Literature DB >> 24936400

Aspergillus nidulans Pmts form heterodimers in all pairwise combinations.

Thanyanuch Kriangkripipat1, Michelle Momany1.   

Abstract

Eukaryotic protein O-mannosyltransferases (Pmts) are divided into three subfamilies (Pmt1, Pmt2, and Pmt4) and activity of Pmts in yeasts and animals requires assembly into complexes. In Saccharomyces cerevisiae, Pmt1 and Pmt2 form a heteromeric complex and Pmt 4 forms a homomeric complex. The filamentous fungus Aspergillus nidulans has three Pmts: PmtA (subfamily 2), PmtB (subfamily 1), and PmtC (subfamily 4). In this study we show that A. nidulans Pmts form heteromeric complexes in all possible pairwise combinations and that PmtC forms homomeric complexes. We also show that MsbA, an ortholog of a Pmt4-modified protein, is not modified by PmtC.

Entities:  

Keywords:  Aspergillus nidulans; HA, hemagglutinin; HOG, high osmolarity glycerol; Msb2; O-mannosylation; PMT; Pmt/PMT, protein O-mannosyltransferase; Protein O-mannosyltransferase

Year:  2014        PMID: 24936400      PMCID: PMC4055783          DOI: 10.1016/j.fob.2014.03.006

Source DB:  PubMed          Journal:  FEBS Open Bio        ISSN: 2211-5463            Impact factor:   2.693


Introduction

Protein O-mannosylation is a type of protein glycosylation found in prokaryotes and eukaryotes [1-3]. In eukaryotes, protein O-mannosyltransferases (Pmts) are integral membrane proteins localized in the endoplasmic reticulum (ER) [4,5]. Pmts transfer a mannose residue from dolichyl phosphate mannose to the hydroxyl residue of serine or threonine in secreted proteins facing the luminal side of the ER [6,7]. Further elongation of O-mannosyl glycans takes place in the Golgi using a different set of enzymes and GDP-sugar [1]. O-mannosylation is important for stability, localization and function of secreted proteins [8-10] and a total lack of O-mannosylation is lethal in eukaryotes. Pmts in eukaryotes are grouped into 3 subfamilies with names based on the Saccharomyces cerevisiae enzymes Pmt1, Pmt2 and Pmt4 [11]. S. cerevisiae has 7 Pmts; Candida albicans has 5 [12]; and Aspergillus nidulans and other filamentous fungi have 3, one from each subfamily [2,13]. In S. cerevisiae Ser/Thr-rich domains of secreted proteins are likely to be mannosylated and membrane-associated proteins are mannosylated by Pmt4 [14,15]. But beyond these generalizations, the consensus sequence directing O-mannosylation is not known [3]. Nonetheless, some targets of Pmts have been found empirically and these exhibit specificity toward individual target proteins [8,16]. However, there is evidence of limited substrate overlap. For example, the S. cerevisiae Pmt4 and Pmt1/Pmt2 complex mannosylate different domains of Ccw5p [17]. O-mannosyltransferase activity requires a Pmt complex [18-20]. In S. cerevisiae and S. pombe, members of the Pmt1 subfamily form heteromeric complexes with members of the Pmt2 subfamily [13,21]. The Pmt4 subfamily of S. cerevisiae forms a homomeric complex [13]. In previous work, both our group and another group independently showed that the filamentous fungus A. nidulans has three pmts each representing a different subfamily: PmtA from subfamily 2, PmtB from subfamily 1, and PmtC from subfamily 4. Both groups also showed that ΔpmtA, ΔpmtB, ΔpmtC and the double ΔpmtA ΔpmtB were viable and that each null mutant had a distinctive phenotype [22,23]. These results strongly suggested that either PmtA and Pmt B do not form complexes in A. nidulans as the orthologous Pmt2 and Pmt1 do in S. cerevisiae, or that such subfamily 1/subfamily 2 complexes are not required for viability in A. nidulans as they are in S. cerevisiae. In this study we tested the three A. nidulans Pmts for the ability to form heteromeric and homomeric complexes. We also examined modifications of the A. nidulans ortholog of S. cerevisiae Msb2, a HOG pathway osmosensor modified by Pmt4 [24,25].

