Transcript-RNA-templated DNA recombination and repair.

Homologous recombination is a molecular process that has multiple important roles in DNA metabolism, both for DNA repair and genetic variation in all forms of life. Generally, homologous recombination involves the exchange of genetic information between two identical or nearly identical DNA molecules; however, homologous recombination can also occur between RNA molecules, as shown for RNA viruses. Previous research showed that synthetic RNA oligonucleotides can act as templates for DNA double-strand break (DSB) repair in yeast and human cells, and artificial long RNA templates injected in ciliate cells can guide genomic rearrangements. Here we report that endogenous transcript RNA mediates homologous recombination with chromosomal DNA in yeast Saccharomyces cerevisiae. We developed a system to detect the events of homologous recombination initiated by transcript RNA following the repair of a chromosomal DSB occurring either in a homologous but remote locus, or in the same transcript-generating locus in reverse-transcription-defective yeast strains. We found that RNA-DNA recombination is blocked by ribonucleases H1 and H2. In the presence of H-type ribonucleases, DSB repair proceeds through a complementary DNA intermediate, whereas in their absence, it proceeds directly through RNA. The proximity of the transcript to its chromosomal DNA partner in the same locus facilitates Rad52-driven homologous recombination during DSB repair. We demonstrate that yeast and human Rad52 proteins efficiently catalyse annealing of RNA to a DSB-like DNA end in vitro. Our results reveal a novel mechanism of homologous recombination and DNA repair in which transcript RNA is used as a template for DSB repair. Thus, considering the abundance of RNA transcripts in cells, RNA may have a marked impact on genomic stability and plasticity.

To investigate the capacity of transcript RNA to recombine with genomic DNA, we examined if a chromosomal DSB could be repaired directly by endogenous RNA in yeast S. cerevisiae cells. We designed a strategy in which we could induce a DSB in the HIS3 marker gene and monitor precise repair of the DSB by a homologous transcript messenger RNA by restoration of the HIS3 function resulting in histidine prototrophic (His+) cells (see Methods). We developed two experimental yeast cell systems, trans and cis, in strains YS-289, 290 and YS-291, 292, respectively (Extended Data Table 1). The trans system is designed to test the ability of a spliced (intron-less) antisense his3 transcript from chromosome (Chr) III to repair a DSB in a different his3 allele on Chr XV, which contains an engineered HO endonuclease cutting site (Fig. 1a and Extended Data Fig. 1a,b). Differently, the cis system is designed to test the capacity of the spliced antisense his3 transcript from Chr III to repair a HO endonuclease-induced DSB located inside the intron of the same his3 locus (Fig. 1b and Extended Data Fig. 1c). In both the trans and cis cell systems, the spliced antisense his3 transcript RNA can serve as a homologous template to repair the broken his3 DNA and restore its function. However, given the abundance of Ty retrotransposons in yeast cells, the spliced antisense his3 RNA could potentially be reverse transcribed by the Ty reverse transcriptase (RT) in the cytoplasm within the Ty particles to cDNA that could then recombine with the homologous broken his3 sequence or be captured by NHEJ at the HO break site to produce His+ cells[6-8]. To distinguish DSB repair mediated by transcript RNA-template from repair mediated by cDNA-template, we performed the trans and cis assays in two yeast strains that either contained a wild-type SPT3 gene or its null allele, which reduces Ty RT function over 100-fold[3,8,9]. In both assays, cells containing wild-type SPT3 produced numerous His+ colonies after DSB induction (Fig. 1c and Table 1a). As expected, the frequency of His+ colonies in the trans system was significantly higher than that in the cis system because the his3 transcript is continuously generated in the presence of galactose. In contrast, production of the full his3 transcript is immediately terminated upon DSB formation in the cis system. This frequency difference is not specific to the particular genomic loci in which the DSBs are induced, as transformation by DNA oligos (HIS3.F and HIS3.R) designed to repair the broken his3 gene produced the same frequency of His+ colonies in the two systems (Extended Data Tables 2a and 3) demonstrating that the HO DSB stimulates HR in the trans and cis systems equally well. Notably, almost all the His+ colonies are dependent on SPT3 function indicating that the DSB in his3 is repaired exclusively via the cDNA pathway (Fig. 1c and Table 1a). This finding demonstrates that if an actively transcribed gene is broken, it can be repaired using a cDNA template derived from its intact transcript. Moreover, these data also support the model that reverse transcribed products from any sort of RNA can be a significant source of genome modification at DSB sites[10] (and references therein).

