| Literature DB >> 25049512 |
K S Kim1, S W Kim1, N E Raney1, C W Ernst1.
Abstract
Previously identified QTL regions on BTA1 and BTA5 were investigated to validate the QTL regions and to identify candidate genes for growth and carcass traits in commercial cattle populations from the USA and Korea. Initially, a total of 8 polymorphic microsatellite (MS) markers in the BTA1 and 5 QTL regions were used for Chi-square tests to compare the frequencies of individual alleles between high and low phenotypic groups for the US (Michigan Cattleman's Association/Michigan State University; MCA/MSU) cattle. For a subsequent study, 24 candidate genes containing missense mutations and located within the QTL regions based on bovine genome sequence data were analyzed for genotyping in the two commercial cattle populations. Re-sequencing analyses confirmed 18 public missense SNPs and identified 9 new SNPs. Seventeen of these SNPs were used for genotyping of the MCA/MSU cattle (n = 98) and Korean native cattle (n = 323). On BTA1, UPK1B, HRG, and MAGEF1 polymorphisms residing between BM1312 and BMS4048 were significantly associated with growth and carcass traits in one or both of the MCA/MSU and Korean populations. On BTA5, ABCD2, IL22 and SNRPF polymorphisms residing between BL4 and BR2936 were associated with marbling and backfat traits in one or both of the MCA/MSU and Korean cattle populations. These results suggested that BTA 1 and 5 QTL regions may be segregating in both Korean Hanwoo and USA commercial cattle populations and DNA markers tested in this study may contribute to the identification of positional candidate genes for marker-assisted selection programs.Entities:
Keywords: Carcass Traits; Microsatellite Markers; Quantitative Trait Loci; SNPs
Year: 2012 PMID: 25049512 PMCID: PMC4093042 DOI: 10.5713/ajas.2012.12218
Source DB: PubMed Journal: Asian-Australas J Anim Sci ISSN: 1011-2367 Impact factor: 2.509
Means and standard deviations for growth, carcass and beef quality traits measured on MCA/MSU and Korean cattle populations
| Phenotypes | N | Mean | Std Dev | Median |
|---|---|---|---|---|
| Michigan cattle | ||||
| Average daily gain (ADG, kg) | 100 | 1.37 | 0.19 | 1.37 |
| Back fat thickness (BF, cm) | 97 | 0.97 | 0.2 | 0.89 |
| Birth weight (BW, kg) | 91 | 40.86 | 8.07 | 39.92 |
| Marbling (MAR) | 97 | 530.52 | 71.57 | 520.00 |
| Warner-Bratzler Shear force (WBSF, kg) | 97 | 3.39 | 0.78 | 3.30 |
| Slaughter weight (SW, kg) | 100 | 579.46 | 51.29 | 579.92 |
| Ribeye area (REA, cm2) | 97 | 34.321 | 3.63 | 34.79 |
| Korean cattle | ||||
| Carcass weight (CW, kg) | 319 | 346 | 38 | 344 |
| Longissimus muscle area (LMA, cm2) | 320 | 79.3 | 8.31 | 79 |
| Backfat thickness (BF, cm) | 321 | 5.04. | 2.93 | 4 |
| Marbling score (MAR) 1–7 | 320 | 2.52 | 1.30 | 2 |
Identification of SNPs in MCA/MSU and Korean cattle
| Chr. | Gene symbol | GenBank_ID | Primer sequences (5′→3′) | Product size (bp) | NCBI | Site of SNPs in this study |
|---|---|---|---|---|---|---|
| 1 | rs43652277 | TTTGGTTGCCTGGCAGTGAG | 321 | 251R | 146(C/G) | |
| 1 | rs43242284 | AATCCTGGATGAATGCTTTT | 455 | 251R | 251(A/G) | |