Materials and methods

Aspergillus strains and media

The A. nidulans strains used in this study (Table 1) were incubated in complete and minimal media (CM and MM) with supplements as previously described [22]. Genetic manipulations were carried out using standard A. nidulans protocols as previously described [22].
Table 1

A. nidulans strains and plasmids.

StrainGenotype/phenotypeSource or reference
A850argB2::trpC_B methGFGSC
ATK08pyrG89 argB2::trpC_B pyroA4 ΔpmtA::AfpyrG[22]
ATK16pyrG89 ΔpmtB::AfpyrG argB2 pyroA4[22]
ATK38pyrG89 wA3 argB2 pyroA4 ΔpmtC::AfpyrG[22]
ATK42pyrG89 wA3 argB::trpC_B pyroA4This study
ATK45pyrG89 argB::trpC_B nkuA::Afpyro pyroA4[22]
ATK89pyrG89 argB::trpC_B nkuA::Afpyro pyroA4 pmtA::S-tag-AfpyrGThis study
ATK95pyrG89 argB2::trpC_B pyroA4 ΔpmtA::AfpyroThis study
ATK103ATK38::AfargB-gpd(P)- ANID_01359-S-tagThis study
ATK104pyrG89 wA3 ΔpmtB::Afpyro argB2 pyroA4[22]
ATK154pyrG89 argB::trpC_B nkuA::Afpyro pyroA4 pmtC::HA-tag-AfargBThis study
ATK165pyrG89 argB::trpC_B pyroA4 pmtA::S-tag-AfpyrG pmtC::HA-tag-AfargBThis study
ATK168pyrG89 ΔpmtB::Afpyro argB::trpC_B pyroA4 pmtA::S-tag-AfpyrG pmtC::HA-tag-AfargBThis study
ATK172A850::AfargB-gpd(P)-ANID_07041(MsbA)-S-tagThis study
ATK177ATK16::AfargB-gpd(P)-AN ID_07041(MsbA)-S-tagThis study
ATK179ATK08::AfargB-gpd(P)-AN ID_07041(MsbA)-S-tagThis study
ATK184ATK38::AfargB-gpd(P)-AN ID_07041(MsbA)-S-tagThis study
ATK187pyrG89 pmtB::HA-tag-AfargB argB::trpC_B nkuA::Afpyro pyroA4This study
ATK192pyrG89 pmtB::HA-tag-AfargB argB::trpC_B pyroA4 pmtA::S-tag-AfpyrGThis study
ATK193pyrG89 pmtB::HA-tag-AfargB argB::trpC_B pyroA4 pmtC::S-tag-AfpyrGThis study
ATK195ATK149 X ATK104This study
ATK200pyrG89 pmtB::HA-tag-AfargB argB::trpC_B pyroA4ΔpmtA::Afpyro pmtC::S-tag-AfpyrGThis study
ATK208pyrG89 argB::trpC_B pyroA4 pmtC::S-tag-AfpyrGThis study
ATK211ATK177 X ATK95This study
ATK217pyrG89/pyrG89 argB::trpC_B/argB::trpC_B pyroA4/pyroA4 pmtC::S-tag-AfpyrG/pmtC::HA-tag-AfargBThis study



Plasmids
pAfargB2Ampr argB2G. S. May
pAO81GA4-S-Tag AfpyrG[26]
pDV2Ampr argB-gpd(p)-ccdB-sgfp[28]
pMT-3xHAAmpr argB-alcA(p)-ccdB-3xHA[28]
pFNO3Kanr GA5-GFP AfpyrG[26]
pTK74pDV2::ANID_07041-S-tagThis study

Fungal Genetics Stock Center School of Biological Sciences, University of Missouri, Kansas City, Kansas City, Missouri, USA

Construction of tagged Pmts

Strains bearing single copy epitope tagged Pmts were constructed by fusion PCR [26] using primers listed in Table 2. Primer names in Table 2 indicate tag identity and whether primers are upstream or downstream of the designated pmt gene. Amplicons were purified and transformed into ATK45. Homologous integration resulting in strains bearing a single tagged Pmt replacing the original Pmt was verified by PCR and Southern. All strains constructed along with detailed genotypes are shown in Table 1.
Table 2

Primers.