Extended Data Table 1

Yeast strains used in this study

S. cerevisiae strains used in this study. Strains specifically used for the trans or cis assay are indicated.

Strain	Relevant genotype	Source
FRO-767	hoΔ hmlΔ::ADE1 mataΔ::hisG hmrΔ::ADE1 ade1 leu2::HOcs lys5 trp1::hisG ura3-52 ade3::GAL::HO	[3]
FRO-1072	hoΔ hmlΔ::ADE1 Δmata::hisG hmrΔ::ADE1 ade1 leu2::pGAL1-mhis3AI-URA3 lys5 trp1::hisG ura3-52 ade3::GAL::HO	this study
FRO-1073	hoΔ hmlΔ::ADE1 mataΔ::hisG hmrΔ::ADE1 ade1 leu2::pGAL1mhis3AI-ADE3 lys5 trp1::hisG ura3-52 ade3::GAL::HO	this study
FRO-1074	FRO-1073 his3::CORE-UH	this study
FRO-1075,1080 (trans)	FRO-1073 his3::HOcs	this study
FRO-1092, 1093	hoΔ hmlΔ::ADE1 mataΔ::hisG hmrΔ::ADE1 ade1 leu2::pGAL1-ADE3 lys5 trp1::hisG ura3-52 ade3::GAL::HO his3::HOcs rad52Δ::kanMX4	this study
YS-164, 165	FRO-1075, 1080 (HIS3::HOcs)::TRP1	this study
YS-166, 167	YS-164, 165 pGAL1-mhis3AI::CORE	this study
YS-172, 174 (cis)	YS-166, 167 pGAL1-mhis3AI::HO	this study
YS-275, 276	FRO-1075, 1080, YCLWTy2-1::CORE	this study
YS-278, 281	YS-172, 174 YCLWTy2-1::CORE	this study
YS-289, 290 (trans) WT	YS-275, 276 YCLWTy2-1Δ	this study
YS-291, 292 (cis) WT	YS-278, 281 YCLWTy2-1Δ	this study
YS-414, 415 (trans)	YS-289, 290 rnh1Δ::kanMX4	this study
YS-416, 417 (cis)	YS-291, 292 rnh1Δ::kanMX4	this study
YS-410, 411 (trans)	YS-289, 290 rnh201Δ::hygMX4	this study
YS-412, 413 (cis)	YS-291, 292 rnh201Δ::hygMX4	this study
YS-428, 429 (trans)	YS-289, 290 spt3Δ::kanMX4	this study
YS-440, 441 (cis)	YS-291, 292 spt3Δ::kanMX4	this study
YS-444, 445 (cis)	YS-291, 292 rad52Δ::kanMX4	this study
YS-446, 447 (cis)	YS-291, 292 rad51Δ::kanMX4	this study
HK-76, 77 (trans)	YS-289, 290 dbr1Δ::kanMX4	this study
HK-72, 73 (cis)	YS-291, 292 dbr1Δ::kanMX4	this study
YS-520, 521 (trans)	YS-414, 415 spt3Δ::hygMX4	this study
YS-522, 524 (cis)	YS-416, 417 spt3Δ::hygMX4	this study
YS-452, 453 (trans)	YS-410, 411 spt3Δ::hygMX4	this study
YS-464, 465 (cis)	YS-412, 413 spt3Δ::hygMX4	this study
YS-422, 423 (trans)	YS-289, 290 rnh1Δ::NAT rnh201Δ::hygMX4	this study
YS-424, 426 (cis)	YS-291, 292 rnh1Δ::NAT rnh201Δ:: hygMX4	this study
YS-476, 477 (trans)	YS-289, 290 rnh1Δ::NAT rnh201Δ::hygMX4 spt3Δ::kanMX4	this study
YS-486, 487 (cis)	YS-291, 292 rnh1Δ::NAT rnh201Δ::hygMX4 spt3Δ::kanMX4	this study
YS-490, 491 (cis)	YS-424, 426 rad52Δ::kanMX4	this study
YS-492, 493 (cis)	YS-424, 426 rad51Δ::kanMX4	this study
HK-78, 79 (trans)	YS-422, 423 dbr1Δ::kanMX4	this study
HK-74, 75 (cis)	YS-424, 426 dbr1Δ::kanMX4	this study
HK-213, 215 (trans)	YS-422, 423 dbr1Δ::KIURA3	this study
HK-217, 219 (cis)	YS-424, 426 dbr1Δ::KIURA3	this study
HK-136, 137 (trans)	YS-422, 423 spt3Δ::KIURA3	this study
HK-138, 139 (cis)	YS-424, 426 spt3Δ::KIURA3	this study
HK-194, 197 (cis)	HK-138, 139 rad52Δ::kanMX4	this study
HK-180, 184 (cis)	HK-138, 139 rad51Δ::kanMX4	this study
HK-112, 113 (trans)	HK-78, 79 spt3Δ::KIURA3	this study
HK-110, 111 (cis)	HK-74, 75 spt3Δ::KIURA3	this study
YS-526, 527 (cis)	YS-291 pGAL1Δ::KIURA3	this study
YS-528, 529 (cis)	YS-424, 426 pGAL1Δ::KIURA3	this study
YS-530, 531 (cis)	YS-486, 487 pGAL1Δ::KIURA3	this study
YS-532, 533 (cis)	YS-291, 292 ade3::GAL::hoΔ::KIURA3	this study
YS-534, 535 (cis)	YS-424, 426 ade3::GAL::hoΔ::KIURA3	this study
YS-536, 537 (cis)	YS-486, 487 ade3::GAL::hoΔ::KIURA3	this study
HK-9, 10 (cis)	YS-291, 292 + Yep195spGAL	this study
HK-11, 12 (cis)	YS-291, 292 + Yep195spGAL-RNH201-WT	this study
HK-13, 14 (cis)	YS-291, 292 + Yep195spGAL-mh201-D39A	this study
HK-15, 16 (cis)	YS-440, 441 + Yep195spGAL	this study
HK-17, 18 (cis)	YS-440, 441 + Yep195spGAL-RNH201-WT	this study
HK-19, 20 (cis)	YS-440, 441 + Yep195spGAL-rnh201-D39A	this study
HK-21, 22 (cis)	YS-424, 426 + Yep195spGAL	this study
HK-23, 24 (cis)	YS-424, 426 + Yep195spGAL-RNH201-WT	this study
HK-25, 26 (cis)	YS-424, 426 + Yep195spGAL-rnh20- D39A	this study
HK-27, 28 (cis)	YS-486, 487 + Yep195spGAL	this study
HK-29, 30 (cis)	YS-486, 487 + Yep195spGAL-RNH201-WT	this study
HK-31, 32 (cis)	YS-486, 487 + Yep195spGAL-rnh201-D39A	this study
YS-301	MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 trp5(ΔCC1001-2; G1017→A)	[44]
YS-305	YS-301 rnh201Δ::kanMX4	[44]
KK-72	YS-305 rnh1Δ::hygMX4	this study
TY-32, 52	YS-301 + BDG102 (empty vector)	this study
TY-17, 53	YS-301 + BDG598 (pGTy-H3mHIS3AI)	this study
TY-36, 66	KK-72 + BDG102 (empty vector)	this study
TY-22, 67	KK-72 + BDG598 (pGTy-H3mHIS3AI)	this study
HK-386, 388 (cis)	YS-291, 292 mhis3AI::CORE	this study
HK-382, 384 (cis)	YS-424, 426 mhis3AI::CORE	this study
HK-396, 400 (cis)	HK-386, 388 AIΔ23	this study
HK-391, 394 (cis)	HK-382, 384 AIΔ23	this study
HK-404, 407 (cis)	HK-391, 394 spt3Δ::kanMX4	this study

Figure 1

Repair of a chromosomal DSB by transcript RNA

Scheme of the (a) trans and (b) cis cell systems used to detect DSB repair by transcript RNA. HO, HO endonuclease; AI, artificial intron; RT, reverse transcriptase. Examples of replica-plating results (n = 6) from galactose medium to histidine dropout medium demonstrating the ability of various yeast strains (relevant genotypes shown) of the trans and cis systems to generate histidine prototrophic colonies (c) in the absence of SPT3, or DBR1 function, or with PFA, (d) in the presence of the plasmid carrying the pGAL1-mhis3AI cassette (BDG606) or the control (BDG283), or (e) when the AI has a 23-bp deletion.

Extended Data Figure 1

DNA sequence of the his3 loci in the trans and cis systems

a, Trans system on Chr III. HIS3 ATG and STOP codons are boxed. The HIS3 gene is disrupted by an insert (orange) carrying the artificial intron (AI). The consensus sequences of the AI are boxed. b, Trans system on Chr XV. HIS3 ATG and STOP codons are shown. The HIS3 gene is disrupted by an insert (yellow) containing the 124-bp HO site (marked by lines). c, Cis system on Chr III. HIS3 ATG and STOP codons are shown. The HIS3 gene is disrupted by an insert (orange) carrying the AI, which contains the 124-bp of the HO site (yellow and marked by lines). The consensus sequences of the AI are boxed. * indicates a 23-bp deletion of the AI, including the 5’-splice site, made in some strains.

Table 1

Frequencies of cDNA and transcript RNA-templated DSB repair in trans and in cis

a	trans			cis
Genotype	His+ freq.		Survival	His+ freq.		Survival
WT	12,300	(10,000-14,600)	1.1%	2,100	(1,800-2,700)	0.7%
spt3	<0.1	(0-8)	8%[*]	<0.1	(0-0)	4.8%
rnh201	33,000	(30,400-42,200)	0.7%	15,800	(11,800-18,300)	0.6%
rnh201 spt3	<0.1	(0-5)	8%	<0.1	(0-0)	7%
rnh1	20,610	(17,100-23,900)	0.8%	1,780	(1,200-2,600)	0.5%
rnh1 spt3	<0.1	(0-5)	9%	<0.1	(0-10)	4.5%
rnh1 rnh201	69,000	(58,600-76,500)	1%	75,000	(57,900-82,100)	0.5%
rnh1 rnh201 spt3	642	(590-800)	11%	6,920	(5,840-7,900)	6%

a, Frequencies of His+ colonies per 107 viable cells for yeast strains of the trans and cis system following 48-h galactose treatment are shown as median and 95% CI (in parentheses). Percentage of cell survival after incubation in galactose is also shown. There were 26 repeats for WT, 12 for spt3, rnh201, rnh201 spt3, rnh1, rnh1 spt3; 24 for rnh1 rnh201 in both trans and cis,24 for trans rnh1 rnh201 spt3 and 18 for cis rnh1 rnh201 spt3.

b, Frequencies of His+ colonies per 107 viable cells for different rad52 and rad51 mutant strains of the cis system following 48-h galactose treatment are shown as median and 95% CI (in parentheses). There were 12 repeats for WT, rnh1 rnh201 spt3, rnh1 rnh201 rad52, rnh1 rnh201 spt3 rad52, and 6 for rad52, rnh1 rnh201, rad51, rnh1 rnh201 rad51, rnh1 rnh201 spt3 rad51. Percentage of cell survival after incubation in galactose is also shown. For the significance of comparisons between the strains in the trans and the cis systems, and between different strains of the trans or the cis system we used the two-tailed Mann-Whitney U test, see Supplementary Table 1a and b).

