| Literature DB >> 25049546 |
Yang Liu, Jingeng Xu, Weixuan Fu, Ziqing Weng, Xiaoyan Niu, Jianfeng Liu, Xiangdong Ding, Qin Zhang.
Abstract
Interferon regulatory factor 6 (IRF6) gene is a member of the IRF-family, and plays functionally diverse roles in the regulation of the immune system. In this report, the 13,720 bp porcine IRF6 genomic DNA structure was firstly identified with a putative IRF6 protein of 467 amino acids. Alignment and phylogenetic analysis of the porcine IRF6 amino acid sequences with their homologies to other species showed high identity (over 96%). Tissues expression of IRF6 mRNA was observed by RT-PCR, the results revealed IRF6 expressed widely in eight tissues. One SNP (HQ026023:1383 G>C) in exon7 and two SNPs (HQ026023:130 G>A; 232 C>T) in the 5 ' promoter region of porcine IRF6 gene were demonstrated b y DNA sequencing analysis. A further analysis of SNP genotypes associated with immune traits including IFN-γ and IL10 concentrations in serum was carried out in three pig populations including Large White, Landraces and Songliao Black pig (a Chinese indigenous breed). The results showed that the SNP (HQ026023:1383 G>C) was significantly associated with the level of IFN-γ (d 20) in serum (p = 0.038) and the ratio of IFN-γ to IL10 (d 20) in serum (p = 0.041); The other two SNPs (HQ026023:130 G>A; 232 C>T) were highly significantly associated with IL10 level in serum both at the day 20 (p = 0.005; p = 0.001) and the day 35 (p = 0.004; p = 0.006). Identification of the porcine IRF6 gene will help our further understanding of the molecular basis of the IFN regulation pathway in the porcine immune response. All these results should indicate that the IRF6 gene can be regarded as a molecular marker associated with the IL10 level in serum and used for genetic selection in the pig breeding.Entities:
Keywords: Association Analysis; Expression; IRF6; Pig; Polymorphisms
Year: 2012 PMID: 25049546 PMCID: PMC4093143 DOI: 10.5713/ajas.2011.11168
Source DB: PubMed Journal: Asian-Australas J Anim Sci ISSN: 1011-2367 Impact factor: 2.509
Primers used for mRNA expression and SNP detection of the porcine IRF6 gene
| Fragments | Primers sequence (5′-3′) | Product size (bp) | PCR (Tm) | Used for |
|---|---|---|---|---|
| IRF6-RT | CTGAAGCCCTGGCTGGTAG | 436 | 60.6 | mRNA expression |
| IRF6-1 | TGAGGGAGCTGGAAAACAAC | 228 | 60.2 | SNP detection |
| IRF6-2 | TTCGTAAGCGAGGCAATTTT | 291 | 59.6 | SNP identification |
| IRF6-3 | TGATGTTCAGGAAGGGGAAG | 152 | 59.8 | SNP identification |
| IRF6-4 | GCAGAAGGTGGACAGGAAAT | 253 | 59.5 | SNP identification |
| IRF6-5 | CAGTTCCCACCATCCATCTT | 410 | 59.7 | SNP identification |
| IRF6-6 | AAGGCCAAGAGATGTTGACG | 156 | 60.0 | SNP identification |
| IRF6-7 | TGAAGTCATCAAGGCAGAGC | 612 | 59.5 | SNP detection |
Figure 1Genomic organization comparisons among pig, human and mouse IRF6 gene. Exon sequences are represented in the boxed areas (length in bases on top).
Figure 2mRNA expression of porcine IRF6 gene was detected in different tissues by RT-PCR. He, heart; Ki, kidney; Sp, spleen; SM, skeletal muscle; LN, lymph node; Lu, lung; Li, liver; Th, thymus; Br, brain; M, 100 bp DNA marker.