| 1 | rs43244443 | GAGGAGAGGCGGGGGTGCTG | 435 | 251Y | – | |
| 1 | rs41257187 | TCACGGTCCTCAGGGAGCCA | 443 | 27Y | – | |
| 1 | rs17870997 | CCTCATTTCATCCTGCTCAG | 307 | 177Y | – | |
| 1 | rs43705174 | TCCTTCTCGCAGAAATGTG | 449 | 101S | – | |
| 1 | rs43245364 | AGCCCTCTTCACTTTGTCCA | 336 | 251M | 251(A/C) | |
| 1 | rs43245367 | CAACCACCCTGGGCAAGATA | 344 | 251Y | 251(C/T) | |
| 1 | rs17870725 | CGGCCCTTGCGATGATCTCA | 292 | 256S, 300K | 256(C/G) | |
| 1 | rs42820807 | TGTTTGTTAGTGGCAGGAGA | 419 | 251S | – | |
| 1 | rs43247946 | GGAGTGGCAGGAGCATGAT | 426 | 251W | – | |
| 1 | rs43246948 | GGGCAGGGCTGTGGAACTTC | 329 | 251K | – | |
| 5 | rs42920919 | AGGTGGCAGGGATGGCAATC | 303 | 251M | 251(A/C) | |
| 5 | rs29003650 | CCAGAGTGAAGGTGTGGTTG | 327 | 73R, 158Y | 73(A/G) | |
| 5 | rs43431357 | TCCCTGAGAATTTGTGGAG | 438 | 251S | – | |
| 5 | rs29004136 | TCCCTGAGAATTTGTGGAG | 431 | 18Y, 21R, 113M, 138M, 178M, 256R, 258S | 113(A/C) | |
| 5 | rs29002687 | GGGCGCGCCTCAGACAACCA | 384 | 256R, 257Y, 304R | 256(A/G) | |
| 5 | rs41590097 | CCCAGGGAGCTGCCAACCAG | 371 | 251Y | 251 (C/T) | |
| 5 | rs43087855 | ATTCCAGCATATTCCTGACA | 451 | 251Y | – | |
| 5 | rs43440868 | TTCCAAGAAATAAGGTGCAG | 382 | 251Y | – | |
| 5 | rs42500325 | TCGGGCTTGCAAGGACCTGA | 324 | 251S | 324(C/T) | |
| 5 | NM001014912 | TGAGGTCCGGCAGAGGGTCC | 387 | Unknown | – | |
| 5 | NM_174208 | GGAGGGACCCGCTGTGCATC | 365 | Unknown | – | |
| 5 | rs43436464 | GGTCCTGCGGTTGGCTGTGT | 489 | 251M | – | |
| 5 | rs43438424 | TTCCAGCCGCTGCTCTTTGA | 464 | 251R | 135(A/G) |
SNP previously reported in the NCBI database and position is based on the reference sequence (http://www.ncbi.nlm.nih.gov/projects/SNP/).
New SNPs based on bovine SNPs at the reference sequence.
Seventeen SNPs that were genotyped in the MCA/MSU cattle and Korean cattle for association analyses.
List of probe information and allele frequencies of 17 polymorphisms on BTA1 and BTA5 genotyped in MCA/MSU and Korean cattle
| Gene | SNP_ID | SNaPshot primer sequences | ‘Allele 1’ | MSU allele 1 frequency | KOR allele 1 frequency |
|---|---|---|---|---|---|
| 209-R | TTCAGTCAGGCTGATGGCC (F) | A | 0.82 | 0.71 | |
| 146-S | TGCTTACAGCCTATGCAG (R) | G | 0.79 | 0.33 | |
| 251-Y | TGGCAGTGCAGATTGCAGC (R) | C | 0.68 | 0.44 | |
| 251-Y | CTGGGACGACTGTGAGCTG (R) | C | 0.83 | 0.91 | |
| 251-M | GCTCAGTATCCTCAAAGAAAT (F) | A | 0.78 | 0.86 | |
| 300-K | AGCAGAAACTGCACCAACTC (F) | G | 0.59 | 0.81 | |
| 251-M | TCTGCATTCACTCCAGGTGA (F) | A | 0.59 | 0.74 | |
| 73-R | CGTTGAGCTTACAGTGCGAC (F) | G | 0.83 | 0.72 | |
| 113-M | GGATGAATGGGAAACGCGC (F) | C | 0.52 | 0.50 | |
| 138-M | ACCACCAGGCCCGGCAAGT (F) | C | 0.87 | 0.96 | |
| 258-S | GCAGGATACTCGCCGCCGA (F) | C | 0.76 | 0.98 | |
| 304-R | GGAGTTGGACATCGGCATC (F) | G | 0.71 | 0.84 | |
| 324-Y | CGTTCGTCTGCGGCGTCGT (R) | T | 1 | 0.94 | |
| 168-R | TCGCTGTAGACGGCATTATC (R) | G | 0.93 | 0.82 | |
| 229-Y | AAGAGCCGTGCCCAGACG (R) | C | 0.65 | 0.56 | |
| 251-R | CATCACGCTCTGGCTCTGC (R) | A | 0.83 | 0.56 | |
| 282-W | CGCGTACAGGATGACGGC (R) | A | 0.85 | 1 |
MSU = MCA/MSU cattle population (n = 98); KOR = Korean cattle population (n = 323).