Primer nameSequence
Pmt2FWentCACCATGGCTGAAATTGGCTTTG
Pmt2RVnostopGTTAGCGATTCGCCAACCG
pmt2-GA4FwGAGCGGTTGGCGAATCGCTAACGGAGCTGGTGCAGGCGC
Stag-pmt2RVGAACTGTAACGCTCTATCACGGTTCCTGTCTGAGAGGAGGCACTGATGC
pmt2DnFWGAACCGTGATAGAGCGTTACAGTTCCCGTTG
pmt2DNRVGCGATCCCAATCCTTCCTATCTCTGTCATC
PMT2F301CCGAATCGGCCGCTCAAACATCGTG
PMT2R6311TGCGACTGGGCGAGAAAGCGTGAGG
up177PMT2FTCCGCAGTCGCCCGCCAGATATGAG
StagRGCGCCAATTGCTGTTGCCAGGTGAGG
PMT11093FGTGCTTGGTCAATCCGGGAGAGGG
Pmt1RVnostopACGGGTCGCCTCGTTGCCTTC
PMT1-GA5FGCAACGAGGCGACCCGTGGAGCTGGTGCAGGCGC
argBAf-PMT1DnRCAACAGACCGACATATTATCTCATAGGATTTTCCCCTTG
Pmt1dn-FWGATAATATGTCGGTCTGTTGAACTACCTGCC
PmtBdnR2CTGAGAGGGAGTTCGGAAACGTGC
463Pmt4FGTCCCCTATGTCGCCCTCCG
Pmt4RVnostopTTTCGCGAAGTGCAAGTCATAGC
Pmt4GA4FCTATGACTTGCACTTCGCGAAAGGAGCTGGTGCAGGCGCTGGAG
pyrGAFRV-Pmt4SPRVAGAACGAGATGAGATCAGATGCTCCTGTCTGAGAGGAGGCACTGATGCG
Pmt4dnFWGAGCATCTGATCTCATCTCGTTCTCTCCC
Pmt4dnRVCTATCCACGGTATGAGCTGAGCGAGTAATG
argBpmt4RVAGAACGAGATGAGATCAGATGCTCCGATTTTCATAGGATTTTCCCCTTG
StagRGCGCCAATTGCTGTTGCCAGGTGAGG
MSB2entFCACCATGGTTTCCCAGACGGCTC
MSB2-StagRGCGCCTGCACCAGCTCCGTTCCATCCCAGAGAGTTC
StagFGGAGCTGGTGCAGGCGCTGGAGC
StagRGCGCCAATTGCTGTTGCCAGGTGAGG

Construction of S-tagged Pmt target proteins

The GA4 S-tag fragment with stop codon was amplified from pAO81 and the gene of interest was amplified from the start codon to one codon before the stop codon. Amplicons were fused by PCR, ligated into the pENTR/D-TOPO vector using the pENTR/D-TOPO Cloning Kit (Invitrogen Co., CA) and transferred into the pMT-DV2 destination vector using Gateway LR Clonase II (Invitrogen Corp., CA) and transformed into A850 and Δpmt strains. All strains constructed along with detailed genotypes are shown in Table 1. All primer sequences are shown in Table 2. Primer names in Table 2 indicate tag identity and whether primers are upstream or downstream of the designated pmt gene.

Membrane fraction preparation

1  × 108 conidia/ml of the specified tagged-PMT strain were inoculated to CM (50 mL for target protein extraction and 1 L for immunoprecipitation) and shaken at 200 rpm and 30°C for 8 h. Mycelia were filtered, washed with cold stop buffer (0.9% NaCl, 1 mM NaN3, 10 mM EDTA, 50 mM NaF, pH 7.0), and ground in liquid nitrogen. Two milliliters of cold extraction buffer (50 mM TrisHCl, pH 7.5, 0.3 mM MgCl2 plus protease Inhibitors (Complete, Mini, EDTA-free; Protease Inhibitor Cocktail Tablets, Roche) were added to 1 g ground mycelia and vortexed for 10 min at 4 °C. The cell suspension was centrifuged at 500×g for 10 min at 4°C. The supernatant was collected and centrifuged for 30 min at 20,000 rpm at 4 °C (Sorvall SS34 rotor). One mL buffer containing 50 mM TrisHCl, pH 7.5, 7.5 mM MgCl2, and 15% glycerol was added per 1 mL of pellet and stored at −80°C. Protein was quantified with RC DC Protein Assay Kit (Bio-Rad Laboratories, CA) using bovine serum albumin as a standard.

Immunoprecipitation

Immunoprecipitation methods were adapted from Girrbach and colleagues [7]. Twenty milligrams of membrane fraction was solubilized in 4 mL of lysis buffer (20 mM TrisHCl, pH 7.5, 140 mM NaCl, 0.3 mM MgCl2, 10% glycerol, 0.35% sodium deoxycholate, 0.5% Triton X-100 plus Protease Inhibitor (Complete, Mini, EDTA-free; Protease Inhibitor Cocktail Tablets, Roche). One hundred μL of agarose immobilized anti-epitope tag antibody slurry was added per 20 mg of protein. Agarose immobilized rabbit anti-S tag or rabbit anti-HA antibody was used for immunoprecipitation (Immunology Consultants Laboratory, Inc., Newberg, OR). Incubation with the solubilized membrane fraction was carried out at 4°C on a rocker for 2 h followed by 5 washes at 4°C with equal volume of cold lysis buffer and one wash with 1 mL cold Tris-buffered saline. Agarose beads were resuspended in 50 μL cold Tris-buffered saline. The bound proteins were eluted with 3 × SDS loading dye by 5 min at 95°C.

