Novel substituted 2,3-dihydrobenzofuran-7-carboxamide (DHBF-7-carboxamide) and 2,3-dihydrobenzofuran-3(2H)-one-7-carboxamide (DHBF-3-one-7-carboxamide) derivatives were synthesized and evaluated as inhibitors of poly(ADP-ribose)polymerase-1 (PARP-1). A structure-based design strategy resulted in lead compound 3 (DHBF-7-carboxamide; IC50 = 9.45 μM). To facilitate synthetically feasible derivatives, an alternative core was designed, DHBF-3-one-7-carboxamide (36, IC50 = 16.2 μM). The electrophilic 2-position of this scaffold was accessible for extended modifications. Substituted benzylidene derivatives at the 2-position were found to be the most potent, with 3',4'-dihydroxybenzylidene 58 (IC50 = 0.531 μM) showing a 30-fold improvement in potency. Various heterocycles attached at the 4'-hydroxyl/4'-amino of the benzylidene moiety resulted in significant improvement in inhibition of PARP-1 activity (e.g., compounds 66-68, 70, 72, and 73; IC50 values from 0.718 to 0.079 μM). Compound 66 showed selective cytotoxicity in BRCA2-deficient DT40 cells. Crystal structures of three inhibitors (compounds (-)-13c, 59, and 65) bound to a multidomain PARP-1 structure were obtained, providing insights into further development of these inhibitors.
Novel substituted 2,3-dihydrobenzofuran-7-carboxamide (DHBF-7-carboxamide) and 2,3-dihydrobenzofuran-3(2H)-one-7-carboxamide (DHBF-3-one-7-carboxamide) derivatives were synthesized and evaluated as inhibitors of poly(ADP-ribose)polymerase-1 (PARP-1). A structure-based design strategy resulted in lead compound 3 (DHBF-7-carboxamide; IC50 = 9.45 μM). To facilitate synthetically feasible derivatives, an alternative core was designed, DHBF-3-one-7-carboxamide (36, IC50 = 16.2 μM). The electrophilic 2-position of this scaffold was accessible for extended modifications. Substituted benzylidene derivatives at the 2-position were found to be the most potent, with 3',4'-dihydroxybenzylidene 58 (IC50 = 0.531 μM) showing a 30-fold improvement in potency. Various heterocycles attached at the 4'-hydroxyl/4'-amino of the benzylidene moiety resulted in significant improvement in inhibition of PARP-1 activity (e.g., compounds 66-68, 70, 72, and 73; IC50 values from 0.718 to 0.079 μM). Compound 66 showed selective cytotoxicity in BRCA2-deficient DT40 cells. Crystal structures of three inhibitors (compounds (-)-13c, 59, and 65) bound to a multidomain PARP-1 structure were obtained, providing insights into further development of these inhibitors.
Poly(ADP-ribose)polymerase-1
(PARP-1) is an abundant, ubiquitously
expressed nuclear protein that is responsible for the maintenance
and repair of DNA damage.[1] PARP-1 is the
founding member of an expanded family of related proteins with similar
enzymatic activity. PARP-1 utilizes NAD+ as a substrate
to synthesize linear and branched chains of poly(ADP-ribose) (PAR).
These PARchains covalently bind to the acceptor residues. Poly(ADP)ribosylation
(PARylation) occurs mainly on PARP-1 itself (automodification) but
also on number of nuclear target proteins (heteromodification) such
as histones, p53, topoisomerase I/II, DNA polymerases, and DNA ligases.[1,2] In response to DNA-strand breaks, PARylation by PARP-1 is stimulated
nearly 500-fold.[3] PARylation is involved
in a number of important cellular processes including DNA damage repair,
genomic stability, and regulation of transcription and cell death.[4,5] The synthesis of highly negatively charged PARchains leads to chromatin
decondensation and dynamic nucleosome remodeling[6] that facilitates accessibility of base excision repair
(BER) proteins such as XRCC1, DNA ligase III, and DNA polymerase β
(pol β) to sites of damaged DNA.[7−9] The presence of PAR is
both transient and dynamic, as hydrolase enzymes such as poly(ADP-ribose)glycohydrolase
(PARG) quickly degrade PAR into ADP-ribose units.[10]With such prominent and pivotal roles in the maintenance
of genomic
stability, PARP-1 inhibitors have been developed to target certain
diseases such as cancer. PARP-1 inhibitors sensitize tumorcells to
certain DNA alkylating agents (e.g., temozolomide, cisplatin), topoisomerase
I poisons (e.g., irinotecan), and other chemotherapeutic agents and
are being used in clinical trials as potentiators of chemo- and radiotherapy.[5,11,12] The finding that double-strand
DNA break repair-deficient cancercells carrying defective or mutated BRCA1 and BRCA2 respond to PARP inhibitors
(synthetic lethality) has paved the way for PARP inhibitors as single
agents therapy in oncology.[13,14] Some of the clinically
proven PARP-1 inhibitors such as olaparib have been shown to exhibit
single agent activity for tumors with mutations in BRCA1- and BRCA2-dependent DNA double-strand break repair
mechanisms (homologous recombination, HR).[15−18] In addition, PARP-1 inhibitors
may also be effective at targeting other DNA repair defects in tumors
with “BRCAness” phenotypes.[19] For instance, lack of tumor suppressor gene PTEN (phosphatase and
tensin homologue) demonstrate HR defects in humantumorcell lines,
making them responsive to PARP-1 inhibitors.[20] Taken together, PARP-1 inhibitors offer exciting therapeutic potential
as molecular targeted agents in the field of oncology.Previously,
we reported N-1 substituted indazole-3-carboxamide[21] and 2,8-disubstituted quinazolin-4(3H)-one[22] derivatives as PARP-1
inhibitors. With the aims of structural novelty and improved potency
of these scaffolds, we designed the previously unexplored pharmacophores
2,3-dihydrobenzofuran-7-carboxamide (DHBF-7-carboxamide) and 2,3-dihydrobenzofuran-3(2H)-one-7-carboxamide (DHBF-3-one-7-carboxamide) that are
targeted to the NAD+ binding site of PARP-1. We obtained
crystal structure data of these scaffolds to help further drug development.
Inhibitor bound crystal structures were of the PARP-1 multidomain
complex with DNA,[23] demonstrating the first
report of a PARP inhibitor bound to DNA-damage activated PARP-1.
Results
and Discussion
Structure-Based Drug Design
A considerable
number of
PARP inhibitors have been described in the literature over the past
several years.[24,25] The structures of the selected
PARP inhibitors (ABT-888,[26] MK-4827,[27] AG014699,[28] and AZD-2281[29]) in clinical trials are shown in Chart 1. It is well established that these agents target
the NAD+ binding site by occupying the nicotinamide pocket.
Inhibitors that target this site contain a cyclic or acycliccarboxamide
pharmacophore, which makes π–π stacking interactions
with adjacent tyrosine residues, Tyr896 and Tyr907, and form three
key hydrogen bonds with Gly863 and Ser904 of the PARP-1catalytic
site. Optimization efforts that gave rise to these clinical candidates
improved potency by restricting the amideconformation of the carboxamide
through intramolecular hydrogen bonding[27,30,31] or by locking the amide into a ring.[22,28,29] With this guiding concept, we
hypothesized that the DHBF-7-carboxamide (3) would establish
an intramolecular hydrogen bond leading to the formation of a 6:5:6
pseudotricyclic ring system with improved potency.
Chart 1
PARP Inhibitors Currently
Being Evaluated in the Clinic
Similar to other PARP-1 inhibitors, docking of DHBF-7-carboxamide
(compound 3) within the catalytic site of humanPARP-1
(PDBcode 4L6S)[32] (Figure 1) revealed that the carbonyl oxygen atom formed
a hydrogen bond with the side chain hydroxyl group of Ser904 (C=O···HO-Ser904,
1.91 Å) and backbone −NH of Gly863 (C=O···HN-Gly863,
2.09 Å) while the carboxamidehydrogen atom entered into hydrogen
bonding interaction with the backbone carbonyl oxygen atom of Gly863
(NH···O=C-Gly863, 1.92 Å). We observed
formation of an intramolecular hydrogen bond between the carboxamidehydrogen atoms and the ether oxygen atom of the DHBF-7-carboxamide
that results in the formation of pseudotricyclic ring and restriction
of the carboxamide moiety. The aromatic ring of DHBF was stabilized
through a π–π stacking interaction with the nearly
coplanar electron rich phenyl ring of Tyr907, as seen with other PARP-1
inhibitors. To further develop this lead series, we carried out SAR
analysis, stereochemical characterization, and small molecule and
macromolecular X-ray crystallographic analysis of the DHBF-7-carboxamide
and DHBF-3-one-7-carboxamide derivatives. Further biochemical evaluation
of PARP-1 activity and cytotoxicity analysis of BRCA2-deficient DT40 cells demonstrated the therapeutic potential of
these series as PARP-1 inhibitors.
Figure 1
XP-Glide predicted binding mode of compound 3 within
the active site of PARP-1, represented in ribbon form, with the interacting
amino acids represented as sticks and atoms colored according to the
following: carbon, beige; hydrogen, white; nitrogen, blue; oxygen,
red. The inhibitor is shown as ball and stick with the same color
scheme depicted above except that carbons are represented as orange.
Dotted red lines indicate intra- and intermolecular hydrogen bonding
interaction, whereas the dotted yellow lines indicate the distance
between the two atoms/groups/centroids in angstroms. The centroids
are marked as green stars. The image was generated using PyMOL, version
1.6.0.
XP-Glide predicted binding mode of compound 3 within
the active site of PARP-1, represented in ribbon form, with the interacting
amino acids represented as sticks and atoms colored according to the
following: carbon, beige; hydrogen, white; nitrogen, blue; oxygen,
red. The inhibitor is shown as ball and stick with the same color
scheme depicted above except that carbons are represented as orange.
Dotted red lines indicate intra- and intermolecular hydrogen bonding
interaction, whereas the dotted yellow lines indicate the distance
between the two atoms/groups/centroids in angstroms. The centroids
are marked as green stars. The image was generated using PyMOL, version
1.6.0.
Synthesis
Dihydrobenzofuran
derivatives were synthesized
in good yields with diminutive variations in reported procedures.[33−36] The carboxylation at the 7-position of the 2,3-dihydrobenzofuran
(DHBF, compound 1) was achieved by lithiation with n-butyllithium (n-BuLi) in TEMED/hexane
at room temperature under nitrogen atmosphere, followed by addition
of dry ice and acidification with concentrated HCl[33] (Scheme 1). The resultant carboxylic
acid derivative 2 was converted to the carboxamide via
a mixed-anhydride method to get the lead compound 3.
Bromination of 3 using a solution of bromine in acetic
acid at elevated temperature of 80 °C provided compound 4.[34] Nitration[33] of 3 with nitric acid and trifluoroacetic
acid at low temperature yielded 5 in good yield. The
nitro group of 5 was further reduced to amine using tin
chloride dihydrate in ethyl acetate under refluxing conditions to
yield compound 6.
Scheme 1
Synthesis of 5-Substituted 2,3-Dihydrobenzofuran-7-carboxamide
Derivatives
Reagents and conditions: (a)
(i) n-BuLi, TEMED, hexane, rt, 4 h; (ii) dry ice,
overnight; conc HCl; (b) (i) i-BuOCOCl, NMM, THF,
−20 °C, 4 h; (ii) 30% NH4OH, rt, 1 h; (c) Br2, CH3COONa, CH3COOH, 80 °C, 3 h;
(d) TFA, HNO3, 0 °C to rt, 3 h; (e) SnCl2·2H2O, EtOAc, reflux, 4 h; (f) H2SO4, MeOH, reflux, 3 h.
Synthesis of 5-Substituted 2,3-Dihydrobenzofuran-7-carboxamide
Derivatives
Reagents and conditions: (a)
(i) n-BuLi, TEMED, hexane, rt, 4 h; (ii) dry ice,
overnight; concHCl; (b) (i) i-BuOCOCl, NMM, THF,
−20 °C, 4 h; (ii) 30% NH4OH, rt, 1 h; (c) Br2, CH3COONa, CH3COOH, 80 °C, 3 h;
(d) TFA, HNO3, 0 °C to rt, 3 h; (e) SnCl2·2H2O, EtOAc, reflux, 4 h; (f) H2SO4, MeOH, reflux, 3 h.In order to modify
the 2-position of DHBF, we used an alternative
synthetic route to synthesize the 2-substituted and the 2,5-disubstituted
DHBF-7-carboxamide derivatives from the corresponding salicylic acid
derivatives to avoid the low yielding carboxylation step in the later
stages of the synthetic protocol. First, the salicylic acid derivatives
were converted to corresponding methyl esters using thionyl chloride
in the presence of methanol (Scheme 2). This
was followed by O-allylation, carried out using allyl bromide and
potassium carbonate, to yield compounds 9a–c. The 3,3-sigmatropicClaisen rearrangement was carried out
by heating compounds 9a–c neatly
at elevated temperatures to yield ortho-rearranged products 10a–c.[35] The
furan ring was constructed by reacting the rearranged product with
zirconium chloride in dichloromethane to yield the corresponding methyl
2-methyl-DHBF-7-carboxylate derivatives 11a–c.[36] Hydrolysis of the methyl ester
using sodium hydroxide provided corresponding acids 12a–c that were converted to carboxamides 13a–c under mixed anhydrideconditions
and aqueous ammonia (as discussed above). Nitration of compound 13a (where R = H) followed by reduction was carried out essentially
as discussed above to obtain 14 and 15,
respectively.