Cells with the spt3-null allele have higher survival than wild-type SPT3 cells after DSB induction because they spend more time in G2 (see Extended Data Fig. 2c).

Extended Data Table 2

Oligos used in this study and sequence patterns of the HIS3 region repaired by transcript RNA or via NHEJ

a, Name, size and sequence of the oligos used in this study are described. The specific experiments in which the oligos were utilized are indicated. b, Sequence patterns of the HIS3 region repaired by transcript RNA or via NHEJ. All 24 His+ cis rnh1 rnh201 spt3 clones that were sequenced had perfect match with wild-type HIS3 sequence. Differently, when we examined the sequence of the rare His+ clones that we could obtain (~10/107 viable cells) from a strain that had the HO site in his3 on Chr XV (the construct is identical to that described in Extended Data Fig. 1b) and was rad52 null (FRO-1092, 1093), 29 out of 29 His+ samples had replaced 4 nucleotides (TGGC) of his3 next to the HO site with new sequence. Differences from the WT HIS3 gene are in bold. A-C, patterns of the HIS3 region from spontaneous His+ revertants. Among the 29 sequenced HIS3 regions, 25 displayed pattern A, 3 displayed pattern B, and 1 displayed pattern C. The four bases inconsistent with the WT HIS3 affected two codons, causing a silent mutation (GCC → GCG: Ala → Ala) and a missense mutation (AAG → GTA, GTC or GTG: Lys → Val).

a
Name	Size	Sequence	Experiment
HIS3.F	80	5’ACCAATGCACTCAACGATTAGCGACCAGCCGGAATGCTTGGCCAGAGCATGTATCATATGGTCCAGAAACCCTATACCTG	Transformation
HIS3.R	80	5’CAGGTATAGGGTTTCTGGACCATATGATACATGCTCTGGCCAAGCATTCCGGCTGGTCGCTAATCGTTGAGTGCATTGGT	Transformation
His3.F2	20	5’ CCTGTTCTGCTACTGCTTCT	qRT-PCR
His3.R2	20	5’ CGATCTCTTTAAAGGGTGGT	qRT-PCR
ACT1.F	20	5’ TTGGATTCCGGTGATGGTGT	qRT-PCR
ACT1.R	20	5’ CGGCCAAATCGATTCTCAAA	qRT-PCR
CEN16.F	20	5’ TGAGCAAACAATTTGAACAG	qRT-PCR
CEN16.R	18	5’ CCGATTTCGCTTTAGAAC	qRT-PCR
His3.2	20	5’ GAGAGCAATCCCGCAGTCTT	Colony PCR
His3.5	20	5’ ATGACAGAGCAGAAAGCCCT	Colony PCR
HO.F	20	5’ AACCACTCTACAAAACCAAA	Colony PCR
INTRON.F	20	5’ GTATGTTAATATGGACTAAA	Colony PCR
S3.1	20	5’ TTAAAGAGGCCCTAGGGGCC	Southern blot
S3.2	20	5’ CTACATAAGAACACCTTTGG	Southern blot
S3.3	20	5’ TTTGCGCCTTTGGATGAGGC	Southern blot
S3.4	20	5’ TTGGGCGAGGTGGCTTCTCT	Southern blot
211	48	5’ GAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAAT	Rad52 Annealing
501	48	5’ GAAGCAUUUAUCAGGGUUAUUGUCUCAUGAGCGGAUACAUAUUUGAAU	Rad52 Annealing
508	53	5’ ATTCAA ATATGTATCCGCTAATGAGACAATAACCCTGATAAATGCTTCACTAG	Rad52 Annealing
509	32	5’ TTATTGTCTCATTAGCGGATACATATTTGAAT	Rad52 Annealing

Extended Data Table 3

His+ frequency in the trans and cis systems following transformation by HIS3.F and HIS3.R oligos

Frequency of His+ transformant colonies per 107 viable cells for WT, rnh1 rnh201, and rnh1 rnh201 spt3 mutant strains after transformation with HIS3.F and HIS3.R oligos in both trans and cis systems is shown as median and 95% CI (in parentheses). There were four or eight repeats for each of the strains transformed with these oligos. The significance of comparisons between the strains in the trans and the cis systems, and between different strains of the trans or cis system were calculated using the Mann-Whitney U test (Supplementary Table 1d). The strains used in this experiment were: YS-289, YS-290, YS-291, YS-292, YS-422, YS-423, YS-424, YS-426, YS-476, YS-477, YS-486, YS-487, HK-404, HK-407. ND, not determined.

	trans				cis
Genotype	No Oligo		HIS3.F + HIS3.R		No Oligo		HIS3.F + HIS3.R
WT	2.3	(0-8)	1.6×106	(1.4×106 -1.9×106)	<0.1	(0-0)	1.5×106	(946,000-2.3×106)
rnh1 rnh201	8	(0-56)	1×106	(1.1×105 -1.9×106)	165[*]	(63-275)	845,500	(669,000-1×106)
rnh1 rnh201 spt3	1.7	(1-2)	215,480	(196,000-235,000)	49[*]	(25-78)	225,300	(156,000-326,700)
rnh1 rnh201 spt3 AI Δ 23	ND		ND		<0.1	(0-0)	798,370	(610,100-1×106)

We note that when the trans and cis rnh1 rnh201 or rnh1 rnh201 spt3 strains were transformed using exogenous HIS3.F and HIS3.R synthetic oligos following DSB induction, the frequencies of His+ colonies were similar to each other in the trans and cis rnh1 rnh201 or rnh1 rnh201 spt3 cells. In contrast, when no oligos were added, the few His+ colonies were 20 to 28-fold more numerous in cis than in trans rnh1 rnh201 or rnh1 rnh201 spt3 cells, respectively, likely originating from DSB repair by the his3 antisense transcript.

In order for RNA to recombine with DNA, a required intermediate step is likely the formation of an RNA-DNA heteroduplex. We therefore deleted the genes coding for RNase H1 (RNH1) and/or the catalytic subunit of RNase H2 (RNH201), which both cleave the RNA strand of RNA-DNA hybrids[11]. Remarkably, while deletion of RNH1 slightly increased the frequency of His+ colonies in the trans system, deletion of RNH201 increased the frequency of His+ colonies in both the trans and cis systems, and combined deletion of RNH1 and RNH201 resulted in an even stronger increase of His+ colonies in both systems. Moreover, we detected His+ colonies in rnh1 rnh201 cells in the absence of SPT3 (Fig. 1c and Table 1a). Interestingly, there were more His+ colonies in cis rnh1 rnh201 spt3 than in trans, and the frequency of His+ colonies observed in the rnh1 rnh201 spt3 relative to spt3 cells was much higher in cis (>69,000) than in trans (>6,400) (Fig. 1c and Table 1a). If DSB repair in rnh1 rnh201 spt3 cells had been due to cDNA, we would have expected a higher His+ frequency in the trans than in the cis system, as observed in wild-type cells. The fact that the His+ frequency is higher in the cis system suggests that DSB repair is not mediated by cDNA but rather RNA or predominantly RNA. To further examine the possibility that residual cDNA rather than transcript RNA is responsible for his3 correction in cis rnh1 rnh201 spt3 cells, we introduced a trans system directly in these cells and in the control cis wild-type cells. When wild-type cells of the cis system were transformed with a low-copy-number plasmid carrying the pGAL1-mhis3AI cassette (BDG606, see Methods), they displayed a large (a factor of 4,000) increase in the His+ frequency following DSB induction in his3 compared to the same cells transformed with the control empty vector (BDG283). On the contrary, in cis rnh1 rnh201 spt3 cells BDG606 did not significantly increase the His+ frequency (Fig. 1d and Extended Data Table 4). These results argue against the role of residual cDNA in template-dependent DSB repair in cis rnh1 rnh201 spt3 cells and support a predominant, direct template function of the cis his3 transcript RNA in these cells. Overall, these data support the conclusion that a transcript RNA can directly repair a DSB in cis in rnh1 rnh201 and rnh1 rnh201 spt3 cells. The physical proximity of the his3 transcript to its own his3 DNA during transcription could facilitate annealing of the broken DNA ends to the transcript. This possibility is consistent with the fact that closer donor sequences repair DSBs more efficiently[12,13] and that mature transcript RNAs are rapidly exported to the cytoplasm or degraded after completion of transcription[14].