Western blot analyses

20 μL per lane of epitope-tagged Pmt eluent was loaded into 2 gels to be further probed with anti-S tag or anti-HA antibody. The proteins were resolved on 4–20% gradient TrisHEPES SDS gels (Pierce Protein Gels, Thermo Fisher Scientific Inc., IL) and transferred to a nylon membrane. S-tagged Pmts were detected with mouse anti-S-tag antibody (1:5000) (Abcam Inc., MA), followed by Sheep anti-Mouse IgG ECL antibody coupled to horseradish peroxidase (1:5000) (GE Healthcare, NJ). HA-tagged proteins were detected with mouse anti-HA-tag antibody (1:5000) (Invitrogen Co., CA), followed by Sheep anti-Mouse IgG ECL antibody coupled to horseradish peroxidase (1:5000) (GE Healthcare, NJ). For Pmt target protein analyses, an equal volume of 2 × SDS–PAGE sample buffer [27] was added to membrane fractions and heated for 5 min at 95°C. Forty μg solubilized protein were loaded per lane and detected as described above.

Results and discussion

To investigate Pmt complex formation in A. nidulans, we constructed the following strains with C-terminal purification tags: ATK89 (PmtAS), ATK187 (PmtBHA) and ATK154 (PmtCHA). Because we were concerned that over-expression of individual Pmts might alter interactions within complexes, we constructed these strains by replacing native Pmts with the corresponding tagged protein using homologous integration. In these strains, the tagged Pmt fusion constructs were integrated at native Pmt loci behind native Pmt promoters resulting in expression levels as close to wildtype as possible. Correct integrations were confirmed by PCR and Southern hybridization. All tagged Pmt strains showed wildtype phenotypes at 30°C and 42°C (data not shown). The S and HA tags are both small, with deduced molecular mass of 2.26 kDa and 3.98 kDa, respectively. The predicted molecular mass of PmtAS is 86.86 kDa, of PmtBHA is 108.98 kDa, and of PmtCHA is 92.28 kDa. Attempts to detect tagged Pmts by western blot of total membrane fractions were unsuccessful, suggesting low levels of fusion protein. Therefore, immunoprecipitation of solubilized membrane fractions with agarose-immobilized anti-HA or anti-S tag antibodies was used, followed by SDS–PAGE and immunoblot (Fig. 1). The PmtAS strain yielded two bands with apparent molecular mass of approximately of 68 kDa and 165 kDa. The PmtBHA strain yielded two bands with apparent molecular mass of approximately 120 kDa and 180 kDa. The PmtCHA strain yielded two bands with apparent molecular mass of approximately 80 kDa and 160 kDa. In all cases, the lower band is likely the Pmt based on predicted molecular mass, strength of the signal and reproducibility. Pmts isolated from yeasts and animals frequently show apparent molecular masses that are smaller or larger than predicted [13,18]. Girrbach and Strahl reported similar double band patterns in S. cerevisiae blue native PAGE experiments with the higher bands resulting from heteromeric PMT complex formation [13]. However, our experiments included SDS so that proteins are expected to be denatured. Further these bands always appear at the same molecular mass for specific Pmts and their presence in strains carrying a Pmt deletion along with a tagged Pmt suggests that they are not heterodimers. A similar double band pattern was reported when the human PMT ortholog Pomt1 was expressed in HEK293T cells. In this case the authors speculated that the upper band resulted from protein aggregation due to Pomt1 over-expression [18]. Though the Pmts in our study were all expressed from endogenous promoters rather than over-expressed, it is possible that the higher bands seen in our immunoblots resulted from aggregation of these hydrophobic proteins during processing. It is also possible that the upper bands represent homodimers of tagged Pmts.
Fig. 1

Immunoprecipitation of Epitope-tagged Pmts. Western blot analyses of immunoprecipitates from ATK89 (PmtAS), ATK187 (PmtBHA) and ATK154 (PmtCHA). Proteins were expressed from their native loci under the control of their endogenous promoters. Solubilized membrane-enriched fractions were immunoprecipitated with the corresponding agarose immobilized antibody against the epitope tag. Immunoprecipitates were resuspended in SDS loading dye and resolved on 4–20% gradient Tris–HEPES–SDS–polyacrylamide gels, transferred to membranes, and probed with anti-S tag antibody (left) or anti-HA antibody (two blots on right). Arrows indicate Pmts.