Scheme 2
Synthesis of 2,5-Disubstituted 2,3-Dihydrobenzofuran-7-carboxamides
Reagents and conditions: (a)
SOCl2, MeOH, reflux, 12 h; (b) allyl bromide, K2CO3, NaI, DMF, rt, 12 h; (c) neat, 160–190 °C,
2 h; (d) ZrCl4, DCM, rt, 10 h; (e) NaOH, MeOH, reflux,
2 h; (f) (i) i-BuOCOCl, NMM, THF, −20 °C,
4 h; (ii) 30% NH4OH, rt, 1 h; (g) when R = H, TFA, HNO3, 0 °C to rt, 3 h; (h) SnCl2·2H2O, EtOAc, reflux, 4 h.
Synthesis of 2,5-Disubstituted 2,3-Dihydrobenzofuran-7-carboxamides
Reagents and conditions: (a)
SOCl2, MeOH, reflux, 12 h; (b) allyl bromide, K2CO3, NaI, DMF, rt, 12 h; (c) neat, 160–190 °C,
2 h; (d) ZrCl4, DCM, rt, 10 h; (e) NaOH, MeOH, reflux,
2 h; (f) (i) i-BuOCOCl, NMM, THF, −20 °C,
4 h; (ii) 30% NH4OH, rt, 1 h; (g) when R = H, TFA, HNO3, 0 °C to rt, 3 h; (h) SnCl2·2H2O, EtOAc, reflux, 4 h.Since the enantiomers
bind differently within the active site,
one of the enantiomers is presumed to be more potent when compared
to the other. Therefore, we decided to resolve the 2-position enantiomers
resulted during the construction of DHBF ring and evaluate the activity
of the pure enantiomers. The 2-position enantiomers (compounds (+)-13a, (−)-13a, (+)-13c, and
(−)-13c) were resolved by preparative chiral HPLC,
using an amylose based chiral stationary phase Chiralpak 1A (4.6 mm
× 250 mm) at GVK Biosciences Pvt. Ltd., Hyderabad, India. To
determine the absolute configuration at the 2-position of the representative
eutomer, the X-ray crystal structure of 12a was elucidated
using the diastereomericsalt formation approach.[37−40] The absolute configuration from
direct determination based on anomalous scattering from the light
atoms was in agreement with the starting materials. On the basis of
the analysis of the crystals of (−)-enantiomer of 12a with (S)-(−)-α-methylbenzylamine,
it was revealed that the (−)-enantiomer bears the R-configuration (Figure 2). On the basis of
this finding, the (+)-enantiomer was assigned as the S-enantiomer.
Figure 2
ORTEP diagram of salt of (R)-(−)-12a with (S)-(−)-α-methylbenzylamine.
ORTEP diagram of salt of (R)-(−)-12a with (S)-(−)-α-methylbenzylamine.To synthesize the 5-fluoro derivative
of the DHBF-7-carboxamide,
we first attempted to launch the 5-fluoro substituent by a reported
method[41] in which nitration at the 5-position
of the DHBF was carried out (as mentioned previously), followed by
its reduction using a Pd/Ccatalyst, to yield 5-amino-DHBFcompound 18a (Scheme 3). The diazonium tetrafluoroborate
salt of 18a was prepared by adding aqueous sodium nitrite
solution into a mixture of 5-amino-DHBF, hydrochloric acid, and tetrafluoroboric
acid in THF at −15 °C. The resulting precipitates were
refluxed in xylene to obtain 5-fluoro-DHBFcompound 19a. Unfortunately, the lithiation-mediated 7-carboxylation of compound 19a did not yield the desired compound (5-fluoro-DHBF-7-carboxylic
acid, 19b). An alternative strategy was applied in which
we used DHBF-7-carboxylic acid 2 as a starting material
instead of DHBF to elude the low yielding carboxylation step. The
5-position nitration followed by reduction was performed by the same
procedure described for compound 18a to yield 18b. Attempts to replace the amino group of compound 18b with a fluoro group (by the aforementioned method) yielded 5-fluoro-DHBF-7-carboxylic
acid (compound 19b) in a very low yield. To overcome
this, compound 2 was first converted to the corresponding
methyl ester 16 by refluxing it in methanol and a catalytic
amount of sulfuric acid as shown in Scheme 1. Subsequent nitration at the 5-position of 16 followed
by hydrogenation (as mentioned above) yielded methyl 5-amino-DHBF-7-carboxylate 18c in good yield which was fluorinated using the aforementioned
procedure to get the desired compound 19c in good yield.
Compound 19c was hydrolyzed to yield 19b, which was then converted to carboxamide using the mixed-anhydridecondition to obtain the desired product 20 (Scheme 3).
Scheme 3
Synthesis of 5-Fluoro-2,3-dihydrobenzofuran-7-carboxamide
Reagents and conditions: (a)
TFA, HNO3, 0 °C to rt, 3 h; (b) H2/Pd/C,
EtOH, 60 psi, rt, 2–18 h; (c) (i) THF, HCl, HBF4, rt to −15 °C, NaNO2, 30 min; (ii) xylene,
reflux, 2 h; (d) R=H, (i) n-BuLi, TEMED, hexane,
rt, 4 h; (ii) dry ice, overnight; (e) when R = -COOCH3;
NaOH, MeOH, reflux, 3 h; (f) (i) i-BuOCOCl, NMM,
THF, −20 °C, 4 h; (ii) 30% NH4OH, rt, 1 h.
Synthesis of 5-Fluoro-2,3-dihydrobenzofuran-7-carboxamide
Reagents and conditions: (a)
TFA, HNO3, 0 °C to rt, 3 h; (b) H2/Pd/C,
EtOH, 60 psi, rt, 2–18 h; (c) (i) THF, HCl, HBF4, rt to −15 °C, NaNO2, 30 min; (ii) xylene,
reflux, 2 h; (d) R=H, (i) n-BuLi, TEMED, hexane,
rt, 4 h; (ii) dry ice, overnight; (e) when R = -COOCH3;
NaOH, MeOH, reflux, 3 h; (f) (i) i-BuOCOCl, NMM,
THF, −20 °C, 4 h; (ii) 30% NH4OH, rt, 1 h.The 4-amino-2-methyl-DHBF-7-carboxamide 28 was synthesized
using the 4-nitrosalicylic acid 21 as the precursor,
since the direct electrophilic substitution onto the DHBF-7-carboxamide
ring favored the 5-position and attempts to use 4-aminosalicylic acidmethyl ester as the starting material yielded mono-N- and di-N-allylated
methyl ester derivatives in the allylation step (data not shown).
The nitro group in compound 21 acted as a surrogate,
which was reduced to an amino group in the latter steps of the synthetic
scheme. The ring construction was accomplished as outlined in Scheme 4. The esterification of the acid 21 was accomplished by the aforementioned method wherein the acid was
refluxed in the presence of thionyl chloride and methanol. The resulting
ester 22 was allylated onto the phenolichydroxyl with
allyl bromide utilizing the conditions mentioned previously. The 3,3-sigmatropicClaisen rearrangement of the allyl derivative 23 was
performed using carbitol as a solvent, since the aforementioned procedure
of neat heating of the compound above 160 °C yielded the rearranged
product 24 in a very low yield. Cyclization of the rearranged
nitro analogue followed by hydrolysis did not yield the desired nitro
acid (NiAc) derivative (Scheme 4). We therefore
decided to change the synthetic plan by reducing the nitro group of 25 to an amine (compound 26) followed by hydrolysis
using sodium hydroxide, yielding acid intermediate 27. The resulting acid 27 was converted to carboxamide 28 by modified mixed-anhydrideconditions for carboxamide
synthesis, wherein N-methylmorpholine was added first
followed by isobutyl chloroformate to prevent the N-acylation. The
anhydride, once formed, was quickly treated with dry ammonia gas,
resulting in the formation of the target carboxamide rac-28 (Scheme 4). The rac-28 was resolved by means of preparative chiral chromatography
similar to the method developed for racemates 13a and 13c.
Scheme 4
Synthesis of 4-Amino-2-methyl-2,3-dihydrobenzofuran-7-carboxamide
Synthesis of 4-Amino-2-methyl-2,3-dihydrobenzofuran-7-carboxamide
Reagents and conditions: (a)
SOCl2, MeOH, reflux, 12 h; (b) allyl bromide, K2CO3, NaI, DMF, rt, 12 h; (c) carbitol, 170–180
°C, 2 h; (d) ZrCl4, DCM, rt, 10 h; (e) NaOH, MeOH,
reflux; (f) H2/Pd/C, EtOH, 60 psi, rt, 4 h; (g) NaOH, MeOH,
reflux, 18 h; (h) (i) NMM, i-BuOCOCl, THF, −20
°C, 20 min; (ii) dry NH3, rt, 45 min.A successful synthesis of DHBF-3-one-7-carboxamide (compound 36) (Scheme 5) was carried out after
trying two unsuccessful strategies, which involved (i) carboxylation
of DHBF-3-one and (ii) oxidation of 7-methyl group of 7-methyl-DHBF-3-one,
none of which yielded the desired penultimate intermediate DHBF-3-one-7-carboxylic
acid 35. Finally, in order to resolve the issue of ring
oxidation, which occurred in the latter case, we decided to oxidize
the aromatic methyl group prior to the ring construction. This was
met by first esterifying 3-methylsalicylic acid to obtain 30 followed by O-alkylation with ethyl bromoacetate to yield diester
intermediate 31, which was then hydrolyzed to yield the
diacid derivative 32 and was further oxidized to 2-(carboxymethoxy)isophthalic
acid (compound 33). Cyclization of 33 to
3-acetoxybenzofuran-7-carboxylic acid (34) was accomplished
by treating 33 with the 1:3:5[42] proportions of sodium acetate, acetic acid, and acetic anhydride,
respectively, under refluxing conditions. The resulting compound was
hydrolyzed using a mixture of 1:10:40 [42] proportions of hydrochloric acid (11 N)/water/methanol, generating
a 3-oxo derivative 35. The resulting acid was finally
converted to an amide 36 by the aforementioned mixed-anhydride
technique.
Scheme 5
Synthesis of 3-Oxo-2,3-dihydrobenzofuran-7-carboxamide
Synthesis of 3-Oxo-2,3-dihydrobenzofuran-7-carboxamide
Reagents and conditions: (a)
SOCl2, MeOH, reflux, 12 h; (b) BrCH2COOEt, K2CO3, NaI, DMF, rt, 12 h; (c) KOH, MeOH, reflux,
4 h; (d) KMnO4, water, reflux, 2 h; (e) NaOAc, (CH3CO)2O, CH3COOH, reflux, 5 h; (f) HCl
(11 N)/H2O/MeOH, reflux, 1 h; (g) (i) i-BuOCOCl, NMM, THF, −20 °C, 4 h; (ii) 30% NH4OH, rt, 1 h.The benzaldehydes required for
the synthesis of target compounds 50–71 were either commercially available
or prepared (37–49) as shown in Schemes 6 and 7. The 3- or 4-hydroxybenzaldehydes
were alkylated with commercially available 2-chloroethylmorpholine/piperidine
in the presence of potassium carbonate under refluxing conditions
to obtain 37–40 (Scheme 6). The 4-(2-chloroethoxy)benzaldehyde 41 was synthesized by reacting 4-hydroxybenzaldehyde with bromochloroethane
in the presence of potassium carbonate and refluxing acetonitrile.
Compound 41 was then reacted with N-methylpiperazine
to yield the desired benzaldehyde 42 (Scheme 6). Benzaldehyde derivative 43 was prepared
similar to that of 41 using bromochloropropane instead
of bromochloroethane (Scheme 7). Compound 43 was then treated with morpholine to obtain the desired
aldehyde intermediate 44. The acyl derivative 46 was synthesized by performing diminutive variations in the reported
conditions (Scheme 7).[43,44] First, the morpholine was reacted with chloroacetyl chloride in
the presence of triethylamine in dichoromethane at 0 °C, which
generated N-2-chloroacetylmorpholine (45). Compound 45 was then treated with 4-hydroxybenzaldehyde
by following the aforementioned alkylation technique (using potassium
carbonate as a base) to yield 46. The aldehyde 47 was synthesized by alkylating 4-hydroxybenzaldehyde with
epibromhydrin under alkylation conditions (Scheme 7). Compound 48 was synthesized by epoxide ring-opening,
which was mediated by nucleophilic attack of morpholine onto the electropositive
methylene group of the epoxide ring of 47 (Scheme 7). Compound 49 was synthesized by alkylating
commercially available 1-(4-fluorophenyl)piperazine with compound 41 using potassium carbonate as a base (Scheme 7).
Scheme 6
Synthesis of Substituted Benzaldehydes 37–40 and 42
Reagents
and conditions: (a)
K2CO3, 4-(2-chloroethyl)morpholine (for compounds 37 and 39) and 4-(2-chloroethyl)piperidine (for
compounds 38 and 40), CH3CN,
reflux, 6 h; (b) K2CO3, KI, bromochloroethane,
CH3CN, reflux, 12 h; (c) K2CO3, KI, N-methylpiperazine, CH3CN, reflux, 2–6
h.
Scheme 7
Synthesis of Substituted Benzaldehydes 44 and 46–49
Synthesis of Substituted Benzaldehydes 37–40 and 42
Reagents
and conditions: (a)
K2CO3, 4-(2-chloroethyl)morpholine (for compounds 37 and 39) and 4-(2-chloroethyl)piperidine (for
compounds 38 and 40), CH3CN,
reflux, 6 h; (b) K2CO3, KI, bromochloroethane,
CH3CN, reflux, 12 h; (c) K2CO3, KI, N-methylpiperazine, CH3CN, reflux, 2–6
h.