Extended Data Table 4

His+ frequencies in the presence of plasmid BDG283 or BDG606 in cis strains

Frequencies of Ura+His+ colonies per 107 viable cells for yeast strains of the cis cell system transformed with plasmid BDG283 or BDG606 following 48-h galactose or glucose treatment are shown as median and 95% CI (in parentheses). Percentage of cell survival after incubation in galactose or glucose is shown. There were 6 repeats for all the strains. The significance of comparisons between strains was calculated using the Mann-Whitney U test (Supplementary Table 1e).

Galactose
	cis
Genotype	Ura+His+ freq.		Survival
WT + BDG283	36	(27-45)	9%
WT + BDG606	157,000	(143,020-193,000)	9%
rnh1 rnh201 spt3 + BDG283	820	(720-900)	25%
rnh1 rnh201 spt3 + BDG606	815	(680-900)	25%

To confirm that inactivation of RNase H1 and H2 allows for direct transcript RNA repair of a DSB in homologous DNA, we conducted a complementation test in the cis system using a vector expressing either a catalytically inactive mutant of RNH201, rnh201-D39A[15], or wild-type RNH201. Results showed that when wild-type RNH201 was expressed from the plasmid in rnh1 rnh201 spt3 cells, there were no His+ colonies following DSB induction (Extended Data Fig. 2a). Deletion of SPT3 is a well-established and robust method to suppress RT and formation of cDNA in yeast[3,8,9]. However, to prove that the increased frequency of His+ detected in the cis relative to the trans rnh1 rnh201 spt3 background was not solely linked to SPT3 deletion, we impaired cDNA formation by deleting the DBR1 gene, which codes for the RNA debranching enzyme Dbr1[16,17], or by using the RT inhibitor foscarnet (phosphonoformic acid, PFA)[18]. Results shown in Fig. 1c and Extended Data Table 5a support our conclusion that RNA transcripts can directly repair a DSB in chromosomal DNA without being first reverse transcribed into cDNA in rnh1 rnh201 cells.

Extended Data Figure 2

Efficient transcript RNA-directed gene modification is inhibited by RNH201, requires transcription of the template RNA and formation of a DSB in the target gene

a, Complementation of rnh201 defect suppresses transcript RNA-templated DSB repair in cis rnh1 rnh201 spt3 cells. WT, spt3, rnh1 rnh201, rnh1 rnh201 spt3 strains of the cis system were transformed by a control empty vector (YEp195spGAL-EMPTY), a vector expressing catalytically inactive (YEp195spGAL-rnh201-D39A) or a wild-type form of RNase H2 (YEp195spGAL-RNH201). All the vectors have the galactose inducible promoter. Shown is an example of replica-plating results (n = 6) from galactose medium to histidine dropout for the indicated strains and plasmids. b, Example of replica-plating results (n = 6) from galactose medium to histidine dropout for the indicated strains of the cis system, which have functional pGAL1 and HO gene, or have deleted pGAL1, or deleted HO gene. c, Table with percentages of cells in the G1, S or G2 stage of the cell cycle out of random 200 cells counted for the indicated strains of the cis system after 0 h and 8 h from galactose induction. If an HO DSB is made in his3, yeast cells arrest in G2, thus, high percentage of G2 arrested cells indicates occurrence of the HO DSB. We also note that strains with spt3 mutation have higher percentage of G2 cells than strains with wild-type SPT3 before DSB induction (0 h GAL). d, Results of qRT-PCR of his3 RNA. Cells were grown in YPLac liquid medium O/N, and were collected and prepared for qRT-PCR at 0, 0.25 or 8 h after adding galactose to the medium. Trans strains have blue bars, cis red, respectively. Data are represented as a fold change value with respect to mRNA expression at time zero, as median with range of 6-8 repeats. The significance of comparisons between fold changes obtained at 0.25 h vs. those obtained at 8 h, fold changes of different strains of the trans and cis system, and between fold changes obtained in the trans vs. cis system for the same strains at the same time point was calculated using the Mann-Whitney U test and P values are presented in Supplementary Table 1jI, II and III, respectively.

We note that an apparent higher level of his3 RNA is detected at 8 h in galactose in both trans and cis rnh1 rnh201 cells relative to the other tested genetic backgrounds. Our interpretation of these results is that his3 RNA could be more stable in rnh1 rnh201 cells if present in the form of RNA-DNA heteroduplexes, and this may explain the increased frequency of His+ colonies observed in both trans and cis in the rnh1 rnh201 cells (Fig. 1c and Table 1a).

Extended Data Table 5

His+ frequencies for strains with dbr1 null, grown in the presence of PFA, with and without the pGAL1 promoter, grown in glucose, or containing the AIΔ23 intron truncation

a, Frequencies of His+ colonies per 107 viable cells for yeast strains of the trans and cis cell system following 48-h galactose treatment are shown as median and 95% CI (in parentheses). Percentage of cell survival after incubation in galactose is also shown. 18 repeats for dbr1 (in trans), 6 repeats for dbr1 (in cis); 6 repeats for rnh201 dbr1, rnh1 dbr1; 24 repeats for rnh1 rnh201 dbr1; 4 repeats for PFA data. The significance of comparisons between strains was calculated using the Mann-Whitney U test (Supplementary Table 1a). b, Frequencies of His+ colonies per 107 viable cells for yeast strains of the cis cell system following 48-h galactose treatment are shown as median and 95% CI (in parentheses). Percentage of cell survival after incubation in galactose is also shown. There were 6 repeats for all the strains. The significance of comparisons between strains was calculated using the Mann-Whitney U test (Supplementary Table 1f). c, Frequencies of His+ colonies per 107 viable cells for the indicated yeast strains following 24-h glucose treatment in both the trans and the cis cell systems are shown as median and 95% CI (in parentheses). Percentage of cell survival after growth in glucose is also shown. There were 8 repeats for each of the strains. The significance of comparisons between the strains in the trans and cis systems was calculated using the Mann-Whitney U test (Supplementary Table 1g). ND, not determined. d, Frequencies of His+ colonies per 107 viable cells for yeast strains of the cis cell system following 48-h galactose treatment are shown as median and 95% CI (in parentheses). Percentage of cell survival after incubation in galactose is also shown. There were 6 repeats for all the strains. The significance of comparisons between strains was calculated using the Mann-Whitney U test (Supplementary Table 1h).

a	trans			cis
Genotype	His+ freq.		Survival	His+ freq.		Survival
dbr1	1,330	(1,030-1,660)	1.6%	23	(0-47)	2%
rnh201 dbr1	2,130	(1,150-3,620)	2.6%	322	(122-453)	3%
rnh1 dbr1	2,455	(1,500- 3,250)	1.2%	18	(0-78)	2.5%
rnh1 rnh201 dbr1	7,420	(7,400-11,300)	1.7%	29,900	(26,900-33,200)	1.2%
WT + PFA	519	(400-1,300)	1.7%	112	(94-380)	0.9%
rnh1 rnh201 + PFA	4,120	(3,100-5,340)	0.9%	9,400	(7,290-20,800)	0.7%

Efficient generation of His+ colonies in cis wild-type, rnh1 rnh201, or rnh1 rnh201 spt3 cells requires transcription and splicing of the antisense his3 and DSB formation in the his3 gene. Deletion of pGAL1 upstream of his3 on Chr III, deletion of the HO endonuclease gene, or growing cells in glucose medium, in which HO is repressed, drastically decreased His+ frequency (Extended Data Fig. 2b,c and Extended Data Table 5b,c). Similarly, yeast wild-type, rnh1 rnh201 and rnh1 rnh201 spt3 cells of the cis system containing a 23-bp truncation of the artificial intron in his3 lacking the 5’-splice site (Extended Data Table 1 and Extended Data Figure 1c) produced no His+ colonies following DSB induction (Fig. 1e and Extended Data Table 5d), yet these cells were efficiently repaired by HIS3.F and HIS3.R synthetic oligos indicating that the DSB occurred in these cells (Extended Data Table 3).

