(TCA)3(TCAGCA)2(GCA)3	179–184	59	6-FAM	JX000192
	R: GGCAACAATGCAGCTAACC
Myrsp2	F: TTCTACCGCGAAAGACT	(AC)4(TC)10	340–358	52	6-FAM	JX000193
	R: CCATCATTCCTATCAACC
Myrsp3	F: CACCACTCCTAAACTCACCCTC	(TA)7(TG)18	439–457	60	6-FAM	JX000194
	R: GCTCATCGCCAACTCCTG
Myrsp4	F: ACTGGCTAATGATATGCTGA	(TC)17(AC)9	253–284	54	ROX	JX000195
	R: TCTTTCCACGCCTCTTC
Myrsp5	F: GGGAAGCCGACAAGAAA	(TC)11	351–360	55	ROX	JX000196
	R: CGAAGACGGAGTTATCAAG
Myrsp6	F: TAACAAACCGTACATTACAAGC	(TC)17	145–155	59	ROX	JX000197
	R: TTTCTCTGGGAGCCATAAC
Myrsp7	F: AGGACGGAGATAGGATGG	(TGA)10(TC)3(TG)3	297–307	60	6-FAM	JX000198
	R: GAGGGCAAAGGGATGAC
Myrsp8	F: GCACCATTAGGAGGAGAAC	(CA)9	282–287	58	HEX	JX000199
	R: CTGCCGAAGATGAAACG
Myrsp9	F: TCCCCATCTGGTTCGTAT	(ATC)5(TTCATC)2(TTC)2	224–233	58	HEX	JX000200
	R: GGAAGGTAGCGGAGTGC
Myrsp10	F: CTAATCCCAGTCCACGG	(TCA)4(GCA)5	268–273	59	HEX	JX000201
	R: GCTGAAATTGAAGCCTCT
Myrsp11	F: ATTCCAATCCCACAGTCT	(GAA)3(TGC)6(TGA)3	267–269	55	ROX	JX000202
	R: TCGGCTCATTAGTCCC
Myrsp12	F: CGCTTCACAAGTATTCTG	(TC)18(AC)10	349–384	52	HEX	JX000203
	R: TTCATGGTAGCCGTCA
Myrsp13	F: GCTTCCATTGCGAAACTT	(GCA)4(TCA)4(GCA)3	450–455	55	ROX	JX000204
	R: CCCAAACACCACCTCATT
Myrsp14	F: TTCCCATCCTTCTCCTG	(TA)2(TG)8(TA)8(GA)4	301–313	58	ROX	JX000205
	R: CCAAGTAAGTGTCCCAAAC
Myrsp15	F: TCTTTCCACGCCTCTTC	(TG)7(AG)9	247–282	56	6-FAM	JX000206
	R: ACTGGCTAATGATATGCTGA
Myrsp16	F: GGCTGCCCTATGCTAA	(TG)2(CA)8(TA)6(GA)6	339–354	54	ROX	JX000207
	R: ATCCCACTGAAGTCAAACT
Myrsp17	F: CGGAAATACAGTCCAAGGT	(GT)2(TG)9	320	58	HEX	JX000208
	R: CATGAGACACTAGTAAAGATCGA
Myrsp18	F: GACGCCAAATCCAACT	(TCA)11	331–339	58	6-FAM	JX000209
	R: AATGATGTGCCTATACTGAA
Myrsp19	F: CTCACCGCCTCGTTAAA	(TC)8	138–148	54	HEX	JX000210
	R: CGTGTTCATTCCATCATTG
Myrsp20	F: ACCTCTTCTTCCTGTCTACC	(AG)13	104	57	6-FAM	JX000211
	R: ACTAAGCCACATCTGTCTGA

Note: Ta = annealing temperature.

All forward primers were labeled with fluorescent dyes except Myrsp4, Myrsp6, and Myrsp19, in which the labels are on the reverse primers.

Because M. spicatum is hexaploid, up to six alleles per locus should be expressed in one single plant. Of all 20 loci, however, most showed no more than four alleles per individual (Table 2); no reliable explanation could be provided for this considering that the inheritance pattern of M. spicatum was ambiguous. The allele dosage of partial heterozygotes is difficult to identify, thus the presence/absence of the peaks was used to calculate the frequencies for Nei’s expected heterozygosity. The locus Myrsp12 showed the highest polymorphism with 13 alleles in the Liangzi Lake population, whereas Myrsp17 and Myrsp20 were monomorphic in both populations. The expected heterozygosity ranged from 0 to 0.873 with a mean of 0.407 and 0.601 in the two populations, respectively (Table 2).

Table 2.

Results of initial primer screening in two populations of Myriophyllum spicatum.

		Bosten Lake		Liangzi Lake
Locus	Am	A	He	A	He
Myrsp1	3	4	0.661	3	0.591
Myrsp2	3	3	0.594	9	0.847
Myrsp3	2	1	0	5	0.417
Myrsp4	4	2	0.496	10	0.782
Myrsp5	5	4	0.703	8	0.817
Myrsp6	3	5	0.568	4	0.681
Myrsp7	2	1	0	5	0.687
Myrsp8	2	2	0.496	2	0.496
Myrsp9	3	1	0	8	0.716
Myrsp10	2	4	0.543	4	0.543
Myrsp11	2	1	0	2	0.466
Myrsp12	6	3	0.667	13	0.873
Myrsp13	3	2	0.496	3	0.631
Myrsp14	4	4	0.543	10	0.773
Myrsp15	4	4	0.543	10	0.784
Myrsp16	4	3	0.665	4	0.689
Myrsp17	1	1	0	1	0
Myrsp18	4	3	0.665	4	0.727
Myrsp19	2	2	0.496	2	0.496
Myrsp20	1	1	0	1	0
Mean	3	2.55	0.407	5.4	0.601

Note: A = number of alleles; Am = maximum allele number per individual; He = expected heterozygosity.

Cross-species amplification was conducted in M. verticillatum L. (10 individuals, Appendix 1) and M. sibiricum Kom. (20 individuals, Appendix 1), both of which are in the same section of Myriophyllum as M. spicatum (Moody and Les, 2010). All of the loci were amplified successfully in these two related species.

CONCLUSIONS

The polymorphism observed for the microsatellite loci we isolated is high enough to support genetic studies in M. spicatum. Cross-species amplification also reveals that these markers are suitable to use in two related species. We conclude that these primers will facilitate the investigation of genetic diversity, population structure, and evolutionary history of M. spicatum as well as some of its related species.