Synthesis of Substituted Benzaldehydes 44 and 46–49
Reagents and conditions: (a)
K2CO3, bromochloropropane, CH3CN,
reflux, 3 h; (b) K2CO3, morpholine, CH3CN, reflux, 6 h; (c) chloroacetyl chloride, DCM, triethylamine, 0
°C to rt, 3 h; (d) K2CO3, 4-hydroxybenzaldehyde,
CH3CN, reflux, 6 h; (e) epibromhydrin, K2CO3, CH3CN, reflux, 6 h; (f) morpholine, K2CO3, CH3CN, reflux, 6 h; (g) 4-fluorophenylpiperazine,
K2CO3, CH3CN, reflux, 48 h.Knoevenagel condensation[45] of compound 36 with various commercially available
and in house synthesized
benzaldehyde derivatives under refluxing toluene in the presence of
ammonium acetate yielded target compounds 50–73, which were finally washed with water (to remove excess
of ammonium acetatecatalyst), dried, and obtained in moderate yields
as shown in Scheme 8.
Scheme 8
Synthesis of Target
Compounds 50–73
Reagents and conditions: (a)
NH4OAc, commercially available/synthesized R-CHO, toluene,
reflux, 1–24 h.
Synthesis of Target
Compounds 50–73
Reagents and conditions: (a)
NH4OAc, commercially available/synthesized R-CHO, toluene,
reflux, 1–24 h.The benzaldehydes required
for making the target sulfonamide analogues 72 and 73 were synthesized by reacting 72a (obtained
by reducing 4-nitrobenzaldehyde using tin chloride
dihydrate in ethyl acetate) with chloroethanesulfonyl chloride (to
obtain compound 72b) and chloropropanesulfonyl chloride
(to obtain compound 72c) at 0 °C in the presence
of triethylamine in dichloromethane. The resulting benzaldehydes 72b and 72c were then reacted with N-methylpiperazine to yield intermediates 72d and 72e, respectively (Scheme 9).
Scheme 9
Synthesis
of Substituted Benzaldehyde Intermediates 72d and 72e Required for Respective Synthesis of Target
Compounds 72 and 73
Reagents
and conditions: (a)
SnCl2·2H2O, ethyl acetate, reflux, 4 h;
(b) chloroethanesulfonyl chloride (for compound 72b)
or chloropropanesulfonyl chloride (for compound 72c),
DCM, triethylamine, 0 °C to rt, 6 h; (c) N-methylpiperazine,
K2CO3, CH3CN, reflux, 6 h.
Synthesis
of Substituted Benzaldehyde Intermediates 72d and 72e Required for Respective Synthesis of Target
Compounds 72 and 73
Reagents
and conditions: (a)
SnCl2·2H2O, ethyl acetate, reflux, 4 h;
(b) chloroethanesulfonyl chloride (for compound 72b)
or chloropropanesulfonyl chloride (for compound 72c),
DCM, triethylamine, 0 °C to rt, 6 h; (c) N-methylpiperazine,
K2CO3, CH3CN, reflux, 6 h.
Structure–Activity Relationship
All synthesized
analogues were evaluated for PARP-1 inhibitory activity. The clinical
candidates, veliparib (ABT-888) and olaparib (AZD-2281), were used
as reference standards in the PARP-1 enzyme inhibitory assay. Our
initial lead compound 3 demonstrated moderate activity
with an IC50 value of 9.45 μM (Table 1). From the docking model of 3 into the PARP-1
active site (Figure 1), it was observed that
the carboxamide group undergoes the aforementioned interactions with
Gly863 (NH···O=C-Gly863, 1.92 Å; C=O···HN-Gly863,
2.09 Å) and Ser904 (C=O···HO-Ser904, 1.91
Å), and the aromatic ring was stabilized through π–π
stacking interaction with the nearly coplanar electron rich phenyl
ring of Tyr907 (centroidligand–centroidTyr907 = 4.3 Å, Figure 1). Initially, we synthesized
derivatives of 3 modified at the synthetically feasible
5-position. Substitution with bromo, nitro, and amino at the 5-position
of 3 yielded compounds 4, 5, and 6, which were concluded to be inactive with IC50 values above 25 μM. Because of the unfavorable contribution
of substituents at the 5-position of 3, we next focused
onto the 2-position of the 2,3-DHBF scaffold. To probe the 2-position
of 3, we followed a new synthetic route as depicted in
Scheme 2. The 2-methyl analogue rac-13a was obtained in racemic form and showed an IC50 value of 10.44 μM. Compound rac-13a offered an opportunity to investigate PARP-1 inhibitory
activity of each enantiomer. The rac-13a was resolved into pure enantiomers by preparative chiral chromatography
(GVK Biosciences Pvt. Ltd., India). Both (R)-(−)
and (S)-(+) isomers of 13a exhibited
comparable IC50 values (6.34 and 8.44 μM, respectively).
The 5-methyl, 5-nitro, and 5-amino derivatives (compounds 13b, 14, and 15, respectively) proved to be
inactive, similar to the earlier series of compounds (4, 5, and 6). Collectively, this indicates
that the active site region around the 5-position of the DHBF scaffold
bears steric restrictions (e.g., compounds 13a vs 13b, Table 1).
Table 1
Structures
and PARP-1 Inhibition Data
for the Synthesized Compounds 3–28
compd
R1
R2
R3
IC50 (μM)b
3
-H
-H
-H
9.45 ± 0.25
4
-Br
-H
-H
>25
5
-NO2
-H
-H
>25
6
-NH2
-H
-H
>25
rac-13a
-H
-CH3
-H
10.44 ± 0.96
(−)-13a
-H
-CH3
-H
6.34 ± 1.08
(+)-13a
-H
-CH3
-H
8.44 ± 1.05
13b
-CH3
-CH3
-H
>25
rac-13c
-F
-CH3
-H
2.45 ± 0.65
(−)-13c
-F
-CH3
-H
1.53 ± 0.12
(+)-13c
-F
-CH3
-H
3.62 ± 0.76
14
-NO2
-CH3
-H
>25
15
-NH2
-CH3
-H
>25
20
-F
-H
-H
2.12 ± 0.37
rac-28
-H
-CH3
-NH2
4.65 ± 0.25
281a
-H
-CH3
-NH2
2.43 ± 0.42
282a
-H
-CH3
-NH2
5.33 ± 0.16
ILCc
6.80 ± 0.57
ABT-888c
0.006 ± 0.001
AZD-2281c
0.007 ± 0.001
28 and 28 represent
the resolved enantiomers of the racemate 28 by chiral
HPLC technique.
IC50 values were determined
by at least two independent experiments done in triplicate.
Indazole lead compound (ILC) reported
in ref (21) and clinical
candidates ABT-888 and AZD-2281 were included as reference standards
for comparative purposes.
28 and 28 represent
the resolved enantiomers of the racemate 28 by chiral
HPLC technique.IC50 values were determined
by at least two independent experiments done in triplicate.Indazole lead compound (ILC) reported
in ref (21) and clinical
candidates ABT-888 and AZD-2281 were included as reference standards
for comparative purposes.Examination of previous X-ray crystallography data revealed that
small substituents, e.g., fluoro, are well tolerated at the 6-position
(5-position equivalent in the DHBF scaffold) of the benzimidazole-4-carboxamide
scaffold.[12] Similarly, addition of a fluoro
group at the 5-position of 2H-indazole-7-carboxamide[46] and at the 8-position of 1,3,4,5-tetrahydrobenzonaphthyridin-6-one[47] (analogous to the 5-position in the DHBF scaffold)
showed 2- to 3-fold improvement in activity. To obtain the 5-fluoro
substituted derivative of compound 3 (5-fluoro-DHBF-7-carboxamide,
compound 20), we developed a new synthetic route (Scheme 3). As expected from the previous finding, the 5-fluoro
derivative 20 (IC50 = 2.12 μM) was found
to be ∼5-fold more potent than our initial lead 3 (Table 1). To examine the effect of the 5-fluoro
substitution on 2-methyl-DHBF-7-carboxamide (13a), we
synthesized rac-13c (IC50 = 2.45 μM) and found it to be 4-fold more potent than 13a. The compound rac-13c was
resolved and enantiomers were evaluated in vitro for PARP-1 inhibition.
The (+)-13c enantiomer had an
IC50 value of 3.62 μM, whereas (−)-13c exhibited an IC50 value of 1.53 μM. The electron
deficit phenyl ring of compound (−)-13c (contributed
to by the electronegative nature of the fluorine group) was predicted
to generate a stronger π–π stacking interaction
with the phenyl ring of Tyr907compared to the unsubstituted analogue 13a (Table 1).To further develop
this scaffold, we obtained cocrystal structure
data of (−)-13c bound to the catalytic domain
of PARP (Figure 3E). From this structure it
appeared the 4-position of (−)-13c was in proximity
to the γ-carboxylate group of Glu988 (an essential residue involved
in PAR synthesis). Therefore, we chose to synthesize the 4-amino derivative rac-28 to capture electrostatic interactions
with the carboxylate group of Glu988. The 4-amino-2-methyl-DHBF-7-carboxamide rac-28 (IC50 = 4.65 μM) had
a 2-fold increase in inhibition over rac-13a, thus underscoring the positive role of the 4-amino group. Chiral
resolution of this racemate yielded individual enantiomers (compounds 28 and 28) that were discriminated by enzymatic activity as
evident from their respective IC50 values of 2.43 and 5.33
μM (Table 1).
Figure 3
Crystal structure of
inhibitors in the active site of PARP-1. (A)
Structural representation of the PARP-1 activated complex, which highlights
the NAD+ binding site (active site) where most PARP inhibitors
bind. (B–D) Fo – Fc electron density difference map (blue mesh)
of PARP-1 crystals soaked with 1–5 mM (−)-13c, 59, or 65 (PBD code 4OPX, 4OQA, or 4OQB, respectively),
contoured to 2.5σ in which density is calculated in the absence
of ligand. (E–G) Compounds bound to the NAD+ site
of PARP-1 make π–π stacking interactions between
Tyr907 and Tyr896 and H-bond interactions with the backbone of Gly863
and Ser904 consistent with the traditional benzamide pharmacophore
of most PARP inhibitors. Compounds 59 and 65 extend out of the nicotinamide pocket and make further interactions
in the ADP-ribose pocket of the NAD+ binding site.
Crystal structure of
inhibitors in the active site of PARP-1. (A)
Structural representation of the PARP-1 activated complex, which highlights
the NAD+ binding site (active site) where most PARP inhibitors
bind. (B–D) Fo – Fc electron density difference map (blue mesh)
of PARP-1crystals soaked with 1–5 mM (−)-13c, 59, or 65 (PBD code 4OPX, 4OQA, or 4OQB, respectively),
contoured to 2.5σ in which density is calculated in the absence
of ligand. (E–G) Compounds bound to the NAD+ site
of PARP-1 make π–π stacking interactions between
Tyr907 and Tyr896 and H-bond interactions with the backbone of Gly863
and Ser904consistent with the traditional benzamide pharmacophore
of most PARP inhibitors. Compounds 59 and 65 extend out of the nicotinamide pocket and make further interactions
in the ADP-ribose pocket of the NAD+ binding site.Extensive analysis of the substituent
effect onto the 2-, 4- and
5-positions of the DHBF-7-carboxamidecore revealed that the 2-position
was the most promising site for various substitutions owing to the
steric restriction at the 5-position of DHBF-7-carboxamide. Cocrystal
structure data (Figure 3E) revealed an empty
pocket adjacent to the 2-position of the DHBF scaffold, which could
likely tolerate large substitutions. Since substitution at the 2-position
of the DHBF scaffold presented significant syntheticchallenges, we
proposed an alternative core, DHBF-3-one-7-carboxamide (compound 36, IC50 = 16.2 μM, Table 2), which is analogous to the DHBF-7-carboxamide with a robust
synthetic advantage of presenting an electrophilic 2-position (being
connected to the carbonyl group on one side and ethereal oxygen atom
on the other side) amenable to Knoevenagel condensation with benzaldehydes.
Knoevenagel condensation of compound 36 with substituted
benzaldehydes resulted in the desired 2-position substituted compounds
(Table 2). The exocyclic double bond of the
benzylidene group in these target compounds (Table 2) is stereogenic; however, it has previously been reported
that condensation at the 2-position of DHBF-3-one with different aldehydes
yields the Z-isomer.[42,48] In agreement
with literature NMR reports, the olefinic β-proton in these
compounds was found to be around 7.03 ppm, which indicates the formation
of the Z-isomer (calculated chemical shift for the
same proton of the E-isomer was found to be ∼6.19
ppm).
Table 2
Structures and PARP-1 Inhibition Data
for Target Compounds 36 and 50–73
IC50 values were determined
by at least two independent experiments done in triplicate.
Indazole lead compound (ILC) reported
in ref (21) and clinical
candidates ABT-888 and AZD-2281 were included as reference standards
for comparative purposes.
IC50 values were determined
by at least two independent experiments done in triplicate.Indazole lead compound (ILC) reported
in ref (21) and clinical
candidates ABT-888 and AZD-2281 were included as reference standards
for comparative purposes.In order to study the stericcompliance at the 2-position of the
DHBF-3-one-7-carboxamide scaffold, initial compounds probed the active
site pocket by substituting hydrophobic groups such as phenyl (compound 50), 3-phenoxyphenyl (compound 51), and p-chlorophenyl (compound 52). PARP-1 inhibitory
data of this series revealed that extensive hydrophobic substitution
at the 2-position marginally improved potency (IC50 values
of 12.02, 4.65, and 6.09 μM, respectively; Table 2). However, the added hydrophobicity contributed by these
substitutions inevitably increased the magnitude of log P, diminishing the druglike properties of the molecules.