Chi-square analyses of allelic frequency differences between high and low phenotypic groups
| Chr. | Marker (allele) | Traits | MCA/MSU cattle
| ||
|---|---|---|---|---|---|
| High | Low | ||||
| BTA1 | BM1312(109) | REA | 0.39 | 0.61 | 4.52 |
| WBSF | 0.41 | 0.59 | 4.02 | ||
| BM6506(201) | BW | 0.69 | 0.31 | 8.58 | |
| BTA5 | BL4(159) | ADG | 0.35 | 0.65 | 19.22 |
| BL4(165) | BW | 0.67 | 0.33 | 4.12 | |
| BR2936(162) | ADG | 0.58 | 0.42 | 4.51 | |
| ETH10(220) | SW | 0.35 | 0.65 | 4.50 | |
| ETH10(222) | MAR | 0.67 | 0.33 | 8.99 | |
| BMS1248(142) | ADG | 0.71 | 0.29 | 6.95 | |
| SW | 0.71 | 0.29 | 9.15 | ||
Medium phenotypic values were used to divide the high and low phenotypic groups
Significant at the 5% level.
Significant at the 1% level.
Significant at the 0.5% level.
Association of SNPs on BTA1 and BTA5 with growth and carcass traits for MCA/MSU and Koran cattle
| Chr. | Gene | Phenotypic trait | MSU/MCA cattle (n = 98)
| p-value | Phenotypic trait | Korean cattle (n = 323)
| p-value | ||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Genotypic least squares means (SE) | Genotypic least squares means (SE) | ||||||||||
| BTA1 | UPK1B (209A/G) | SW | AA: 585.63 (6.27) | AG: 563.52 (12.07) | GG: 562.52 (18.81) | 0.0873 | NS | ||||
| REA | AA: 34.45 (0.47) | AG: 34.87 (0.886) | GG: 31.02 (1.38) | 0.0527 | |||||||
| BTA1 | UPK1B (146C/G) | RA | CC: 37.23 (0.74) | CG: 37.79 (0.52) | GG: 33.66 (0.49) | 0.0422 | |||||
| MAR | CC: 585.714 (16.556) | CG: 549.090 (14.985) | GG: 518.727 (9.477) | 0.0297 | MAR | CC: 2.897 (0.121) | CG: 2.627 (0.123) | GG: 2.976 (0.147) | 0.0497 | ||
| BTA1 | HRG(2) (251A/G) | BF | AA: 0.68 (0.02) | AG: 0.95 (0.05) | GG: 1.04 (0.11) | 0.0074 | CW | AA: 330.333 (14.401) | AG: 348.000 (5.375) | GG: 360.020 (4.371) | 0.0167 |
| BTA1 | HRG(1) (251A/C) | BF | AA: 0.67 (0.11) | AC: 0.95 (0.04) | CC: 0.99 (0.03) | 0.0338 | |||||
| BTA1 | MAGEF1 (300G/T) | NS | BF | GG: 5.280 (0.180) | GT: 4.566 (0.230) | TT: 5.985 (0.752) | 0.0243 | ||||
| MAR | GG: 2.684 (0.106) | GT: 2.770 (0.124) | TT: 3.532 (0.323) | 0.0326 | |||||||
| BTA5 | ABCD2 (251A/C) | NS | MAR | AA: 2.899 (0.106) | AC: 2.587 (0.127) | CC: 2.307 (0.217) | 0.0045 | ||||
| BTA5 | IL22 (73A/G) | BF | CC: 0.93 (0.03) | CT: 0.94 (0.04) | TT: 1.19 (0.07) | 0.0021 | NS | ||||
| BTA5 | SNRPF (113A/C) | MAR | AA: 554.545 (15.437) | AC: 508.709 (13.004) | CC: 536.428 (13.683) | 0.0728 | MAR | AA: 2.543 (0.138) | AC: 2.782 (0.107) | CC: 2.946 (0.155) | 0.0612 |
| BTA5 | C1QTNF6 (229C/T) | MAR | CC: 511.621 (11.541) | CT: 546.571 (11.866) | TT: 547.272 (21.167) | 0.0832 | BF | CC: 5.396 (0.242) | CT: 4.723 (0.206) | TT: 5.194 (0.315) | 0.0946 |
| BTA5 | C1QTNF6 (168A/G) | WBSF | CC: 3.339 (0.094) | CT: 3.822 (0.271) | – | 0.0969 | NS | ||||