Next, to examine whether DSB repair frequencies at the his3 locus in trans and in cis correlate with the expression level of antisense his3 transcript, we performed quantitative real time PCR (qRT-PCR). The qRT-PCR data showed that with increased time of incubation in galactose medium (from 0.25 to 8 h) the trans strains had significantly more his3 RNA than the cis strains in all backgrounds including the rnh1 rnh201 spt3. Also the levels of his3 transcript dropped significantly from 0.25 to 8 h in galactose in cis but not in trans, except for the cis strain in which the HO gene was deleted (Extended Data Fig. 2d). These results are expected in the cis strains because as soon as the HO DSB is made, a full his3 transcript cannot be generated. Therefore, these data corroborate the conclusion that the higher frequency of His+ colonies obtained in cis than in trans rnh1 rnh201 spt3 cells (Fig. 1c and Table 1a) is not due to more abundant and/or more stable transcript but rather to the proximity of the transcript to the target DNA.

PCR analysis of 10 random His+ colonies from each of the trans and the cis rnh1 rnh201 spt3 backgrounds, and Southern blot analysis of three samples from each background showed that the his3 locus that was originally disrupted by the HO site (trans background), or by the intron with the HO site (cis background), was indeed corrected to intact HIS3 sequence. No integration of the HIS3 gene at the HO site or elsewhere in the genome was detected in all tested clones (20/20) excluding possible mechanisms of repair via capture of cDNA by end joining or via transposition (Fig. 2a and Extended Data Figs. 3 and 4a-c). We also excluded that double deletion of RNH1 and RNH201 resulted in increased level of Ty transposition. In fact, results presented in Extended Data Table 6 showed transposition rate a factor of 3-14 lower in null rnh1 rnh201 than in wild-type cells. This could be due to an increase of non-productive Ty RNA-DNA substrates for the Ty integrase, resulting in abortive integrations and/or titration of the enzyme. Sequence analysis of 24 random His+ colonies from the cis rnh1 rnh201 spt3 background revealed that all 24 clones had the precise sequence as the spliced antisense his3 transcript and did not present a typical end joining pattern with small in/del/substitution mutations (Extended Data Fig. 1c and Extended Data Table 2b). These results, together with our observation of no His+ colony formation in cells unable to splice the intron in his3 (Fig. 1e and Extended Data Table 5d), strongly support an HR mechanism of DSB repair by transcript RNA in cis rnh1 rnh201 spt3 cells.

Figure 2

Transcript-templated DSB repair follows an HR mechanism

a, Southern blot analysis of yeast genomic DNA derived from trans WT His− (lane 2) or His+ (lane 3), rnh1 rnh201 spt3 His− (lane 4) or His+ (lanes 5-7) cells, digested with BamHI restriction enzyme and hybridized with the HIS3 probe, or derived from cis WT His− (lane 8) or His+ (lane 9), rnh1 rnh201 spt3 His− (lane 10) or His+ (lanes 11-13) cells, digested with NarI restriction enzyme and hybridized with the HIS3 probe (Extended Data Fig. 4a,c). Lanes 1 and 14, 1 kb DNA ladder visible in the ethidium bromide-stained gel (Extended Data Fig. 4b). Size of digested DNA bands is indicated by red arrows. b, Experimental scheme of Rad52-promoted annealing between RNA and DNA in vitro. Asterisk denotes 32P label. ssDNA (#211) or ssRNA (#501) are in black, oligos #508 and #509 forming dsDNA are in blue and green, respectively. c, The kinetics of annealing promoted by yeast Rad52 and (d) human RAD52. Nucleoprotein complexes were assembled between either yeast or human Rad52 (1.35 nM) and tailed dsDNA (#508/509) (0.4 nM, molecules) in the presence (dashed lines) or absence (solid lines) of RPA (2 nM). Annealing was initiated by addition of 32P-labeled ssRNA or ssDNA (0.3 nM, molecules). The kinetics of protein-free annealing reactions are indicated by open squares and circles. The error bars represent the standard error of the mean, n = 4. For the significance of comparisons between the last two time points we used the two-tailed Mann-Whitney U-test. P values are in Supplementary Table 1c.

Extended Data Figure 3

Verification of his3 repair in trans and cis rnh1 rnh201 spt3 cells via an HR mechanism using colony PCR

a, Scheme of the trans system before DSB induction (BDI, groups of lanes 1 and 7) and after DSB repair (ADR, groups of lanes 2-6 and 8-12) with the primers used in colony PCR shown as small black arrows and named with roman numerals: I, HIS3.5; II, HIS3.2; III, INTRON.F; IV, HO.F. The primer pairs used for colony PCR are named A (I+II), B (I+III), and C (I+IV), and base-pair sizes of the expected PCR products are shown in parentheses. b, Photos of agarose gels with results of colony PCR reactions. M, 2-Log DNA Ladder marker; the 100, 300 and 500-bp band sizes are pointed by arrows. Groups of lanes 1 and 7, two isolates of trans rnh1 rnh201 spt3 mutants BDI, each tested with primer pairs A, B and C. Groups of lanes 2-6 and 8-12, ten isolates of trans rnh1 rnh201 spt3 mutants ADR, each tested with primer pairs A, B and C. c, Scheme of the cis system before DSB induction (BDI, groups of lanes 1 and 7) and after DSB repair (ADR, groups of lanes 2-6 and 8-12) with the primers used in colony PCR shown as small black arrows and named with roman numerals: I, HIS3.5; II, HIS3.2; III, INTRON.F; IV, HO.F. The primer pairs used for colony PCR are named A (I+II), B (I+III), and C (I+IV), and base-pair sizes of the expected PCR products are shown in parentheses. d, Photos of agarose gels with results of colony PCR reactions. M, 2-Log DNA Ladder marker; the 100, 300 and 500-bp band sizes are pointed by arrows. Groups of lanes 1 and 7, two isolates of cis rnh1 rnh201 spt3 mutants BDI, each tested with primer pairs A, B and C. Groups of lanes 2-6 and 8-12, ten isolates of cis rnh1 rnh201 spt3 mutants ADR, each tested with primer pairs A, B and C.