Genotype and allele frequencies of the SNPs detected in the porcine IRF6 gene1
| Breed | HQ026023:g.130 G>A | HQ026023:g. 232 C>T | HQ026023:g. 1383 G>C | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
|
|
| |||||||||||||
| Genotype frequencies | Allele frequencies | Genotype frequencies | Allele frequencies | Genotype frequencies | Allele frequencies | ||||||||||
| GG | GA | AA | G | A | CC | CT | TT | C | T | GG | GC | CC | G | C | |
| Landrace (68) | 0.25 | 0.37 | 0.38 | 0.44 | 0.56 | 0.25 | 0.37 | 0.38 | 0.44 | 0.56 | 0.84 | 0.16 | 0 | 0.92 | 0.08 |
| Large White (163) | 0.31 | 0.44 | 0.25 | 0.53 | 0.47 | 0.28 | 0.47 | 0.25 | 0.52 | 0.48 | 0.40 | 0.41 | 0.19 | 0.61 | 0.39 |
| Songliao Black (71) | 0.32 | 0.58 | 0.10 | 0.61 | 0.39 | 0.31 | 0.56 | 0.13 | 0.59 | 0.41 | 1.00 | 0.00 | 0.00 | 1.00 | 0.00 |
The number of animals in each breed is indicated between parentheses.
Association analysis of immune traits in three pig breeds
| Traits | Breeds (Least square mean | ||
|---|---|---|---|
|
| |||
| Landrace (n = 68) | Large White (n = 163) | Songliao Black (n = 71) | |
| IFN-γ (d 20) | 107.57±12.61 | 58.29±12.98 | 59.86±13.85 |
| IFN-γ (d 35) | 100.47±15.64 | 59.52±16.10 | 66.50±17.17 |
| IFN-γ/IL10 (d 20) | 1.53±0.47 | 1.32±0.49 | 0.66±0.52 |
| IL10 (d 20) | 133.62±41.29 | 81.82±42.49 | 173.74±45.32 |
| IL10 (d 35) | 100.39±33.50 | 54.38±34.48 | 107.21±36.78 |
| IFN-γ/IL10 (d 35) | 2.152±0.45 | 1.91±0.46 | 1.65±0.50 |
Statistically different of least square means (p<0.05).
Statistically different of least square means (p<0.01).
Association analysis and multiple tests of the IRF6 gene SNPs with immune traits in three pig populations
| Immune traits | p-value | Polymorphism genotypes (Least square mean±SE) | ||||
|---|---|---|---|---|---|---|
|
| ||||||
| HQ026023 | HQ026023 | HQ026023 | ||||
| IFN-γ (d 20) | 0.190 | 0.216 | 0. 038 | HQ026023:g.1383 G>C | ||
| GG | GC | CC | ||||
| 44.59±26.18 | 34.08±26.45 | 33.87±26.64 | ||||
| IFN-γ (d 35) | 0.841 | 0.941 | 0.389 | HQ026023:g.1383 G>C | ||
| GG | GC | CC | ||||
| 0.89±0.56 | 0.90±0.47 | 1.08±0.34 | ||||
| IFN-γ/IL10 (d 20) | 0.616 | 0.703 | 0.041 | HQ026023:g.130 G>A | ||
| GG | GA | AA | ||||
| 349.58±52.54 | 200.12±70.06 | 138.93±99.99 | ||||
| IL10 (d 20) | 0.005 | 0.001 | 0.317 | HQ026023:g.232 C>T | ||
| CC | CT | TT | ||||
| 76.89±57.65 | 81.44±69.56 | 406.23±95.59 | ||||
| IL10 (d 35) | 0.004 | 0.006 | 0.819 | HQ026023:g.130 G>A | ||
| GG | GA | AA | ||||
| 279.01±42.50 | 162.64±56.67 | 72.33±80.88 | ||||
| IFN-γ/IL10 (d 35) | 0.280 | 0.320 | 0.643 | HQ026023:g.232 C>T | ||
| CC | CT | TT | ||||
| 12.29±46.63 | 55.41±56.27 | 326.19±77.32 | ||||
p<0.05;
p<0.01.
Statistically different of least square means (p<0.05).
Statistically different of least square means (p<0.01).