Structural data revealed that the benzylidene ring of the DHBF-3-one-7-carboxamide
scaffold was located in proximity to polar side groups, namely, Glu763,
Asp766, and Tyr889 (Figure 3F). This indicated
that the polar substituents on the benzylidene ring could in turn
favor PARP-1 inhibition. With this hypothesis, we aimed at synthesizing
analogues bearing polar groups on the benzylidene ring. Compound 53 with a vanillyl (4′-hydroxy-3′-methoxyphenyl)
group was found to exhibit an IC50 value of 3.62 μM
(Table 2). The moderate inhibition by compound 54 (IC50 = 3.30 μM) also suggested that substitutions
made onto the 4′-position of the benzylidene ring were well
tolerated. Structural data suggested that a nearby vacant pocket was
likely accessible from the 4′-position of the benzylidene ring,
without any potential for a stericclash (Figure 3F). In order to further delineate the contribution of the
hydroxyl group at each position of the benzylidene moiety, we synthesized
analogues bearing hydroxyl groups at 2′-position (55), 3′-position (56), and 4′-position (57). Among them, 56 and 57 were
found to have improved potency with IC50 values of 2.14
and 0.813 μM, respectively (Table 2).
Poor inhibition of PARP-1 by compound 55 also corroborated
the importance of 4′-position substitution onto the benzylidene
ring. This further suggested that the hydroxyl group at the 4′-position
of the benzylidene ring is important to increase potency. We also
synthesized dihydroxy substituted analogues, bearing hydroxyl groups
at the 3′-position and either the 4′- (compound 58) or 5′-position (compound 60). Among
the dihydroxy analogues (compounds 58, 59, 60, and 61), compound 58 bearing 3′,4′-dihydroxy substitution and compound 59 with 2′,4′-dihydroxy groups demonstrated
IC50 values of 0.531 and 0.753 μM, respectively.
Structural data of 59-PARP-1 revealed that the 4′-hydroxyl
group substituted onto the benzylidene ring was directed toward the
side chain of Asp766 (Figure 3F). In addition,
methylation of the 4′-hydroxyl group of compound 57 led to compound 54 which showed 4-fold reduced inhibitory
activity. Collectively, these data clearly underline that polar hydroxyl
groups at the 4′-position are beneficial for PARP-1 inhibition.
Interestingly, poor inhibition by compounds 60 and 61 indicated that neither the 3′-position nor 5′-position
was a significant substituent position for PARP-1 inhibition.According to the structural data, the 4′-hydroxyl group
of compound 59 was found to point toward the vacant hydrophilic
pocket formed by the side chains of Asp766, Asn767, Asp770, Ser864,
Asn868, and Arg878 (Figure 3F). With an intention
to extend substitutions into this pocket, we decided to attach a basicnitrogen heterocycle at this position, wherein the hydroxyl group
would act as a good handle for synthetic feasibility. Toward this
end, we synthesized an analogue bearing piperidine (compound 64) linked to the 4′-position of 57 by
an ethyl linker. Our next strategy was aimed at incorporation of an
electronegative oxygen atom at the C4-position of the piperidine
ring, which involved replacing the piperidine ring (64) with a morpholine (65). However, this approach did
not lead to the desired result, since compound 65 (IC50 = 2.07 μM) was found to be 4-fold less potent compared
to 64 (IC50 = 0.544 μM). However, a
potential interaction between the morpholine ring oxygen atom and
the side chain of Arg878 was suggested by studying the X-ray cocrystal
structure of compound 65 bound to the catalytic domain
in the PARP-1 (Figure 3G). In the case of 66 (IC50 = 0.114 μM), the electron rich N-methylpiperazine ring was observed to be in proximity
to the side chain of Arg878 based on molecular docking (Figure 4A). Further, the terminal nitrogen atom of the piperazine
moiety was predicted to undergo an electrostatic interaction with
the side chain carboxyl group of Asp770 (NH+···–OOC-Asp770, 1.89 Å). These data hinted toward
a favorable role of basic groups at the 4′-substitued saturated
heterocycles (Figure 4A). Additionally, we
wanted to test if the above substituents at the 3′-position
of the benzylidene ring could also bind favorably to this hydrophilic
pocket. This was experimentally verified by synthesizing analogues
bearing a morpholine ring (compound 62) or piperidine
ring (compound 63) linked by an ethyl linker to the 3′-position
of compound 56. However, substitution at the 3′-position
was found to be detrimental for PARP-1 inhibition (compounds 62 and 63 vs 64 and 65, respectively).
Figure 4
Predicted binding mode of compounds 66 (A)
and 72 (B) within the active site of PARP-1. The color
scheme
for the active site amino acid residues and the inhibitor is the same
as in Figure 1. The centroids are generated
as green stars. The yellow dotted lines indicate the distance between
the two atoms/groups/centroids (in angstroms). The image was generated
in PyMOL, version 1.6.0.
Predicted binding mode of compounds 66 (A)
and 72 (B) within the active site of PARP-1. The color
scheme
for the active site amino acid residues and the inhibitor is the same
as in Figure 1. The centroids are generated
as green stars. The yellow dotted lines indicate the distance between
the two atoms/groups/centroids (in angstroms). The image was generated
in PyMOL, version 1.6.0.Up to this point, we tested the efficacy of inhibitors bearing
ethyl linkers at different positions of benzylidene (compounds 62–66). In an attempt to evaluate the
effect of different linkers, we synthesized analogues 67, 68, and 70. With an intention to extend
the substitution deeper into the hydrophilic pocket, we extended the
linker by one carbon atom (compound 67) to bring the
oxygen of the morpholine ring in compound 65 closer to
the side chain of Arg878. Compound 67 was found to be
nearly 3 times more potent (IC50 = 0.718 μM) compared
to the corresponding ethyl analogue 65 (IC50 = 2.07 μM), likely owing to the stronger interaction with
the guanidine group of Arg878 (Table 2). In
order to increase the ligand–PARP-1 interactions, we aimed
to introduce polar groups onto the linker positions, with the potential
for interaction with the polar amino acid residues present in the
hydrophilic pocket. Introduction of a hydroxyl group onto the second
carbon atom of the propyl linker (compound 70) led to
a significant improvement in the potency with an IC50 of
0.176 μM. Another advantage of polar substitutions is that they
also improved the solubility properties of this compound. The replacement
of the ethyl group of compound 65 with the acetyl group
(compound 68) led to a 9-fold improvement in potency
(IC50 = 0.223 μM). This observation revealed that
polar groups incorporated onto the linker significantly improved potency.
In order to substantiate our hypothesis that substituted nitrogencontaining heterocycles play a significant role in PARP-1 inhibition,
we synthesized and tested a truncated analogue with an oxiranylmethoxy
moiety (compound 69, IC50 = 1.21 μM).
It did not completely lose potency owing to the contribution by polar
epoxide ring (Table 2).Several fragments
have been linked to nicotinamide mimicking pharmacophores
and are widely reported in the literature as significantly improving
PARP-1 inhibition.[49] In an attempt to check
the usefulness of one such fragment known to give significant inhibition,
we tested the impact of linking 1-(4-fluorophenyl)piperazine via ethyl
bridge at the 4′-position of the benzylidene moiety. This analogue
(compound 71) gave a significant inhibition with an IC50 value of 0.445 μM, demonstrating that our studies
correlate with literature reports.In an attempt to improve
the enzyme inhibitory activity of 66, we have successfully
replaced the ethoxy linker in 66 with ethanesulfonamide
(compound 72, IC50 = 0.079 μM) and propanesulfonamide
(compound 73, IC50 = 0.113 μM) linkers.
It was anticipated
that the sulfonamide groups will provide a sharp angle, mimic the
phosphate group of NAD+ (substrate of PARP), and place
the piperazine moiety deeper into the adenine-ribose binding pocket
of PARP-1 active site. Two of the most potent inhibitors 66 and 72 not only are water-soluble but also present
a group amenable for the preparation of pharmaceutical salts. Predicted
binding model of 72 within the active site of PARP-1
is shown in Figure 4B. In contrast to compound 66, compound 72 showed three additional hydrogen
bonds between the sulfonamide group and the side chains of Asp766,
Ser864, and Asn868. Similar to compound 66, sulfonamide
analogue 72 was able to reach the adenine-ribose binding
pocket, as evident from the docking studies (Figure 4B), wherein the N-methylpiperazine moiety
of 72 is in the vicinity of adenine-ribose binding residues
Asp770 and Arg878. Taken together, successful replacement of ethoxy
linker with ethanesulfonamide further showcases the potential of developing
highly active DHBF-3-one scaffold inhibitors.
Selective Killing of BRCA2-Deficient
Cells
Since catalyticPARP inhibition is known to induce synthetic lethality in BRCA1- or
BRCA2-deficient cells, we tested one of the potent inhibitors (compound 66) for sensitivity against wild-type, PARP-1-deficient, and
BRCA2-deficient DT40 cells. This compound was compared to veliparib,
a leading clinical PARP inhibitor with high potency. Consistent with
previous reports,[50] veliparib was not cytotoxic
in wild-type and PARP-1-deficient cells up to 10 μM, while it
was selectively cytotoxic in BRCA2-deficient cells with an IC90 of 5.0 μM (Figure 5A). Compound 66 also selectively killed BRCA2-deficient cells with an IC90 of 5.2 μM while being minimally cytotoxic in wild-type
and PARP-1-deficient cells (Figure 5B). The
weak cytotoxicity of compound 66 in wild-type and PARP-1-deficient
cells compared to veliparib suggests off-target effects beside PARP-1.
PARP inhibitors can have promiscuous inhibitory activity extending
to PARP-1–4 and tankyrases[25] and
can have PARP-1-independent cytotoxicity.[51,52] Hence, we conclude that compound 66 has similar cellular
potency as veliparib in BRCA2-deficient cells.
Figure 5
Cell viability of DT40
cells after continuous exposure to (A) veliparib
or (B) compound 66 for 72 h. Cellular ATP concentration
was used to measure cellular viability. The viability of untreated
cells was set as 100%. Error bars represent standard deviation (n = 3). Circle: wild-type cell. Triangle: PARP1-deficient
cells. Square: BRCA2-deficient cells. Invisible error bars are encompassed
within the symbol sizes.
Cell viability of DT40
cells after continuous exposure to (A) veliparib
or (B) compound 66 for 72 h. Cellular ATPconcentration
was used to measure cellular viability. The viability of untreated
cells was set as 100%. Error bars represent standard deviation (n = 3). Circle: wild-type cell. Triangle: PARP1-deficient
cells. Square: BRCA2-deficient cells. Invisible error bars are encompassed
within the symbol sizes.
Structural Studies
To further validate our SAR approach
and docking studies, we obtained crystal structure data of both scaffolds
bound to the recent structure of PARP-1 in complex with DNA (Figure 3A).[23] The diffraction
limit of these crystals restricts the level of detail obtained from
the PARP-1/compound complexes as a result of large multidomain protein;
however, the data allowed us to confidently model the major features
of their binding poses within the catalytic domain. Furthermore, we
obtained data with three compounds of various sizes but based on the
same scaffold, which helped confirm the placement of the inhibitors
(Figure 3A). Consistent with the docking studies,
the benzamide portion of the DHBF scaffold stacks between two tyrosine
residues and makes hydrogen bonding interactions with Gly863 and Ser904
(Figure 3E). Compound 59 appears
to reach outside of the traditional nicotinamide pocket with its benzylidene
modification to further interact with Tyr889 (Figure 3F). It is interesting to note that modification of the 5′-position
of the benzylidene ring would cause a stericclash with Tyr889, which
is consistent with the complete loss of potency observed with compounds
containing a 5′-position modification (60 and 61). Scaffolds with larger modifications reach deeper into
the adenine-ribose binding region of the active site, as seen with
compound 65 (Figure 3G). The observed
interaction of 65 with Arg878 is only speculative because
of the poor density in this region. However, the structures clearly
explain why the 4′-position modifications are superior in potency
compared to the 3′-position modifications, since the 3′-position
would lead to significant stericclash in the NAD+ binding
site.
Conclusions
A novel series of DHBF-7-carboxamide and
DHBF-3-one-7-carboxamide
derivatives were designed, synthesized, and evaluated for PARP-1 inhibition.
Substituents larger than fluorine at the 5-position of the DHBF scaffold
were found to be detrimental for PARP-1 inhibition. The 2-position
methyl substitution is well tolerated in the DHBF-7-carboxamide scaffold,
yielding enantiomers that bind differently in the active site. The
molecules were resolved and tested for PARP-1 inhibitory activity
concluding levorotatory analogues to be the eutomers ((−)-13a and (−)-13c). Synthesizing the DHBF-3-one-7-carboxamide
derivatives demonstrated an added advantage of an ease of substitution
at the electrophilic 2-position. An initial set of lead compounds 57, 58, and 59 revealed that substituting
the hydrophilic groups onto the 4′-position of the benzylidene
ring was important for potency. Alkylating the 4′-hydroxyl
group of compound 57 with the basic heterocycles linked
by a two-carbon spacer generated compounds 64 and 66 with significantly improved PARP-1 inhibitory activity.
Crystal structure determination confirmed that these compounds target
the nicotinamide binding pocket of the active site and reach out into
the adenine-ribose binding region, resulting in increased potency.
Extending the side chain on the 4′-position of the benzylidene
ring as well as modification of the linker proved to have a significant
effect on PARP-1 inhibition, as evident from the inhibition by compounds 67–71. Also, significant inhibition by 71 highlighted that our studies corroborated with literature
reports.[49] The replacement of ethoxy linker
in 66 with aminosulfonylethyl and aminosulfonylpropyl
linkers, respectively, resulted in improved inhibitors 72 and 73. Compound 66 was selectively active
in BRCA2-deficient cells and comparable to veliparib. Overall, compound 66 was identified as one of the potent compounds in the series
with an IC50 of 0.114 μM in an enzyme assay and an
IC90 of 5.2 μM against BRCA2-deficient DT40 cells.