PmtA (subfamily 2) forms heteromeric complexes with PmtB (subfamily 1)

To investigate whether A. nidulans PmtA and PmtB form a heteromeric complex like their S. cerevisiae orthologs, Pmt2 and Pmt1 [13], we derived a PmtAS PmtBHA strain (ATK192) from sexual crosses. Immunoprecipitation was performed with agarose-immobilized anti-HA antibodies and agarose-immobilized anti-S tag antibody. The immunoprecipitate was divided into two aliquots. One aliquot was probed with anti-S tag antibody and the other was probed with anti-HA antibody. When probed with anti-S tag antibody, the same bands that were seen in the PmtAS strain were visible (approximately 68 kDa and 165 kDa) (Fig. 2). When probed with anti-HA antibody, the same bands that were seen in the PmtBHA strain were visible (approximately 120 kDa and 180 kDa) (Fig. 2). Reciprocal experiments performed using anti-HA antibodies for immunoprecipitation before immunoblotting showed very high background, though the results were consistent with heteromeric complex formation by PmtA and PmB (data not shown). Our results show that PmtA and PmtB form heteromeric complexes in A. nidulans.
Fig. 2

Immunoprecipitation of PmtA-PmtB heteromeric complexes. Solubilized membrane-enriched fractions from ATK192 (PmtAS PmtBHA) were immunoprecipitated with agarose immobilized anti-S tag antibody. Co-immunoprecipitates were resuspended in SDS loading dye and resolved on 4–20% gradient Tris–HEPES–SDS–polyacrylamide gels, transferred to membranes, and probed with anti-S tag antibody (left) or anti-HA antibody (right). Arrows indicate Pmts.

PmtA (subfamily 2) forms heteromeric complexes with PmtC (subfamily 4)

In S. cerevisiae, Pmt2 and Pmt4 do not form complexes [13]. To investigate the interactions between the A. nidulans orthologs, strains carrying PmtAS and PmtCHA in the presence of PmtB (pmtA::S tag, pmtC::HA, ATK165) and absence of PmtB (pmtA::S tag, pmtC::HA, ΔpmtB; ATK168) were derived from sexual crosses. Immunoprecipitations were performed with agarose-immobilized anti-S tag antibody as described above. When probed with anti-HA antibody, Western blots of immunoprecipitates from both strains showed a band of approximately 80 kDa whether or not PmtB was present (Fig. 3). Reciprocal experiments performed using anti-HA antibodies for immunoprecipitation before immunoblotting were consistent with heteromeric complex formation by PmtA and PmtC (Fig. S1). Our results show that A. nidulans PmtA forms a heteromeric complex with PmtC in the presence and absence of PmtB.
Fig. 3

Immunoprecipitation of PmtA-PmtC heteromeric complexes. Solubilized membrane-enriched fractions from ATK168 (PmtAS, PmtCHA, ΔpmtB; lane 1) and ATK165 (PmtAS, PmtCHA; lane 2) were immunoprecipitated with agarose immobilized anti-S-tag antibody. Co-immunoprecipitates were resuspended in SDS loading dye and resolved on 4–20% gradient Tris–HEPES–SDS–polyacrylamide gels, transferred to membranes, and probed with anti-S tag antibody (left) or anti-HA antibody (right). Arrows indicate Pmts.

PmtB (subfamily 1) forms heteromeric complexes with PmtC (subfamily 4)

To investigate the interactions between PmtB and PmtC, a strain bearing PmtBHA and PmtCS in the presence of PmtA (pmtB::HA, pmtC::S tag; ATK193) and absence of PmtA (pmtB::HA, pmtC::S tag, ΔpmtA; ATK200) were derived from sexual crosses. Immunoprecipitation and Western blots were performed as described above. Immunoblots probed with anti-HA antibody showed a band of approximately 120 kDa whether or not PmtA was present (Fig. 4). Reciprocal experiments performed using anti-HA antibodies for immunoprecipitation before immunoblotting showed very high background, though the results were consistent with heteromeric complex formation by PmtB and PmtC (data not shown). Our results show that A. nidulans PmtB forms a heteromeric complex with PmtC in the presence and absence of PmtA.
Fig. 4

Immunoprecipitation of PmtB-PmtC heteromeric complexes. Solubilized membrane-enriched fractions were immunoprecipitated with agarose immobilized anti-S-tag antibody. Lane 1 is co-immunoprecipitate from ATK200 (PmtBHA, PmtCS, ΔpmtA), lane 2 is co-immunoprecipitate from ATK193 (PmtBHA, PmtCS). Co-immunoprecipitates were resuspended in SDS loading dye and resolved on 4–20% gradient Tris–HEPES–SDS–polyacrylamide gels, transferred to membranes, and probed with anti-S tag antibody (left) or anti-HA antibody (right).