Extended Data Figure 4

RNA-templated DNA repair occurs via HR and requires Rad52

a, Scheme of the trans and cis his3/HIS3 loci in His− (Before DSB Induction) and His+ (After DSB Repair) cells. The size of the BamHI (trans) or NarI (cis) restriction digestion products and the position of the HIS3 probe are shown. b, Photo of ruler next to ethidium bromide-stained agarose gel with marker and genomic DNA samples visible before Southern blot. Lanes 1 and 14, 1 kb DNA Ladder; 500 bp, 1 kb, 1.5 kb, 2 kb, 3 kb and 4 kb bands are pointed by arrows. Trans WT His− (lane 2) or His+ (lane 3), rnh1 rnh201 spt3 His− (lane 4) or His+ (lanes 5-7) cells, digested with BamHI restriction enzyme. Cis WT His− (lane 8) or His+ (lane 9), rnh1 rnh201 spt3 His− (lane 10) or His+ (lanes 11-13) cells, digested with NarI restriction enzyme. c, Southern blot analysis (same as in Fig. 2a, but displaying the entire picture of the exposed membrane) of yeast genomic DNA derived from trans WT His− (lane 2) or His+ (lane 3), rnh1 rnh201 spt3 His− (lane 4) or His+ (lanes 5-7) cells, digested with BamHI restriction enzyme and hybridized with the HIS3 probe, or derived from cis WT His− (lane 8) or His+ (lane 9), rnh1 rnh201 spt3 His− (lane 10) or His+ (lanes 11-13) cells, digested with NarI restriction enzyme and hybridized with the HIS3 probe. Lanes 1 and 14, 1 kb DNA ladder visible in the ethidium bromide-stained gel (panel b). Size of digested DNA bands is indicated by red arrows. The annealing reactions were promoted by either yeast (d,e) Rad52 or human (f,g) RAD52 (1.35 nM) in the presence or absence of yeast or human RPA, respectively (2 nM). In control protein-free reactions, protein dilution buffers were added instead of the respective proteins. To initiate the annealing reactions, 0.3 nM (molecules) 32P-labeled ssDNA (#211) or ssRNA (#501) were added. The reactions were carried out for the indicated periods of time, and the products of annealing reactions were deproteinized and analyzed by electrophoresis in 10% polyacrylamide gels in 1 X TBE at 150 V for 1 h. Visualization and quantification was accomplished using a Storm 840 Phosphorimager. e,Treatment of RNA and DNA oligos with RNase. 3 μM ssDNA (#211) or RNA (#501) was incubated with 100 μg/ml (or 7 U/ml) RNase (QIAgen) in buffer containing 50 mM Hepes, pH 7.5 for 30 min at 37 °C, then 7% glycerol and 0.1% bromophenol blue were added to the samples and incubation continued for another 15 min at 37 °C before they were analyzed by electrophoresis in a 10% (17:1 acrylamide:bisacrylamide) polyacrylamide gel at 150 V for 1 h in 1 X TBE buffer. The gel was quantified using a Storm 840 Phosphorimager. The RNA oligo is completely degraded by RNase but not the DNA oligo.

Extended Data Table 6

His+ rates in WT and rnh1 rnh201 cells resulting from the transposition assay at 22 °C or 30 °C

Shown are rates of His+ colonies for WT and rnh1 rnh201 yeast strains containing BDG598 following growth with no galactose with and without plasmid selection (Ura− or YPLac, respectively) or galactose with and without plasmid selection (Ura−Gal or YPLac + gal, respectively) for 96 h at 22 °C, or for 48 h at 30 °C. Data are presented as median and 95% CI (in parentheses). Percentages of cell survival after growth without or with galactose are also shown. There were 15 repeats for the strains incubated at 22 °C and 6 repeats for those incubated at 30 °C. The significance of comparisons between strains was calculated using the Mann-Whitney U test (Supplementary Table 1i). The strains used in this experiment were: TY-17, 53 and TY-22, 67.

22 °C	No gal (Ura-)		+ gal (Ura-Gal)
Genotype	His+ rate (×10−7)	Survival	His+ rate (×10−3)	Survival
WT + BDG598	5.28 (0 – 141)	26%	2.68 (2.55 – 3.06)	15%
rnh1 rnh201 + BDG598	15.3 (16.3 – 42.4)	34%	0.78 (0.54 – 0.92)	27%
30 °C	No gal (Ura-)		+ gal (Ura-Gal)
Genotype	His+ rate (×10−7)		His+ rate (×10−3)
WT + BDG598	2.8[*] (0 – 7.37)	26%	0.58 (0.46 – 0.72)	15%
rnh1 rnh201 + BDG598	16.1 (5.31 – 24.2)	34%	0.04 (0.03 – 0.06)	27%
30 °C	No gal (YPLac)		+ gal (YPLac + gal)
Genotype	His+ rate (×10−7)		His+ rate (×10−5)
WT + BDG598	<0.1 (0 – 0)	26%	1.38 (0.52 – 2.38)	15%
rnh1 rnh201 + BDG598	15.1 (4.90 – 26.4)	34%	0.4 (0.30 – 0.60)	27%

Average.

Previous studies showed the ability of E. coli RecA to promote pairing between duplex DNA and single-strand RNA in vitro[19,20]. Recent work suggests that Rad51 can promote formation of RNA-DNA hybrids in yeast[21]. Here, we show that transcript RNA-directed chromosomal DNA repair is stimulated by the function of Rad52 but not Rad51 recombination protein[22]. Rad52 is important for HR both via single-strand annealing (SSA) and via strand invasion[1,22]. DSB repair by transcript RNA was reduced over 14-fold in cis rnh1 rnh201 spt3 rad52 but was increased by a factor of 4 in cis rnh1 rnh201 spt3 rad51 compared to rnh1 rnh201 spt3 cells (Table 1b). Noticeably, our in vitro experiments demonstrate that both yeast and human Rad52 efficiently promote annealing of RNA to a DSB-like DNA end (Fig. 2b-d; Extended Data Fig. 4d-h). Importantly, Rad52 catalyzes the reaction with RNA with nearly the same rate as the reaction with ssDNA of the same sequence. Moreover, RPA, a ubiquitous ssDNA binding protein[1], caused in our experiments a moderate inhibition of Rad52-promoted annealing between complementary ssDNA molecules, but not between ssRNA and ssDNA molecules. Thus in the presence of RPA, the annealing between ssRNA and ssDNA proceeded with higher efficiency than the reaction between ssDNA molecules (Fig. 2b-d; Extended Data Fig. 4d-g).

In vivo, cDNA and/or RNA-dependent DSB repair may be especially important in the absence of functional Rad51 that prevents repair by the uncut sister chromatid via strand invasion[23]. Indeed our results show that deletion of RAD51 increases the frequency of repair by cDNA and/or RNA (Table 1b). Hence, considering the bias observed for DSB repair in cis vs. trans when Ty RT was impaired, we propose a model that in the absence of RNase H function, transcript RNA mediates DSB repair preferentially in cis via a Rad52-facilitated annealing mechanism. In this mechanism, the transcript may provide a template that either bridges broken DNA ends to facilitate precise re-ligation or initiate SSA via an RT-dependent extension of the broken DNA ends (Fig. 3). The RT activity could likely be contributed by a replicative DNA polymerase[3], minimal Ty RT, or both.

Figure 3

Models of transcript RNA-templated DSB repair in cis

An actively transcribed DNA region experiencing a DSB uses its own transcript RNA as a bridging (a) or an extension (b) template for repair. The small black lines indicate initial annealing between the transcript RNA and the DSB end/s, and between the two DSB ends.

Current view in the field is that RNA-DNA hybrids formed by the annealing of transcript RNA with complementary chromosomal DNA either in cis or in trans are mainly a cause of DNA breaks, DNA damage and genome instability[24]. Here, we demonstrate that under genotoxic stress transcript RNA are recombinogenic and can efficiently and precisely template DNA repair in the absence of RNase H function in yeast. In the central dogma of molecular biology, the transfer of genetic information from RNA to DNA is considered to be a special condition, which has been restricted to retroelements[25] and telomeres[26]. Our data show that the transfer of genetic information from RNA to DNA occurs with an endogenous generic transcript (his3 antisense), and is thus a more general phenomenon than previously anticipated. In addition, in vitro RNA-DNA annealing was markedly promoted not only by yeast but also human RAD52, suggesting that transcript RNA-templated DNA repair could occur in human cells. RNA transcripts could template DNA damage repair at highly transcribed loci, in cells that do not divide (lack sister chromatids), or have more stable RNA-DNA heteroduplexes, like those defective in RNASEH2 of Aicardi-Goutieres Syndrome (AGS) patients[27]. Our findings lay the groundwork for future exploration of RNA-driven DNA recombination and repair in different cell types.