Compounds 66 and 72 will serve as promising
leads for future SAR studies.
Experimental Section
Chemistry.
Synthesis: General
All chemicals and solvents
were purchased from Sigma–Aldrich (St. Louis, MO), AK Scientific
(Union City, CA), Oakwood Laboratories (West Columbia, SC), and Alfa
Aesar (Ward Mill, MA) and were used as received. The clinical candidates
ABT-888 and AZD-2281 were purchased from the Selleckchem library (Houston,
TX). Melting points were determined in open capillary tube on a Thomas-Hoover
capillary melting point apparatus and reported as uncorrected values. 1H NMR spectra were recorded on a Bruker AM-400 spectrometer.
Chemical shifts are reported as δ (ppm) relative to the tetramethylsilane
as an internal standard. Coupling constants (J) are
expressed in hertz (Hz). Proton peak multiplicity is reported as s
(singlet), d (doublet), t (triplet), q (quintet), sext (sextet), dd
(doublet of doublets), ddt (doublet of doublet of triplet), td (triplet
of doublets), m (multiplet), and bs (broad singlet). All compounds
were routinely checked by thin layer chromatography (TLC) and 1H NMR. TLC was performed on silica gel fluorescent coated
plates obtained from Analtech, Inc., Newark, DE. Flash chromatography
purification was performed using silica gel (0.060–0.200 mm)
obtained from Dynamic Adsorbents, Norcross, GA. Optical rotation of
the chiral compounds dissolved in methanol was measured using PerkinElmer
241 polarimeter. Elemental analysis (C, H, N) was performed by Atlantic
Microlab, Inc., (Norcross, GA) for all compounds screened in the biological
assays, and the results are within ±0.40% of theoretical values.
The purity of the synthesized target compounds was determined to be
≥95% by elemental analysis.
Chiral HPLC Analysis
The chiral column used to resolve
the enantiomers (CHIRALPACK 1A) had amylose tris(3,5-dimethylphenylcarbamate)
as the chiral auxiliary. Optimum separation was achieved for both
compounds when the flow rate of the mobile phase was set to 1.0 mL/min.
The samples (compounds 13a and 13c) were
dissolved in ethanol and eluted using an isocratic mobile phase (n-hexane/ethanol 85:15) at an ambient temperature of 25
°C. Compound 28 was resolved by using an isocratic
mobile phase (n-hexane/isopropyl alcohol 70:30).
Retention times for the individual enantiomers were reported as tR (in minutes), whereas the ee (enantiomeric
excess) values were calculated based on the UV absorption (254 nm)
areas for the two enantiomers, respectively. The purity of the resolved
enantiomers was determined by measuring the area under the curve (AUC)
of the LC–MS spectra of the individual enantiomers and represented
as percent AUC of the molecular ion peak relative to the other peaks
in the spectra.
Synthesis of 2,3-Dihydrobenzofuran-7-carboxylic
Acid (2)
To a solution of n-butyllithium
(2.5 M in hexane, 2 mL, 5.0 mmol) in 5 mL of hexane at room temperature
was added (0.58 g, 5.0 mmol) N,N,N′,N′-tetramethylethylenediamine
(TEMED), followed by a solution of 2,3-dihydrobenzofuran (1, 0.3 g, 2.5 mmol) in hexane (5 mL). The mixture was stirred under
nitrogen at room temperature for 4 h and then poured into dry ice.
After being stirred at room temperature overnight, the mixture was
diluted with 15 mL of water and the layers were separated. The aqueous
layer was acidified with hydrochloric acid to pH 1, cooled, and the
precipitates were collected on a filter. The crude product was reprecipitated
using ethyl acetate/hexane to give compound 2 (0.21 g,
yield 52%) as white solid: mp 163–165 °C (lit. 167–169
°C);[33]1H NMR (400 MHz,
DMSO-d6, TMS) δ 3.18 (t, J = 8.8 Hz, 2H), 4.59 (t, J = 8.8 Hz, 2H),
6.86 (t, J = 8.8 Hz, 1H), 7.41 (d, J = 7.4 Hz, 1H), 7.56 (d, J = 7.9 Hz, 1H), 12.62
(s, 1H).
Synthesis of 2,3-Dihydrobenzofuran-7-carboxamide
(3)
To a solution of compound 2 (0.3 g, 1.83
mmol) in 7 mL of anhydrous tetrahydrofuran (THF) were added isobutyl
chloroformate (0.3 g, 2.2 mmol) and N-methylmorpholine
(NMM) (0.22 g, 2.2 mmol) under nitrogen atmosphere at −20 °C,
and the mixture was stirred for 4 h. Then to this mixture was added
5 mL of aqueous ammonia (30%), and the mixture was stirred at room
temperature for 1 h. The organic layer was separated, and the aqueous
layer was extracted with (2 × 10 mL) of THF. The combined organic
layers were dried over sodium sulfate and concentrated under vacuum.
The resulting residue was purified by column chromatography using
ethyl acetate/methanol (95:5) as an eluent, and the product was obtained
as white crystals (0.23 g, yield 75%): mp 185–187 °C; 1H NMR (400 MHz, DMSO-d6, TMS)
δ 3.23 (t, J = 8.6 Hz, 2H), 4.68 (t, J = 8.8 Hz, 2H), 6.92 (t, J = 7.5 Hz, 1H),
7.29 (s, 1H), 7.39 (d, J = 7.2 Hz, 1H), 7.58 (s,
1H), 7.61 (d, J = 7.9 Hz, 1H). Anal. Calcd for C9H9NO2·1/6CH3OH: C, 65.34; H, 5.74; N, 8.31. Found: C, 65.52; H,
5.51; N, 8.41.
Synthesis of 5-Bromo-2,3-dihydrobenzofuran-7-carboxamide
(4)
To a mixture of DHBF-7-carboxamide 3 (0.2 g, 1.23 mmol) and sodium acetate (0.18 g, 2.21 mmol)
in 3 mL
of acetic acid was added bromine solution (0.25 g, 1.60 mmol) in 2
mL of acetic acid. The reaction mixture was heated at 80 °C for
3 h and then poured onto ice and filtered. Reprecipitation from ethyl
acetate afforded the desired compound 4 as a white solid
(0.24 g, yield 80%): mp 195–197 °C; 1H NMR
(400 MHz, DMSO-d6, TMS) δ 3.25 (t, J = 8.8 Hz, 2H), 4.71 (t, J = 8.8 Hz, 2H),
7.26 (s, 1H), 7.57 (d, J = 1.9 Hz, 1H), 7.66 (d, J = 2.3 Hz, 1H), 7.73 (s, 1H). Anal. Calcd for C9H8BrNO2·1/3CH3OH: C, 44.32; H, 3.69; N, 5.54. Found: C, 44.52; H, 3.43;
N, 5.24.
Synthesis of 5-Nitro-2,3-dihydrobenzofuran-7-carboxamide
(5)
To an ice-cooled solution of DHBF-7-carboxamide 3 (0.2 g, 1.23 mmol) in 5 mL of trifluoroacetic acid was added
0.4 mL of nitric acid dropwise. After 30 min, the ice bath was removed
and the mixture was stirred at room temperature for 3 h, and then
the mixture was poured into ice–water. The resulting precipitates
were collected on a filter to give a crude product which was reprecipitated
from ethyl acetate to yield compound 5 (0.17 g, yield
65%) as a pale yellow solid: mp 239–241 °C; 1H NMR (400 MHz, DMSO-d6, TMS) δ
3.35 (t, J = 8.4 Hz, 2H), 4.48 (t, J = 8.6 Hz, 2H), 7.42 (s, 1H), 7.92 (s, 1H), 8.26 (s, 1H), 8.47 (s,
1H). Anal. Calcd for C9H8N2O4·1/6H2O: C, 51.18; H,
3.79; N, 13.27. Found: C, 51.37; H, 3.76; N, 13.10.
Synthesis
of 5-Amino-2,3-dihydrobenzofuran-7-carboxamide (6)
To a solution of compound 5 (0.2
g, 0.96 mmol) in 7 mL of ethyl acetate was added tin chloride dihydrate
(1.3 g, 5.77 mmol), and the mixture was refluxed for 4 h. After completion
of the reaction, mixture was diluted (add 15 mL of ethyl acetate),
cooled, and poured into the saturated sodium bicarbonate solution
(20 mL). The organic layer was separated and the aqueous layer was
washed with ethyl acetate (2 × 20 mL). The combined organic layers
were dried over sodium sulfate and evaporated to give crude product,
which was purified by column chromatography (ethyl acetate/methanol
95:5) to yield compound 6 as a pale yellow solid (0.09
g, yield 55%): mp 141–143 °C; 1H NMR (400 MHz,
DMSO-d6, TMS) δ 3.11 (t, J = 8.2 Hz, 2H), 4.55 (t, J = 8.8 Hz, 2H),
4.76 (bs, 2H), 6.67 (d, J = 1.4 Hz, 1H), 6.87 (d, J = 2.2 Hz, 1H), 7.17 (s, 1H), 7.42 (s, 1H). Anal. Calcd
for C9H10N2O2: C, 60.66;
H, 5.66; N, 15.72. Found: C, 60.76; H, 5.76; N, 15.57.
Synthesis
of Methyl 5-Methylsalicylate (8b)
To a solution
of 5-methylsalicylic acid (3.0 g, 19.7 mmol) in methanol
was added dropwise thionyl chloride (2.81 g, 23.70 mmol), and then
the reaction mixture was refluxed for 12 h. The reaction mixture was
then cooled to room temperature, and the solvent was evaporated under
vacuum. The resulting oil was diluted with water (20 mL) followed
by extracting it with ethyl acetate (3 × 20 mL). The organic
layers were combined, dried over sodium sulfate, and evaporated under
vacuum to yield a yellow liquid, which was further purified by column
chromatography (n-hexane/ethyl acetate 95:5) to give
the desired product 8b as a pale yellow oil (2.95 g,
yield 90%): 1H NMR (400 MHz, CDCl3, TMS) δ
2.26 (s, 3H), 3.92 (s, 3H), 6.87 (d, J = 8.5 Hz,
1H), 7.24 (d, J = 8.7 Hz, 1H), 7.61 (s, 1H), 10.57
(s, 1H).
Synthesis of Methyl 5-Fluorosalicylate (8c)
8c was obtained by the same procedure
as mentioned for
compound 8b using 5-fluorosalicylic acid (2.96 g, 19.0
mmol) as starting material, as pale yellow crystalline solid (2.74
g, yield 85%): 1H NMR (400 MHz, CDCl3, TMS)
δ 3.96 (s, 3H), 6.94 (dd, J = 9.0, 4.6 Hz,
1H), 7.18 (td, J = 8.5, 3.3 Hz, 1H), 7.50 (dd, J = 8.8, 3.3 Hz, 1H), 10.52 (s, 1H).
Synthesis
of Methyl 2-(Allyloxy)benzoate (9a)
To a solution
of methyl salicylate (3.0 g, 19.7 mmol) in 10 mL
of DMF were added allyl bromide (2.63 g, 21.7 mmol), potassium carbonate
(2.99 g, 21.7 mmol), and sodium iodide (3.25 g, 21.7 mmol). The reaction
mixture was stirred for 12 h at room temperature and then poured into
water (50 mL) and extracted with ethyl acetate (3 × 50 mL). The
organic layers were combined, dried over sodium sulfate, and concentrated
under vacuum to yield yellowish brown oil which was further purified
by column chromatography (n-hexane/ethyl acetate
90:10) to get the desired product 9a as pale yellow oil
(3.52 g, yield 92%): 1H NMR (400 MHz, DMSO-d6, TMS) δ 3.79 (s, 3H), 4.63 (m, 2H), 5.25 (dd, J = 10.6, 1.7 Hz, 1H), 5.46 (dd, J = 17.2,
1.7 Hz, 1H), 6.02 (ddt, J = 17.4, 10.7, 4.7 Hz, 1H),
7.01 (t, J = 7.6 Hz, 1H), 7.13 (d, J = 8.3 Hz, 1H), 7.51 (td, J = 7.8, 1.7 Hz, 1H),
7.63 (dd, J = 7.7, 1.6 Hz, 1H).
Synthesis
of Methyl 2-(Allyloxy)-5-methylbenzoate (9b)
Synthesis of Methyl 3-Allyl-2-hydroxybenzoate
(10a)
Compound 9a (3.00 g, 15.62
mmol) was neatly
heated at 160 °C for 2 h, which resulted in the crude brownish
oil that was purified by flash chromatography (n-hexane/ethyl
acetate 95:5) to get compound 10a as pale yellow oil
(2.61 g, yield 87%): 1H NMR (400 MHz, DMSO-d6, TMS) δ 3.36 (d, J = 6.5 Hz,
2H), 3.90 (s, 3H), 5.04 (m, 2H), 6.02 (ddt, J = 16.8,
10.2, 6.5 Hz, 1H), 6.90 (t, J = 7.8 Hz, 1H), 7.39
(d, J = 7.3 Hz, 1H), 7.67 (dd, J = 7.8, 1.7 Hz, 1H), 10.92 (s, 1H).
Synthesis of Methyl 3-Allyl-2-hydroxy-5-methylbenzoate
(10b)
Compound 9b (2.09 g, 10.19
mmol)
was neatly heated at 190 °C for 4 h to obtain crude brownish
oil that was further purified by flash chromatography to get compound 10b as pale yellow oil (1.73 g, yield 83%): 1H
NMR (400 MHz, CDCl3, TMS) δ 2.25 (s, 3H), 3.39 (d, J = 6.8 Hz, 2H), 3.93 (s, 3H), 5.06 (m, 1H), 5.09 (m, 1H),
6.00 (ddt, J = 16.0, 10.0, 6.6 Hz, 1H), 7.14 (s,
1H), 7.51 (s, 1H), 10.85 (s, 1H).