PmtC (subfamily 4) forms homomeric complexes

In S. cerevisiae, Pmt4 functions as a dimer, not a monomer [13]. To investigate whether the A. nidulans ortholog, PmtC, is a monomer or forms homomeric complexes in A. nidulans, a stable diploid PmtCS PmtCHA strain (pmtC::S tag/pmtC::HA; ATK217) was constructed. Immunoprecipitation and Westerns were performed as described above and probed with anti-S tag antibody or anti-HA antibody. In both cases the same bands that were seen in the PmtCHA strain were visible (approximately 80 kDa and 160 kDa) (Fig. 5). Reciprocal experiments performed using anti-HA antibodies for immunoprecipitation before immunoblotting were consistent with homomeric complex formation by PmtC (Fig. S1). Our results show that A. nidulans forms a PmtC homomeric complex as is true for the orthologous S. cerevisiae Pmt4 [13].
Fig. 5

Immunoprecipitation of PmtC-PmtC homomeric complexes. A solubilized membrane enriched fraction from diploid strain ATK217 (PmtCS coexpressed with PmtCHA) was immunoprecipitated with agarose immobilized anti-S tag antibody. Co-immunoprecipitate was resuspended in SDS loading dye and resolved on 4–20% gradient Tris–HEPES–SDS–polyacrylamide gels, transferred to membranes, and probed with anti-S tag antibody (left) or anti-HA antibody (right).

Genetic evidence from our previous work suggests that this PmtCPmtC homomeric complex is sufficient to support growth because the ΔpmtA ΔpmtB strain is viable [22]. Despite repeated attempts, we were unable to recover appropriately marked strains to investigate PmtAPmtA and PmtBPmtB homomeric complex formation. However, if PmtAPmtA and PmtBPmtB homomeric complexes exist, neither appears to be sufficient to support A. nidulans growth in the absence of the other Pmts since both the ΔpmtA ΔpmtC and ΔpmtB ΔpmtC double mutants are inviable.

Pmt complexes are formed in vivo

To eliminate the possibility that the A. nidulans Pmt complexes we detected might result from nonspecific aggregation of Pmts in solubilized membrane fractions, we performed the following control experiment. Membrane fractions were isolated from strains in which S tagged and HA tagged Pmts were co-expressed, and solubilized. Membrane fractions were also isolated separately from strains in which S tagged Pmts were expressed, and from strains in which HA tagged Pmts were expressed. Isolated membrane fractions were combined and solubilized. Agarose-immobilized anti-S tag antibody was used to immunoprecipitate protein from solubilized membranes of the strains co-expressing S tagged and HA tagged Pmts or from the combined and solubilized membranes of the strains separately expressing tagged Pmts. Identical aliquots were probed with anti-S tag antibody or anti-HA antibody. The co-expressed Pmts co-precipitated, but the separately expressed and combined Pmts did not, suggesting that the Pmt complexes we detected in earlier experiments were formed in vivo and not the result of nonspecific protein aggregation (Fig. 6).
Fig. 6

Pmt complexes form in vivo. Solubilized membrane enriched fractions or combined solubilized membrane fractions were immunoprecipitated with agarose immobilized anti-S tag antibody. Lane 1 is co-immunoprecipitate from ATK192 (PmtAS, PmtBHA). Lane 2 is co-immunoprecipitate from membrane fractions of ATK89 (PmtAS) combined with membrane fractions of ATK187 (PmtBHA). Lane 3 is co-immunoprecipitate from ATK165 (PmtAS, PmtCHA). Lane 4 is co-immunoprecipitate from membrane fractions of ATK89 (PmtAS) combined with membrane fractions of ATK154 (PmtCHA). Co-immunoprecipitates were resuspended in SDS loading dye and resolved on 4–20% gradient Tris–HEPES–SDS–polyacrylamide gels, transferred to membranes, and probed with anti-S tag antibody (left) or anti-HA antibody (right).