Methods

Experimental design to explore transcript-RNA templated chromosomal DSB repair in yeast

In the experimental design to explore transcript-RNA templated chromosomal DSB repair it is critical to discriminate repair of the DSB by transcript RNA from repair by the DNA region that generates the transcript. Also translation of the repairing transcript mRNA should not produce the functional His3 protein. Moreover, it is essential that DSB repair would not restore the HIS3 marker sequence by simple end ligation via NHEJ. To satisfy these requirements, the DNA region that generates the transcript was constructed to contain a his3 allele on Chr III consisting of a yeast HIS3 gene interrupted by an artificial intron (AI) in the antisense orientation (mhis3AI cassette), which was previously utilized to study reverse transcription in yeast[28,29]. The antisense his3 RNA is not translated into the functional His3 protein. Moreover, after intron splicing, the transcript RNA sequence has no intron, while the DNA region that generates the transcript retains the intron; thus they are distinguishable. We developed two experimental yeast cell systems, trans and cis (Fig. 1a,b and Extended Data Fig. 1) in strains YS-289, 290 and YS-291, 292, respectively (Extended Data Table 1). In both systems, transcription of the antisense his3 RNA and expression of the HO nuclease are regulated by the galactose inducible promoter (pGAL1). In addition, these yeast cell systems are auxotrophic for histidine (His−) and thus do not grow on media without histidine. Upon induction of the HO DSB, the broken his3 allele of the trans and cis cell systems can, in principle, only be repaired to a functional HIS3 allele by recombination with a homologous template. Alternative mechanism of HIS3 repair by ligation of the broken ends via NHEJ is inefficient in this system (<0.1/10[7] viable cells) (data not shown), as the HIS3 gene is disrupted by a long sequence with the HO site (trans system) or an intron and the HO site (cis system) (Extended Data Fig. 1b,c).

To impair DSB repair by cDNA deriving from the his3 antisense, we deleted the SPT3 or the DBR1 gene. SPT3 encodes for a subunit of the SAGA and SAGA-like transcriptional regulatory complexes and its null allele reduces Ty RT function over 100-fold[3,8,9]. DBR1 encodes for the RNA debranching enzyme Dbr1 and its null allele in yeast cells impairs cDNA formation and diminishes Ty transposition up to a factor of 10-fold[16,17]. As further proof that we can detect DSB repair by transcript RNA independently of cDNA, we performed the trans and cis assays with and without RNase H functions in the presence of foscarnet (phosphonoformic acid, PFA), an inhibitor of the human immunodeficiency virus RT, which blocks Ty reverse transcription in yeast[18] (and data not shown).

Yeast strains

The yeast strains used in this work are listed in Extended Data Table 1 and derive from FRO-767 strain[3], which contains the site for the HO site-specific endonuclease in the middle of the LEU2 gene on Chr III. A gene cassette carried on plasmid pSM50[28,29] containing the his3 gene disrupted by an artificial intron (AI) and regulated in the antisense orientation by the galactose inducible promoter pGAL1 and containing the URA3 marker gene (pGAL1-mhis3AIURA3) was integrated into the leu2 locus of strain FRO-767 after DSB induction at the HO site by the gene collage technique with no PCR amplification[30]. The URA3 gene was then replaced with the ADE3 gene generating strain FRO-1073. To build the strains of the trans system, an HO site was integrated into the endogenous HIS3 locus on Chr XV of FRO-1073 exactly in the same position in which the AI was inserted in the pGAL1-mhis3AI cassette using the “delitto perfetto” method, as previously described[30,31], to generate FRO-1075, 1080. The correct sequence and insertion position of the HO site was confirmed by sequence analysis. For constructing strains of the cis system, first the his3 gene disrupted by the HO site of FRO-1075 and 1080 was replaced with a TRP1 gene to generate YS-164, 165, and then an HO cutting site was integrated into the intron AI in the his3 cassette on Chr III to generate strains YS-172,174. To be cautious to avoid any possibility of transcription from Ty into the pGAL1-mhis3AI cassette in both the trans and cis systems, the Ty2 element located upstream of the leu2 locus on Chr III, YCLWTy2-1, was deleted following the “delitto perfetto” method to generate YS-289, 290 (trans system) and YS-291,292 (cis system). These new strain constructs were verified by PCR and sequence analysis to confirm correct constructions. However, no difference in the frequency of His+ cells was observed between the strains with the YCLWTy2-1 and those without it for the strains of both the trans and cis systems (data not shown). Deletion mutants for the trans YS-289, 290, and the cis 291, 292 strains contain either the kanMX4, hygMX4, natMX4 and/or the Kluyveromyces lactis URA3 (KlURA3) marker gene in place of the open reading frame or the promoter of the gene/s of choice. All gene disruptions were confirmed by colony PCR. Strains HK-396, 400 and HK-391, 394 were constructed using the “delitto perfetto” method by deleting the first 23 bp on the 5’ end of the AI via insertion of the CORE cassette, and then by popping out the CORE cassette with a pair of oligonucleotides. These constructs were confirmed by sequence analysis. Strain HK-404, 407 was obtained by deleting the SPT3 gene with kanMX4 from HK-391, 394. The FRO-1092, 1093 strain is rad52Δ and has only one his3 allele, the endogenous one on Chr XV that has been inactivated by the HO site.

Standard genetic, molecular biology techniques and plasmids

Yeast genetic methods and molecular biology analyses were done as described[3,30,31]. The BDG606 vector[32] and the BDG283 control vector (a gift from D. Garfinkel), used to verify a direct role of transcript RNA in DSB repair (Extended Data Table 4), are centromeric plasmids with the URA3 marker. BDG606 contains the pGAL1-mhis3AI cassette and BDG283 contains only pGAL1. The plasmids used for the complementation assay with RNase H2 are Yep195SpGAL, which is a 2-micron high-copy expression plasmid containing the URA3 selectable marker[33], Yep195SpGAL containing the wild-type RNH201 gene (Yep195SpGAL-RNH201) inserted by gap repair, and Yep195SpGAL-rnh201-D39A constructed by in vitro mutagenesis (Quick Change Mutagenesis Kit, Stratagene, La Jolla, CA) of Yep195SpGAL-RNH201 and confirmed by sequence analysis. To confirm occurrence of the HO DSB following incubation in the 2% galactose medium, the percentage of G2 arrested cells was determined right before adding galactose and after 8-h incubation in galactose as previously described[34] (Extended Data Fig. 2c). All primers used for strain and plasmid constructions, PCR verifications and sequence analyses are available upon request. Samples for sequencing were submitted to Eurofins MWG Operon (Huntsville, AL). Southern blot experiment was done as follows. Cells from colonies growing on YPD or His− were grown on YPD O/N. Genomic DNA was extracted as described[35] and digested with either BamHI or NarI restriction enzyme. After digestion, column purification was applied by using QIAquick PCR Purification Kit (QIAGEN). DNA was run in a 0.8% agarose gel. Following electrophoresis and Southern blotting chromosomal regions containing the HIS3 gene were detected using a [α-32P]ATP (PerkinElmer) labeled (Prime-It RmT Random Primer Labelling Kit, Agilent Technologies) 250-bp HIS3-specific probe. Membrane was exposed to a phosphor screen for 3 days. Images were taken with Typhoon Trio+ (GE Healthcare) and obtained with ImageQuant (GE Healthcare).