Synthesis of Methyl 3-Allyl-5-fluoro-2-hydroxybenzoate
(10c)
Compound 9c (2.6 g, 12.38
mmol)
was neatly heated at 190 °C for 4 h to obtain crude brownish
oil that was further purified by flash chromatography to get compound 10c as pale yellow oil (2.13 g, yield 82%): 1H
NMR (400 MHz, CDCl3, TMS) δ 3.41 (d, J = 6.6 Hz, 2H), 3.94 (s, 3H), 5.10 (m, 1H), 5.13 (m, 1H), 6.05 (ddt, J = 17.0, 10.4, 6.6 Hz, 1H), 7.09 (dd, J = 8.8, 3.3 Hz, 1H), 7.38 (dd, J = 8.6, 3.3 Hz,
1H), 10.83 (s, 1H).
Synthesis of Methyl 2-Methyl-2,3-dihydrobenzofuran-7-carboxylate
(11a)
To a solution of compound 10a (2.0 g, 10.41 mmol) in dichloromethane (20 mL), cooled to 0 °C,
zirconium(IV) chloride (2.91 g, 12.48 mmol) was added in portions,
and the reaction mixture was stirred at room temperature for 10 h.
After completion, the reaction was quenched by addition of cold water
(10 mL) and the organic layer was separated. The aqueous layer was
extracted with (3 × 10 mL) dichloromethane. The combined organic
phase was washed with water, dried over sodium sulfate, and concentrated
to give the crude product, which was purified by flash chromatography
(n-hexane/ethyl acetate 80:20) to get the desired
product 11a as pale yellow oil (1.70 g, yield 85%): 1H NMR (400 MHz, DMSO-d6, TMS)
δ 1.40 (d, J = 6.3 Hz, 3H), 2.78 (dd, J = 15.7, 7.6 Hz, 1H), 3.32 (dd, J = 15.7,
9.0 Hz, 1H), 3.78 (s, 3H), 5.0 (sext, J = 7.0 Hz,
1H), 6.87 (t, J = 7.3 Hz, 1H), 7.40 (dd, J = 7.3, 1.3 Hz, 1H), 7.57 (d, J = 7.8
Hz, 1H).
Synthesis of Methyl 2,5-Dimethyl-2,3-dihydrobenzofuran-7-carboxylate
(11b)
11b was synthesized according
to the above procedure for 11a using compound 10b (1.5 g, 7.28 mmol) as starting material, as colorless oil (1.24
g, yield 83%): 1H NMR (400 MHz, CDCl3, TMS)
δ 1.50 (d, J = 6.2 Hz, 3H), 2.27 (s, 3H), 2.77
(dd, J = 15.6, 7.4 Hz, 1H), 3.28 (dd, J = 15.6, 8.8 Hz, 1H), 3.88 (s, 3H), 5.04 (sext, J = 7.0 Hz, 1H), 7.12 (s, 1H), 7.50 (s, 1H).
Synthesis
of Methyl 5-Fluoro-2-methyl-2,3-dihydrobenzofuran-7-carboxylate
(11c)
11c was synthesized according
to 11a using compound 10c (1.2 g, 5.71 mmol)
as starting material and obtained as colorless oil (1.0 g, yield 83%): 1H NMR (400 MHz, CDCl3, TMS) δ 1.52 (d, J = 6.2 Hz, 3H), 2.82 (dd, J = 16.0, 7.4
Hz, 1H), 3.32 (dd, J = 16.0, 9.0 Hz, 1H), 3.89 (s,
3H), 5.09 (sext, J = 7.0 Hz, 1H), 7.04 (d, J = 7.4 Hz, 1H), 7.39 (dd, J = 9.6, 2.8
Hz, 1H).
Synthesis of 2-Methyl-2,3-dihydrobenzofuran-7-carboxylic
Acid
(12a)
To a solution of compound 11a (1.50 g, 7.81 mmol) in methanol was added sodium hydroxide (0.94
g, 23.43 mmol), and the mixture was refluxed for 2 h. Upon completion,
the mixture was cooled and the solvent was evaporated under reduced
pressure. The resulting white solid was dissolved in a small amount
of water and cooled to 0 °C. To this, concentrated hydrochloric
acid was added dropwise until pH 1 to get white precipitates, which
were filtered and dried under vacuum to get the desired compound rac-12a as white solid (1.17 g, yield 85%):
mp 121–123 °C (lit. 125–127 °C);[53]1H NMR (400 MHz, DMSO-d6, TMS) δ 1.40 (d, J = 6.2 Hz,
3H), 2.78 (dd, J = 16.0, 7.8 Hz, 1H), 3.31 (dd, J = 15.9, 8.8 Hz, 1H), 4.97 (sext, J =
7.0 Hz, 1H), 6.85 (t, J = 7.6 Hz, 1H), 7.37 (dd, J = 7.1, 1.1 Hz, 1H), 7.55 (d, J = 7.7
Hz, 1H), 12.56 (bs, 1H).The 2-methyl enantiomers obtained were
resolved to elucidate the absolute stereochemistry at the 2-position
of 12a, wherein the acid derivative was heated with equimolar
proportion of either of the (−)-brucine dihydrate in acetone
or (S)-(−)-α-methylbenzylamine or (R)-(+)-α-methylbenzylamine in methanol for crystallization.
The superior quality crystals obtained were used to elucidate the
absolute stereochemistry at Department of Chemistry, Louisiana State
University, Baton Rouge, LA, by X-ray crystallographic analysis. Furthermore,
the absolute stereochemistry of the compound was correlated with the
optical rotation performed by quenching the crystals (having stereochemistry
determined) with diluted hydrochloric acid. The quenched fractions,
upon extraction in ethyl acetate, were subjected to optical rotation
using a polarimeter at a concentration of 0.1 g/mL in methanol. The
specific rotation for each enantiomer was calculated from the observed
rotation, which was found to be [α]25D +14.3° and −13.8°, respectively. The X-ray crystallographic
analysis of the diastereomericsalt of the (−)-enantiomer of 12a with (S)-(−)-α-methylbenzylamine
revealed that the (−)-enantiomer bears the R-configuration (Figure 2). On the basis of
this finding, the (+)-enantiomer was assigned as the S-enantiomer.
Synthesis of 2,5-Dimethyl-2,3-dihydrobenzofuran-7-carboxylic
Acid (12b)
12b was prepared according
to the procedure used to synthesize compound 12a using
compound 11b (1.50 g, 7.28 mmol) as starting material
and obtained as a white solid (1.21 g, yield 87%): mp 146–148
°C (lit. 149–150 °C);[54]1H NMR (400 MHz, DMSO-d6,
TMS) δ 1.38 (d, J = 6.1 Hz, 3H), 2.22 (s, 3H),
2.73 (dd, J = 16.0, 7.6 Hz, 1H), 3.27 (dd, J = 15.6, 8.9 Hz, 1H), 4.93 (sext, J =
7.0 Hz, 1H), 7.19 (s, 1H), 7.35 (s, 1H), 12.48 (s, 1H).
Synthesis
of 5-Fluoro-2-methyl-2,3-dihydrobenzofuran-7-carboxylic
Acid (12c)
12c was prepared according
to the procedure used to synthesize compound 12a using
compound 11c (1.30 g, 6.19 mmol) as starting material
and obtained as pale yellow solid (1.03 g, yield 85%): mp 128–130
°C (lit. 129–131 °C);[53]1H NMR (400 MHz, DMSO-d6,
TMS) δ 1.39 (d, J = 6.3 Hz, 3H), 2.95 (dd, J = 16.4, 7.9 Hz, 1H), 3.32 (dd, J = 15.9,
9.0 Hz, 1H), 5.00 (sext, J = 7.0 Hz, 1H), 7.24 (dd, J = 9.9, 2.9 Hz, 1H), 7.32 (dd, J = 8.0,
3.0 Hz, 1H), 12.89 (s, 1H).
Synthesis of 2-Methyl-2,3-dihydrobenzofuran-7-carboxamide
(13a)
The acid rac-12a (1.10 g, 6.18 mmol) was converted to carboxamide using mixed-anhydride
method as followed for compound 3 to yield the amide
as white solid (0.87 g, yield 80%): mp 124–125 °C; 1H NMR (400 MHz, DMSO-d6, TMS)
δ 1.43 (d, J = 6.1 Hz, 3H), 2.83 (dd, J = 15.4, 7.1 Hz, 1H), 3.36 (dd, J = 15.4,
9.0 Hz, 1H), 5.08 (sext, J = 7.0 Hz, 1H), 7.25 (s,1H),
7.35 (d, J = 6.8 Hz, 1H), 7.57 (s, 1H), 7.62 (d, J = 7.8 Hz, 1H). Anal. Calcd for C10H11NO2: C, 67.78; H, 6.26; N, 7.90. Found: C, 67.56; H, 6.37;
N, 7.80.The racemateamide (rac-13a) was resolved by means of preparative chiral chromatography technique
at GVK Biosciences Pvt. Ltd., Hyderabad, India. Optical rotations
of the individual enantiomers measured were found to be [α]25D +8.3°, −8.1°. tR = 7.68 min (dextro), 7.04 min. (levo); LC–MS
purity = 99.79% (dextro), 98.42% (levo); ee = 90.22% (dextro), 97.30%
(levo).
Synthesis of 2,5-Dimethyl-2,3-dihydrobenzofuran-7-carboxamide
(13b)
13b was synthesized by mixed-anhydride
method according to compound 3 using 12b (1.00 g, 5.21 mmol) as starting material to yield a white solid
(0.74 g, yield 75%): mp 152–153 °C; 1H NMR
(400 MHz, DMSO-d6, TMS) δ 1.42 (d, J = 6.3 Hz, 3H), 2.24 (s, 3H), 2.95 (dd, J = 15.9, 7.4 Hz, 1H), 3.32 (dd, J = 15.7, 8.8 Hz,
1H), 5.04 (sext, J = 7.0 Hz, 1H), 7.17 (s, 1H), 7.21
(s, 1H), 7.42 (s, 1H), 7.54 (s, 1H). Anal. Calcd for C11H13NO2: C, 69.09; H, 6.85; N, 7.32. Found:
C, 68.81; H, 6.97; N, 7.20.
Synthesis of 5-Fluoro-2-methyl-2,3-dihydrobenzofuran-7-carboxamide
(13c)
13c was synthesized by mixed-anhydride
method according to compound 3 using rac-12c (1.30 g, 6.63 mmol) as starting material to yield
a white solid (0.90 g, yield 70%): mp 137–139 °C; 1H NMR (400 MHz, DMSO-d6, TMS)
δ 1.44 (d, J = 6.1 Hz, 3H), 2.84 (dd, J = 16.2, 8.1 Hz, 1H), 3.37 (dd, J = 16.2,
8.8 Hz, 1H), 5.10 (sext, J = 7.0 Hz, 1H), 7.29 (m,
3H), 7.76 (s, 1H). Anal. Calcd for C10H10FNO2·1/6CH3OH: C, 60.89;
H, 5.32; N, 6.98. Found: C, 60.62; H, 5.32; N, 6.98.The amide
enantiomers were resolved by means of chiral chromatography technique
at GVK Biosciences Pvt. Ltd., Hyderabad, India. Optical rotations
of the individual enantiomers measured were found to be [α]25D +14.2°, −12.3°. tR = 7.02 min (dextro) and 6.56 min (levo); LC–MS
purity = 99.48% (dextro), 99.69% (levo); ee = 90.38% (dextro), 93.25%
(levo).
Synthesis of 2-Methyl-5-nitro-2,3-dihydrobenzofuran-7-carboxamide
(14)
14 was synthesized according
to compound 5 using rac-13a (1.20 g, 6.78 mmol) as starting material to give a pale yellow solid
(0.98 g, yield 65%): mp 204–205 °C; 1H NMR
(400 MHz, DMSO-d6, TMS) δ 1.50 (d, J = 6.5 Hz, 3H), 2.95 (dd, J = 16.4, 7.6
Hz, 1H), 3.49 (dd, J = 16.4, 8.8 Hz, 1H), 5.29 (sext, J = 7.0 Hz, 1H), 7.91 (s, 1H), 7.39 (s, 1H), 8.23 (s, 1H),
8.48 (d, J = 2.6 Hz, 1H). Anal. Calcd for C10H10N2O4: C, 54.05; H, 4.54; N, 12.61.
Found: C, 53.89; H, 4.48; N, 12.46.
Synthesis of 5-Amino-2-methyl-2,3-dihydrobenzofuran-7-carboxamide
(15)
15 was obtained according
to the procedure for compound 6 using 14 (0.60 g, 2.70 mmol) as starting material, yielding a pale yellow
solid (0.26 g, yield 50%): mp 152–154 °C; 1H NMR (400 MHz, DMSO-d6, TMS) δ
1.39 (d, J = 6.2 Hz, 3H), 2.71 (dd, J = 15.7, 7.6 Hz, 1H), 3.22 (dd, J = 15.7, 8.6 Hz,
1H), 4.75 (s, 2H), 4.92 (sext, J = 7.0 Hz, 1H), 6.62
(s,1H), 6.86 (s, 1H), 7.18 (s, 1H), 7.42 (s, 1H). Anal. Calcd for
C10H12N2O2: C, 62.49;
H, 6.29; N, 14.57. Found: C, 62.27; H, 6.45; N, 13.56.