MsbA, an ortholog of a Pmt4-modified protein, is not modified by PmtC

In S. cerevisiae, Msb2, an osmosensor in the HOG pathway, is modified by Pmt4 [24,25]. Using the S. cerevisiae Msb2 protein sequence to query the A. nidulans genome database at the Broad Institute (http://www.broad.mit.edu) yielded ANID_07041.1, which we named “MsbA”. MsbAS was expressed from the gpd promoter in wildtype and Δpmt mutants, membrane fractions were isolated and probed with anti-S tag antibodies in Westerns (Fig. 7). The apparent molecular mass of MsbA in the ΔpmtA and ΔpmtB mutants was 160 and 170 kDa respectively, while the molecular mass of MsbAS in ΔpmtAΔpmtB mutant appeared lower at 150 kDa. The apparent molecular mass of MsbA in the ΔpmtC mutant was approximately 240 kDa, which was the same as that in the wildtype. MsbA possesses a putative N-glycosylation site. The molecular mass of PNGase F treated MSbAS in ΔpmtA, ΔpmtB and ΔpmtC was unchanged (data not shown). Our results suggest that MsbA is modified by PmtA and PmtB, but not by PmtC, and that PmtA and PmtB make separate modifications to MsbA.
Fig. 7

MsbA (AN7041) is modified by PmtA and PmtB, but not by PmtC. Crude membrane fractions containing MsbAS from Δpmt mutants and wildtype were treated with 2  × SDS loading dye and separated on 7% SDS–polyacrylamide gel, transferred to a membrane, and probed with anti-S tag antibody.

In S. cerevisiae both Pmt subfamily 1 and Pmt subfamily 2 have two members (Fig. 8). In immunoprecipitation experiments, the predominant interaction partner for Pmt1 is Pmt2, though low levels of Pmt3 (from subfamily 2) are also reproducibly precipitated. Similarly, the predominant interaction partner for Pmt 5 (from subfamily 1) is Pmt3, though low levels of Pmt2 are also precipitated [13]. The Pmt 4 subfamily has only one member and it only forms homodimers. Thus in S. cerevisiae five Pmt complexes exist and low level complexes can substitute if the predominant complexes are lost.
Fig. 8

Diagram comparing Pmt complex formation in A. nidulans and S. cerevisiae (adapted from Girrbach and Strahl) [13]. In S. cerevisiae Pmt1 forms heteromeric complexes with Pmt2 and Pmt4 forms homomeric complexes. Pmt1 forms heteromeric complexes with Pmt3 (subfamily 2) in the absence of Pmt2, while Pmt2 forms heteromeric complexes with Pmt5 (subfamily 1) in the absence of Pmt1. In A. nidulans PmtB (subfamily 1) forms heteromeric complexes with PmtA (subfamily 2) and with PmtC (subfamily 4). PmtA (subfamily 2) forms heteromeric complexes with PmtC (subfamily 4). PmtC (subfamily 4) forms homomeric complexes. Ovals indicate Pmt1 subfamily. Diamonds indicate Pmt2 subfamily. Pentagons indicate Pmt4 subfamily.

In contrast A. nidulans contains only 3 Pmts, one from each subfamily (Fig. 8). Not surprisingly, we found that PmtA (subfamily 2) interacts with Pmt B (subfamily 1) and PmtC (subfamily 4) interacts with itself. More surprisingly, we also found that both PmtA and Pmt B interact with Pmt C (subfamily 4). Because we were unable to generate appropriately marked diploid strains, we do not know if PmtA and Pmt B can also form homodimers and because single copy Pmts driven by native promoters were not produced in large quantities, we were unable to address quantitative issues such as which complexes predominate. However, it is clear that in A. nidulans at least four Pmt complexes exist, though it is not clear which complexes predominate. A. nidulans is the first fungus reported to form heteromeric complexes involving the Pmt4 subfamily, though such complexes have been reported in animals where POMT1 (subfamily 4) forms a heteromeric complex with POMT2 (subfamily 2) [18,19]. It is possible that the novel heterodimers we observed with Pmt C might be low level forms that can substitute when other complexes are lost allowing A. nidulans to survive with its reduced complement of single Pmts from each subfamily [22].

Conclusions

In this study we show that the three A. nidulans Pmts (PmtA from subfamily 2, PmtB from subfamily 1, and PmtC from subfamily 4) form heteromeric complexes in all pairwise combinations and that PmtC forms a homomeric complex. We also show that MsbA, the A. nidulans ortholog of S. cerevisiae Msb2, is modified by PmtA and PmtB, but not by PmtC.
  27 in total

1.  O-mannosylation precedes and potentially controls the N-glycosylation of a yeast cell wall glycoprotein.

Authors:  Margit Ecker; Vladimir Mrsa; Ilja Hagen; Rainer Deutzmann; Sabine Strahl; Widmar Tanner
Journal:  EMBO Rep       Date:  2003-06       Impact factor: 8.807

2.  Multiple functions of Pmt1p-mediated protein O-mannosylation in the fungal pathogen Candida albicans.

Authors:  C Timpel; S Strahl-Bolsinger; K Ziegelbauer; J F Ernst
Journal:  J Biol Chem       Date:  1998-08-14       Impact factor: 5.157

Review 3.  Protein O-mannosylation: what we have learned from baker's yeast.