Trans and cis assays using patches or liquid cultures

Yeast cells of the chosen strains were patched on the rich medium containing yeast extract, peptone and 2% (w/v) dextrose (YPD) and grown at 30 °C for 1 day. The cells were then replica-plated on medium containing yeast extract, peptone and 2% (w/v) galactose (YPGal) or YPGal containing phosphonoformic acid, PFA (2.5 mg/ml) to turn on transcription of the his3 antisense on Chr III and expression of the HO endonuclease. As a control, cells were also replica-plated from the YPD medium on synthetic complete medium plates lacking histidine (SC-His−) and grown for 3 days at 30 °C. We never detected a single His+ colony from any of the trans and cis strains used in this study following replica-plating from the YPD medium on SC-His− (not shown). After 2 days incubation on YPGal medium, these cells were replica-plated on SC-His− and grown for 3 days at 30 °C to form visible colonies. At this stage, plates were photographed and photo files stored. For experiments using the BDG606 and BDG283 plasmids, cells were replica-plated from SC-Ura− on SC-Ura−Gal medium, and were then replica-plated on SC-Ura−His−. As a control, cells were also replica-plated from the SC-Ura− medium SC- Ura−His− and grown for 3 days at 30 °C.

For the experiments in liquid culture, flasks with 50 ml of liquid medium containing yeast extract, peptone and 2.7% (v/v) lactic acid (YPLac) were inoculated with yeast cells of the chosen strains and incubated in a 30 °C shaker for 24 h. The density of the cultures was determined by counting cells using a hemocytometer and counting under a microscope. Generally, 107 or, in rare cases, 108 cells (we note that survival is very low on galactose medium) were then plated on YPGal medium, or YPGal medium containing PFA (2.5 mg/ml) for experiments using PFA to obtain from 1 to ~500 His+ colonies per plate after the replica-plating on His− medium, and grown for 2 days at 30 °C. Two aliquots of 104 cells were plated each on one YPGal medium plate, or YPGal medium containing PFA (2.5 mg/ml) for experiments using PFA plate, to measure the cell survival after galactose treatment. After 2 days incubation on YPGal medium, cells were replica-plated on His− plates and grown for 3 days at 30 °C. The frequency of DSB repair was calculated by dividing the number of His+ colonies on SC-His− medium by the number of colonies on YPGal medium. The survival was calculated by dividing the number of colonies on YPGal medium by the number of cells plated on the same medium. For experiments using the BDG606 and BDG283 plasmids, cells were treated as described above except that they were plated from YPLac on SC-Ura−Gal medium in different dilutions, and were then replica-plated on SC-Ura−His−. The frequency of His+ colonies was calculated by dividing the number of His+ colonies on SC-Ura−His− medium by the number of colonies on SC-Ura−Gal medium. The survival was calculated by dividing the number of colonies on SC-Ura−Gal medium by the number of cells plated on the same medium.

Oligo Transformation

Transformation by oligos (1 nmol) was performed as described[3]. Induction of the HO DSB was done by incubating cells in 2 % galactose medium for 3 h.

Transposition Assay

Yeast cells of the chosen strains transformed with BDG102 (empty plasmid) or BDG598 (pGTy-H3mHIS3AI) plasmid[36] (containing a Ty transposon fused to the his3 gene, which is in the antisense orientation and disrupted by an artificial intron (AI); both Ty and the his3 antisense are regulated by the galactose inducible promoter) were patched on synthetic complete medium lacking uracil (SC-Ura−) and grown overnight at 30 °C. Cells were then replica-plated on synthetic medium lacking uracil with 2% (w/v) galactose (SC-Ura−Gal) and grown for 48 or 96 hours at 30 °C or 22 °C, respectively. As control, cells were also replica-plated on SC-His− to determine the background of His+ clones. After the incubation in galactose, cells were replica-plated on SC-His− and grown for 3 days at 30 °C to form visible colonies. At this stage, plates were photographed and photo files stored. For the experiments in liquid culture, strains with BDG102 or BDG598 were grown in 5 ml SC-Ura− liquid medium or in 10 ml of YPLac liquid medium in a 30 °C shaker for 24 h. Then, 1×106 cells were transferred from the SC-Ura− liquid medium into 5 ml SC-Ura− or 5 ml SC-Ura−Gal liquid medium and incubated for 48 or 96 h at 30 °C or 22 °C, respectively. After 24 h, YPLac cultures were split in half. One half was kept growing for additional 48 h at 30 °C, while galactose was directly added to the other half to reach 2% and cells were then incubated for 48 h at 30 °C. From glucose and YPLac cultures grown at 22 °C or 30 °C, 107 or 108 cells were plated on SC-His−Ura− medium, respectively, and were grown for 2 days at 30 °C. From galactose cultures grown at 22 °C or 30 °C, 105 or 106 cells were plated on SC-His−Ura− medium, respectively, and were grown for 2 days at 30 °C. Two aliquots of 5×102 cells were plated each on one SC-Ura− medium plate, to measure the cell survival after glucose, YPLac or galactose treatment. The rate of formation of His+ cells was calculated by the maximum-likelihood method of Lea and Coulson[37].

Quantitative real time PCR

RNA was isolated from the chosen yeast strains of the trans and cis systems using a protocol adapted from a method described previously by Fasken et al.[38]. RNA was converted in to cDNA using QuantiTect Reverse Transcription Kit (QIAGEN). SYBER Green qPCR Mix (BioRad) was used for analyzing RNA expression in 96 well plates (Applied Biosystem). The total volume in each well was 20 μl, which consisted of 10 μl of SYBR Green qPCR Mix, 4 μl of nuclease-free water, 2 μl of primers, and 4 μl of cDNA. The cDNA levels were determined using an ABI Prism 7000 RT-PCR machine (Applied Biosystems). ACT1.F and ACT1.R, HIS3.F2 and HIS3.R2 primers were used in this study (Extended Data Table 2a). ACT1 primers were used for normalization. Values for each sample were normalized with ACT1, and then a second normalization was performed by subtracting normalized values of each time point from the control normalized value per each gene[39]. As negative control, CEN16.F and CEN16.R primers were used to show that there is no or minimal qRT-PCR product derived from a chromosomal region that is not transcribed (Aziz El Hage, personal communication) (data not shown).

Rad52 in vitro annealing assay

In vitro assays using yeast or human Rad52 were performed as described[40,41] (and references therein), with all DNA and RNA concentrations expressed in moles of molecules. All oligo sequences are shown in Extended Data Table 2a. A single nucleotide mismatch was incorporated into the dsDNA (relative to ssDNA or RNA) to reduce the spontaneous Rad52-independent annealing. Tailed dsDNA (#508/#509) (0.4 nM) was incubated in the absence or presence of yeast or human RPA (2 nM) in a buffer containing 25 mM Tris acetate, pH 7.5, 100 μg/ml BSA, and 1 mM DTT for 5 min at 37 °C, then yeast or human RAD52 (1.35 nM), respectively, was added and incubation continued for 10 min. Annealing reactions were initiated by adding 32P-labeled ssRNA (#501) or ssDNA (#211) (0.3 nM). Aliquots were withdrawn at indicated time points and deproteinized by incubating samples in stop solution containing 1.5% SDS, 1.4 mg/ml proteinase K, 7% glycerol and 0.1% bromophenol blue for 15 min at 37 °C. Samples were analyzed by electrophoresis in 10% (17:1 acrylamide:bisacrylamide) polyacrylamide gels in 1 X TBE (90 mM Tris-borate, pH 8.0, 2 mM EDTA) at 150 V for 1 h and were quantified using a Storm 840 Phosphorimager and ImageQuant 5.2 software (GE Healthcare).

Data presentation and statistics

Graphs were made using GraphPad Prism 5 (Graphpad Software, La Jolla, CA). The results are each expressed as a median and 95% confidence limits (in parentheses), or alternatively the range when number of repeated experiments was <6. Statistical significant differences between the His+ frequencies were calculated using the nonparametric two-tailed Mann-Whitney U test[42]. All P values obtained using the Mann-Whitney U test were then adjusted by applying the false discovery rate (FDR) method to correct for multiple hypothesis testing[43] (Supplementary Table 1).