Synthesis
of Methyl 2,3-Dihydrobenzofuran-7-carboxylate (16)
To a suspension of 2 (3.00 g, 18.29
mmol) in methanol was added a catalytic amount of sulfuric acid, and
the mixture was refluxed for 3 h. After completion of the reaction,
the reaction mixture was cooled and concentrated under vacuum. To
the crude mass, water (20 mL) was added and compound was extracted
in ethyl acetate (3 × 20 mL). The combined organic layers were
dried over sodium sulfate and concentrated under reduced pressure
to get crude solid, which was purified by flash chromatography to
get desired product 16 as white crystalline solid (2.93
g, yield 90%): 1H NMR (400 MHz, CDCl3, TMS)
δ 3.21 (t, J = 8.8 Hz, 2H), 3.89 (s, 3H), 4.70
(t, J = 8.8 Hz, 2H), 6.86 (t, J =
7.6 Hz, 1H), 7.33 (d, J = 7.0 Hz, 1H), 7.71 (d, J = 7.6 Hz, 1H).
Synthesis of 5-Nitro-2,3-dihydrobenzofuran
(17a)
17a was synthesized according
to compound 5 using compound 1 (1.10 g,
9.16 mmol) as starting
material, as pale yellow solid (1.18 g, yield 78%): 1H
NMR (400 MHz, DMSO-d6, TMS) δ 3.28
(t, J = 8.8 Hz, 2H), 4.72 (t, J =
8.8 Hz, 2H), 6.94 (d, J = 8.8 Hz, 1H), 8.06 (dd, J = 8.8, 2.5 Hz, 1H), 8.13 (s, 1H).
Synthesis
of 5-Nitro-2,3-dihydrobenzofuran-7-carboxylic Acid
(17b)
17b was synthesized according
to compound 5 using compound 2 (1.20 g,
7.32 mmol) as starting material, as pale yellow solid (1.07 g, yield
70%): mp 245–247 °C (lit. 249–251.5 °C);[33]1H NMR (400 MHz, DMSO-d6, TMS) δ 3.30 (t, J = 8.6 Hz,
2H), 4.81 (t, J = 8.6 Hz, 2H), 8.29 (s, 1H), 8.44
(s, 1H), 13.37 (bs, 1H).
Synthesis of Methyl 5-Nitro-2,3-dihydrobenzofuran-7-carboxylate
(17c)
To a suspension of 17a (3.00
g, 18.18 mmol)
in ethanol (50 mL) was added 10% palladium on carbon (0.20 g), and
the mixture was stirred under hydrogen atmosphere at 60 psi for 18
h. The mixture was then filtered through Celite bed and concentrated
to afford a gray solid, which was further purified by column chromatography
to get the desired compound 18a as brownish-black solid
(2.17 g, yield 90%): mp 77–79 °C (lit. 80–81 °C);[54]1H NMR (400 MHz, CDCl3, TMS) δ 3.11 (t, J = 8.6 Hz, 2H), 3.30 (bs,
2H), 4.48 (t, J = 8.6 Hz, 2H), 6.45 (d, J = 8.2 Hz, 1H), 6.59 (m, 2H).
Synthesis of 5-Amino-2,3-dihydrobenzofuran-7-carboxylic
Acid
(18b)
18b was obtained by the aforementioned
procedure for compound 18a using 17b (1.3
g, 6.22 mmol) as starting material (reaction completed in 2 h), as
brownish black solid (1.24 g, yield 82%): 1H NMR (400 MHz,
DMSO-d6, TMS) δ 3.05 (t, J = 8.6 Hz, 2H), 4.44 (t, J = 8.6 Hz, 2H),
4.60 (bs, 2H), 6.72 (s, 1H), 6.80 (s, 1H), 12.39 (bs, 1H).
Synthesis
of Methyl 5-Amino-2,3-dihydrobenzofuran-7-carboxylate
(18c)
18c was obtained by the aforementioned
procedure for compound 18a using 17c (1.2
g, 5.40 mmol) as starting material (reaction completed in 2 h), as
crystalline pale yellow solid (0.87 g, yield 84%): 1H NMR
(400 MHz, CDCl3, TMS) δ 3.16 (t, J = 8.7 Hz, 2H), 3.49 (bs, 2H), 3.89 (s, 3H), 4.65 (t, J = 8.7 Hz, 2H), 6.79 (s, 1H), 7.06 (s, 1H).
Synthesis
of 5-Fluoro-2,3-dihydrobenzofuran (19a)
To a
solution compound 18a (2.00 g, 14.49
mmol) in THF (50 mL) was added 1.5 mL of concentrated aqueous hydrochloric
acid in several portions. To the resulting white precipitates was
added dropwise tetrafluoroboric acid (2.7 mL). The mixture was then
chilled (−15 °C), and to it was added sodium nitrite (1.10
g, 15.94 mmol) in water (5 mL). Initially the suspension turned deep
gray and was homogenized, followed by precipitation after some time.
The mixture was stirred for 30 min at −15 °C, and then
the solid was collected by filtration and washed with cold water,
cold ethanol, and cold ether. The solid was dried by vacuum filtration
to afford 5-diazonium-2,3-DHBF tetrafluoroborate salt, which was used
without further purification.A suspension of the above diazonium
tetrafluoroborate salt in xylene (10 mL) was refluxed for 2 h. The
mixture was then cooled and diluted with 20 mL of saturated aqueous
sodium bicarbonate and then extracted with 3 × 20 mL of ethyl
acetate. The combined organic layers were washed with 50 mL of aqueous
sodium bicarbonate, 50 mL of brine, dried over sodium sulfate, filtered,
and concentrated under vacuum to afford crude oil. The crude oil was
purified by gradient flash chromatography (n-hexane/ethyl
acetate 100:0 and than 99.5:0.5) to afford compound 19a as pale yellow oil (0.61 g, yield 30%): 1H NMR (400 MHz,
CDCl3, TMS) δ 3.16 (t, J = 8.6 Hz,
2H), 4.55 (t, J = 8.6 Hz, 2H), 6.66 (dd, J = 8.6, 4.2 Hz, 1H), 6.76 (t, J = 9.0
Hz, 1H), 6.87 (d, J = 7.8 Hz, 1H).
Synthesis
of Methyl 5-Fluoro-2,3-dihydrobenzofuran-7-carboxylate
(19c)
19c was obtained by the aforementioned
procedure for compound 19a using 18c (2.10
g, 10.88 mmol) as starting material with a small modification (instead
of filtering off the diazonium tetrafluoroborate salt). The mixture
was concentrated under reduced pressure and the resulting mass was
refluxed in xylene to yield compound 19c as colorless
solid (0.30 g, yield 14%): 1H NMR (400 MHz, CDCl3, TMS) δ 3.23 (t, J = 8.8 Hz, 2H), 3.91 (s,
3H), 4.73 (t, J = 8.8 Hz, 2H), 7.08 (d, J = 7.3 Hz, 1H), 7.38 (dd, J = 9.6, 2.7 Hz, 1H).
Synthesis of 5-Fluoro-2,3-dihydrobenzofuran-7-carboxylic Acid
(19b)
19b was obtained from ester
hydrolysis of compound 19c using sodium hydroxide (0.25
g, 1.27 mmol) as mentioned for synthesis of compounds 12a–c; however, the mixture was refluxed for 3 h
(instead of 2 h), and the product was obtained as white solid (0.20
g, yield 87%): 1H NMR (400 MHz, DMSO-d6, TMS) δ 3.20 (t, J = 8.8 Hz,
2H), 4.62 (t, J = 8.8 Hz, 2H), 7.25 (dd, J = 9.8 Hz, 3.0 Hz, 1H), 7.35 (d, J = 7.8
Hz, 1H), 12.91 (bs, 1H).
Synthesis of 5-Fluoro-2,3-dihydrobenzofuran-7-carboxamide
(20)
20 was synthesized from compound 19b (0.15 g, 0.82 mmol) following the exact procedure used
to synthesize compound 3 and obtained as pale yellow
solid (0.12 g, yield 80%): mp 188–190 °C; 1H NMR (400 MHz, DMSO-d6, TMS) δ
3.25 (t, J = 8.8 Hz, 2H), 4.71 (t, J = 8.8 Hz, 2H), 7.30 (m, 3H), 7.74 (s, 1H). Anal. Calcd for C9H8FNO2: C, 59.67; H, 4.45; N, 7.73.
Found: C, 59.67; H, 4.51; N, 7.55.
Synthesis of Methyl 4-Nitrosalicylate
(22)
22 was synthesized using 4-nitrosalicylic
acid as the
starting material as per the aforementioned method for compound 8b (3.00 g, 16.40 mmol) and obtained as bright yellow solid
(2.90 g, yield 90%): 1H NMR (400 MHz, DMSO-d6, TMS) δ 3.95 (s, 3H), 5,87 (s, 1H), 7.43 (d, J = 8.7 Hz, 1H), 7.90 (d, J = 8.8 Hz, 1H),
11.31 (s, 1H).
Synthesis of Methyl 2-(Allyloxy)-4-nitrobenzoate
(23)
23 was synthesized using compound 22 (2.50 g, 12.70 mmol) following the same protocol as that
of compound 9a, as a bright yellow solid (2.62 g, yield
87%): 1H NMR (400 MHz, DMSO-d6, TMS) δ
3.86 (s, 3H), 4.81 (d, J = 6.9 Hz, 2H), 5.30 (dd, J = 13.5, 4.2 Hz, 1H), 5.47 (dd, J = 11.3,
5.6 Hz, 1H), 6.04 (ddt, J = 17.0, 10.4, 6.8 Hz, 1H),
7.87 (s, 2H), 7.89 (s, 1H).
Synthesis of Methyl 3-Allyl-2-hydroxy-4-nitrobenzoate
(24)
24 was synthesized using compound 23 (1.00 g, 4.22 mmol) with the diminutive variation in the
procedure of compound 10a where the O-allylated product
was heated in carbitol at an elevated temperature of 170–180
°C for 2 h and obtained as a dark brown oil (0.30 g, yield 30%): 1H NMR (400 MHz, DMSO-d6, TMS)
δ 3.49 (d, J = 6.1 Hz, 2H), 3.95 (s, 3H), 4.99
(dd, J = 11.30, 6.74 Hz, 2H), 5.88 (ddt, J = 17.0, 10.4, 6.8 Hz, 1H), 7.43 (d, J = 8.8 Hz, 1H), 7.90 (d, J = 8.8 Hz, 1H), 11.27
(s, 1H).
Synthesis of Methyl 2-Methyl-4-nitro-2,3-dihydrobenzofuran-7-carboxylate
(25)
25 was obtained from compound 24 (0.85 g, 3.58 mmol) as per the procedure mentioned for
compound 11a in form of pale brown solid (0.55 g, yield
65%): 1H NMR (400 MHz, DMSO-d6, TMS) δ 1.46 (d, J = 6.2 Hz, 3H), 3.26 (dd, J = 11.3, 5.1 Hz, 1H), 3.81 (dd, J = 10.1,
6.5 Hz, 1H), 3.84 (s, 3H), 5.18 (sext, J = 7.0 Hz,
1H), 7.67 (d, J = 8.8 Hz, 1H), 7.83 (d, J = 8.8 Hz, 1H).
Synthesis of Methyl 4-Amino-2-methyl-2,3-dihydrobenzofuran-7-carboxylate
(26)
26 was obtained from compound 25 (1.10 g, 4.64 mmol) using the exact procedure as mentioned
for compound 18a and obtained as bright yellow powder
(0.82 g, yield 85%): 1H NMR (400 MHz, DMSO-d6, TMS) δ 1.40 (d, J = 6.2 Hz,
3H), 2.48 (dd, J = 15.1, 7.8 Hz, 1H), 3.02 (dd, J = 15.3, 9.2 Hz, 1H), 3.71 (s, 3H), 4.95 (sext, J = 7.1 Hz, 1H), 5.62 (s, 2H), 6.2 (d, J = 8.5 Hz, 1H), 7.40 (d, J = 8.6 Hz. 1H).
Synthesis
of 4-Amino-2-methyl-2,3-dihydrobenzofuran-7-carboxylic
Acid (27)
27 was synthesized by
hydrolyzing compound 26 (0.60 g, 2.89 mmol) in the same
way as that the method followed for compound 12a and
obtained in form of pale brown solid (0.41 g, yield 73%): 1H NMR (400 MHz, DMSO-d6, TMS) δ
1.38 (d, J = 6.2 Hz, 3H), 2.54 (dd, J = 15.1, 7.8 Hz, 1H), 3.07 (dd, J = 15.3, 9.2 Hz,
1H), 4.94 (sext, J = 7.1 Hz, 1H), 5.66 (s, 2H), 6.16
(d, J = 8.4 Hz, 1H), 7.35 (d, J =
8.6 Hz, 1H), 13.1 (s, 1H).
Synthesis of 4-Amino-2-methyl-2,3-dihydrobenzofuran-7-carboxamide
(28)
To a well stirred solution of compound 27 (0.30 g, 1.55 mmol) in anhydrous THF was added sequentially N-methylmorpholine (0.3 mL) followed by isobutyl chloroformate
(0.3 mL) at −20 °C under nitrogen atmosphere. The resulting
reaction mixture was then allowed to stir for 30 min to yield the
anhydride through which was passed dry ammonia gas under anhydrous
condition. The mixture was then brought to room temperature with intermittent
monitoring by thin layer chromatography. Upon completion, the reaction
mixture was purified by column chromatography (ethyl acetate/methanol
95:5), resulting in a pale yellow solid (0.12 g, yield 40%): mp 245–248
°C; 1H NMR (400 MHz, DMSO-d6, TMS) δ 1.42 (d, J = 6.3 Hz, 3H), 2.52 (dd, J = 15.1, 9.2 Hz, 1H), 3.09 (dd, J = 15.6,
9.1 Hz, 1H), 5.03 (sext, J = 7.1 Hz, 1H), 5.63 (s,
2H), 6.15 (d, J = 8.6 Hz, 1H), 6.91 (s, 1H), 7.06
(s, 1H), 7.36 (d, J = 8.6 Hz, 1H).The amide
was resolved by means of preparative chiral chromatography technique
at GVK Biosciences Pvt. Ltd., Hyderabad, India. Individual enantiomers
were resolved and characterized for purity and retention times, with tR = 6.93 min (compound 28) and 8.12 min (compound 28); LC–MS purity = 99.07% (compound 28), 96.58% (compound 28); ee = 94.00% (compound 28), 94.46% (compound 28).