Authors:  Martin Loibl; Sabine Strahl
Journal:  Biochim Biophys Acta       Date:  2013-02-20

4.  Protein-O-glycosylation in yeast: protein-specific mannosyltransferases.

Authors:  M Gentzsch; W Tanner
Journal:  Glycobiology       Date:  1997-06       Impact factor: 4.313

5.  Establishment of mRFP1 as a fluorescent marker in Aspergillus nidulans and construction of expression vectors for high-throughput protein tagging using recombination in vitro (GATEWAY).

Authors:  Matthias W Toews; Johannes Warmbold; Sven Konzack; Patricia Rischitor; Daniel Veith; Kay Vienken; Claudia Vinuesa; Huijun Wei; Reinhard Fischer
Journal:  Curr Genet       Date:  2004-04-08       Impact factor: 3.886

6.  Aberrant processing of the WSC family and Mid2p cell surface sensors results in cell death of Saccharomyces cerevisiae O-mannosylation mutants.

Authors:  Mark Lommel; Michel Bagnat; Sabine Strahl
Journal:  Mol Cell Biol       Date:  2004-01       Impact factor: 4.272

7.  Rapid production of gene replacement constructs and generation of a green fluorescent protein-tagged centromeric marker in Aspergillus nidulans.

Authors:  Lin Yang; Leena Ukil; Aysha Osmani; Francis Nahm; Jonathan Davies; Colin P C De Souza; Xiaowei Dou; Ariadna Perez-Balaguer; Stephen A Osmani
Journal:  Eukaryot Cell       Date:  2004-10

8.  Protein O-glycosylation in Saccharomyces cerevisiae: the protein O-mannosyltransferases Pmt1p and Pmt2p function as heterodimer.

Authors:  M Gentzsch; T Immervoll; W Tanner
Journal:  FEBS Lett       Date:  1995-12-18       Impact factor: 4.124

9.  A third osmosensing branch in Saccharomyces cerevisiae requires the Msb2 protein and functions in parallel with the Sho1 branch.

Authors:  Sean M O'Rourke; Ira Herskowitz
Journal:  Mol Cell Biol       Date:  2002-07       Impact factor: 4.272

10.  Protein O-mannosyltransferases B and C support hyphal development and differentiation in Aspergillus nidulans.

Authors:  Masatoshi Goto; Yuka Harada; Takuji Oka; Sho Matsumoto; Kaoru Takegawa; Kensuke Furukawa
Journal:  Eukaryot Cell       Date:  2009-07-31
View more
  6 in total

1.  Protein O-mannosyltransferases are required for sterigmatocystin production and developmental processes in Aspergillus nidulans.

Authors:  Thi Huynh Tram Le; Ayana Oki; Masatoshi Goto; Kiminori Shimizu
Journal:  Curr Genet       Date:  2018-02-28       Impact factor: 3.886

2.  Hansenula polymorpha Pmt4p Plays Critical Roles in O-Mannosylation of Surface Membrane Proteins and Participates in Heteromeric Complex Formation.

Authors:  Hyunah Kim; Eun Jung Thak; Dong-Jik Lee; Michael O Agaphonov; Hyun Ah Kang
Journal:  PLoS One       Date:  2015-07-02       Impact factor: 3.240

3.  Plant Defensins NaD1 and NaD2 Induce Different Stress Response Pathways in Fungi.

Authors:  Peter M Dracatos; Jennifer Payne; Antonio Di Pietro; Marilyn A Anderson; Kim M Plummer
Journal:  Int J Mol Sci       Date:  2016-09-03       Impact factor: 5.923

4.  Identification and Characterization of Aspergillus nidulans Mutants Impaired in Asexual Development under Phosphate Stress.

Authors:  Ainara Otamendi; Eduardo A Espeso; Oier Etxebeste
Journal:  Cells       Date:  2019-11-26       Impact factor: 6.600

Review 5.  Structural, Evolutionary, and Functional Analysis of the Protein O-Mannosyltransferase Family in Pathogenic Fungi.

Authors:  María Dolores Pejenaute-Ochoa; Carlos Santana-Molina; Damien P Devos; José Ignacio Ibeas; Alfonso Fernández-Álvarez
Journal:  J Fungi (Basel)       Date:  2021-04-23

6.  Identification of glycoproteins secreted by wild-type Botrytis cinerea and by protein O-mannosyltransferase mutants.

Authors:  Mario González; Nélida Brito; Celedonio González
Journal:  BMC Microbiol       Date:  2014-10-12       Impact factor: 3.605

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.