Synthesis of Methyl 2-Hydroxy-3-methylbenzoate
(30)
30 was obtained by the same
procedure mentioned
for compound 8b using compound 29 (3.00
g, 19.73 mmol) as starting material and methanol as a solvent to yield
compound 30 as pale yellow oil (2.00 g, yield 60%): 1H NMR (400 MHz, CDCl3, TMS) δ 1.40 (t, J = 7.2 Hz, 3H), 2.26 (s, 3H), 4.39 (q, J = 7.1 Hz, 2H), 6.77 (t, J = 7.6 Hz, 1H), 7.30 (d, J = 7.2 Hz, 1H), 7.70 (d, J = 7.6 Hz, 1H),
11.10 (s, 1H).
Synthesis of Methyl 2-(2-Ethoxy-2-oxoethoxy)-3-methylbenzoate
(31)
To a solution of 30 (3.0 g,
18.0 mmol) in 10 mL of DMF were added ethyl bromoacetate (4.51 g,
27.0 mmol), potassium carbonate (2.72 g, 19.8 mmol), and sodium iodide
(2.96 g, 19.8 mmol). The reaction mixture was stirred for 12 h at
room temperature and then poured into water (50 mL) and extracted
with ethyl acetate (3 × 50 mL). The organic layers were combined,
dried over sodium sulfate, and concentrated under vacuum to yield
yellowish brown oil which was further purified by column chromatography
(n-hexane/ethyl acetate 90:10) to get the desired
product 31 as pale yellow oil (2.20 g, yield 92%): 1H NMR (400 MHz, CDCl3, TMS) δ 1.32 (t, J = 7.2 Hz, 3H), 1.37 (t, J = 7.2 Hz, 3H),
2.35 (s, 2H), 4.29 (q, J = 7.5 Hz, 2H), 4.35 (q, J = 7.5 Hz, 2H), 4.58 (s, 2H), 7.08 (t, J = 7.6 Hz, 1H), 7.35 (d, J = 7.4 Hz, 1H), 7.66 (d, J = 7.6 Hz, 1H).
Synthesis of 2-(Carboxymethoxy)-3-methylbenzoic
Acid (32)
32 was obtained in the
same way
as the protocol followed for compound 12a using 3 equiv
of potassium hydroxide when added to compound 31 under
refluxing conditions, yielding 32 as pale yellow solid
(1.34 g, yield 80%): mp 202–204 °C (lit. 207 °C);[55]1H NMR (400 MHz, DMSO-d6, TMS) δ 2.28 (s, 3H), 4.49 (s, 2H), 7.10 (t, J = 7.6 Hz, 1H), 7.40 (d, J = 7.7 Hz, 1H),
7.54 (d, J = 7.6 Hz, 1H), 12.97 (s, 2H).
Synthesis
of 2-(Carboxymethoxy)isophthalic Acid (33)
To
a suspension of compound 32 (2.0 g, 9.5
mmol) in 20 mL of water was added KMnO4 (7.57 g, 47.6 mmol)
gradually, and the resulting reaction mixture was refluxed for 2 h.
Upon completion, the reaction mixture was filtered and filtrate was
concentrated under vacuum. The resulting white solid was dissolved
in minimum amount of water and cooled to 0 °C. To this solution,
concentrated HCl (11 N) was added dropwise until pH 1 was obtained.
The resulting precipitates were filtered and dried to get the desired
compound 33 as white solid (0.68 g, yield 30%): 1H NMR (400 MHz, DMSO-d6, TMS)
δ 4.56 (s, 2H), 7.29 (t, J = 7.6 Hz, 1H), 7.84
(d, J = 7.6 Hz, 2H), 13.45 (bs, 3H).
Synthesis
of 3-Acetoxybenzofuran-7-carboxylic Acid (34)
To a mixture of 33 (1.0 g, 4.17 mmol) and
sodium acetate (0.34 g, 4.17 mmol) were added 3 mL of acetic acid
and 5 mL of acetic anhydride, and the resulting mixture was refluxed
for 5 h. Upon completion, the reaction mixture was extracted with
ethyl acetate (3 × 15 mL). The combined organic layers were dried
over magnesium sulfate and concentrated under vacuum to obtain a yellow
mass, which was purified by column chromatography (n-hexane/ethyl acetate 90:10) to get the desired compound 34 as pale yellow solid (0.55 g, yield 60%): 1H NMR (400
MHz, DMSO-d6, TMS) δ 2.39 (s, 3H),
7.39 (t, J = 7.6 Hz, 1H), 7.80 (d, J = 7.6 Hz, 1H), 7.89 (d, J = 7.5 Hz, 1H), 8.29 (s,
1H), 13.38 (bs, 1H).
Synthesis of 3-Oxo-2,3-dihydrobenzofuran-7-carboxylic
Acid (35)
Compound 34 (0.5 g, 2.27
mmol) was
dissolved in a 10 mL mixture of HCl/H2O/MeOH (1:10:40)
and was refluxed for 1 h. Upon completion, the reaction mixture was
concentrated under vacuum. The resulting solid obtained was filtered
off and washed with water to yield the desired compound as an orange
solid (0.24 g, yield 60%): 1H NMR (400 MHz, DMSO-d6, TMS) δ 4.89 (s, 2H), 7.23 (t, J = 7.6 Hz, 1H), 7.87 (d, J = 7.5 Hz, 1H),
8.18 (d, J = 7.7 Hz, 1H), 13.24 (bs, 1H).
Synthesis
of 3-Oxo-2,3-dihydrobenzofuran-7-carboxamide (36)
36 was obtained by the same procedure
mentioned for compound 3 using compound 35 (2.00 g, 11.23 mmol) as a starting material to yield compound 36 as yellow solid (0.70 g, yield 35%): mp 194–196
°C; 1H NMR (400 MHz, DMSO-d6, TMS) δ 4.93 (s, 2H), 7.26 (t, J = 7.6 Hz,
1H), 7.44 (s, 1H), 7.81 (d, J = 7.6 Hz, 1H), 7.86
(s, 1H), 8.14 (d, J = 7.4 Hz, 1H). Anal. Calcd for
C9H7NO3: C, 61.02; H, 3.98; N, 7.91.
Found: C, 61.35; H, 3.62; N, 7.86.
Synthesis of 3-(2-Morpholin-4-ylethoxy)benzaldehyde
(37)
To a well stirred solution of 3-hydroxybenzaldehyde
(0.5
g, 4.09 mmol) in acetonitrile were added 4-(2-chloroethyl)morpholine
(0.61 g, 4.09 mmol) and anhydrous potassium carbonate (0.56 g, 4.09
mmol), and the mixture was refluxed for 6 h. Upon completion, the
reaction mixture was partitioned between ethyl acetate and water.
The organic layer was dried over anhydrous magnesium sulfate and concentrated
under vacuum. The resulting crude product obtained upon workup was
finally purified by column chromatography (employing a mobile phase
of DCM/methanol/2 M methanolicammonia 90:10:2) to yield the desired
compound as dark brown oil (0.59 g, yield 62%): 1H NMR
(400 MHz, CDCl3, TMS) δ 2.17–2.32 (m, 4H),
2.47 (t, J = 5.4 Hz, 2H), 3.35–3.39 (m, 4H),
3.82 (t, J = 5.5 Hz, 2H), 6.87 (s, 1H), 7.02–7.09
(m, 1H), 7.09–7.25 (m, 2H), 9.62 (s, 1H).
Synthesis
of 3-(2-Piperidin-1-ylethoxy)benzaldehyde (38)
38 was synthesized by following the same
protocol as for compound 37 by reacting 3-hydroxybenzaldeyde
(0.3 g, 2.45 mmol) and 1-(2-chloroethyl)piperidine (0.36 g, 2.45 mmol)
using potassium carbonate (0.50 g, 3.70 mmol) as a base under refluxing
conditions for 6 h. The resulting crude product was purified by column
chromatography (employing a mobile phase of DCM/methanol/2 M methanolicammonia 90:10:2) to yield a pale yellow oil (0.39 g, yield 72%): 1H NMR (400 MHz, CDCl3, TMS) δ 1.24–1.43
(m, 5H), 2.01–2.34 (m, 5H), 2.47 (t, J = 6.0
Hz, 2H), 3.83 (t, J = 6.0 Hz, 2H), 6.89 (s, 1H),
7.05–7.29 (m, 3H), 9.65 (s, 1H).
Synthesis of 4-(2-Morpholin-4-ylethoxy)benzaldehyde
(39)
39 was synthesized in the
same way as mentioned
for compound 37, by mixing equimolar proportions of 4-hydroxybenzaldehyde
(0.5 g, 4.09 mmol) and 4-(2-chloroethyl)morpholine (0.61 g, 4.09 mmol)
under refluxing conditions in the presence of potassium carbonate
(0.56 g, 4.09 mmol). The mixture was refluxed for 6 h. The resulting
crude product obtained upon workup was purified by column chromatography
(employing a mobile phase of DCM/methanol/2 M methanolicammonia 90:10:2)
to provide pale brown oil (0.67 g, yield 70%): bp >300 °C
(lit.
394 °C);[56]1H NMR (400
MHz, CDCl3, TMS) δ 2.36–2.50 (m, 4H), 2.65
(t, J = 5.3 Hz, 2H), 3.55 (t, J =
3.9 Hz, 4H), 4.01 (t, J = 5.3 Hz, 2H), 6.84 (d, J = 8.0 Hz, 2H), 7.65 (d, J = 7.8 Hz, 2H),
9.69 (s, 1H).
Synthesis of 4-(2-Piperidin-1-ylethoxy)benzaldehyde
(40)
40 was synthesized by following
the same
method as mentioned for compound 37 by reacting 4-hydroxybenzaldehyde
(0.3 g, 2.45 mmol) and 1-(2-chloroethyl)piperidine (0.36 g, 2.45 mmol)
in refluxing conditions under the influence of potassium carbonate
(0.50 g, 3.70 mmol) as a base. The mixture was refluxed for 6 h. The
resulting crude product was purified by column chromatography (employing
a mobile phase of DCM/methanol/2 M methanolicammonia 90:10:2) to
yield pale yellow oil (0.37 g, yield 68%): bp >300 °C (lit.
378
°C);[56]1H NMR (400 MHz,
CDCl3, TMS) δ 1.38 (q, J = 6.3 Hz,
2H), 1.46 (J = 5.7 Hz, 2H), 1.59 (q, J = 5.5 Hz. 4H), 1.66–1.80 (m, 2H), 2.71 (t, J = 6.0 Hz, 2H), 3.70 (t, J = 6.8 Hz, 2H), 7.70 (d, J = 8.1 Hz, 2H), 7.00 (d, J = 8.2 Hz, 2H),
9.80 (s, 1H).
Synthesis of 4-(2-Chloroethoxy)benzaldehyde
(41)
To a well stirred solution of 4-hydroxybenzaldehyde
(0.3
g, 2.45 mmol) in acetonitrile was added bromochloroethane (0.35 g,
2.45 mmol), followed by subsequent addition of potassium carbonate
(0.41 g, 3.0 mmol) and potassium iodide (0.41 g, 2.45 mmol) under
reflux. The reaction was allowed to run for 12 h. The reaction progress
was monitored by thin layer chromatography. Upon completion, the reaction
mass was diluted with water and extracted thrice with ethyl acetate
(3 × 50 mL). The combined organic layers were dried over magnesium
sulfate and concentrated under vacuum to afford a crude product, which
was further purified by column chromatography (n-hexane/ethyl
acetate 90:10) to afford compound 41 as a pale yellow
oil which upon prolonged standing turned solid (0.32 g, yield 72%):
mp 29–32 °C (lit. 31 °C);[57]1H NMR (400 MHz, CDCl3, TMS) δ 3.75
(t, J = 5.6 Hz, 2H), 4.19 (t, J =
5.6 Hz, 2H), 6.90 (d, J = 8.3 Hz, 2H), 7.72 (d, J = 8.4 Hz, 2H), 9.76 (s, 1H).
Synthesis of 4-[2-(4-Methylpiperazin-1-yl)ethoxy]benzaldehyde
(42)
To a suspension of potassium carbonate
(0.21 g, 1.5 mmol) and potassium iodide (0.18 g, 1.1 mmol) in acetonitrile
were added compound 41 (0.18 g, 1.0 mmol) and N-methylpiperazine (0.15 g, 1.5 mmol) under refluxing condition.
The reaction mass was refluxed for 6 h and worked up by diluting with
a small quantity of water. The diluted mass was extracted thrice with
ethyl acetate (3 × 20 mL). The combined organic layers were dried
over magnesium sulfate and concentrated under vacuum to obtain a crude
mass. The crude product was finally purified by preparative TLC (employing
a mobile phase of DCM/methanol/2 M methanolicammonia 90:10:2) to
yield compound 42 in the form of a pale yellow oil (0.17
g, yield 70%): 1H NMR (400 MHz, CDCl3, TMS)
δ 2.41 (s, 3H), 2.63–2.83 (m, 8H), 2.86 (t, J = 5.3 Hz, 2H), 4.17 (t, J = 5.9 Hz, 2H), 6.98 (d, J = 8.6 Hz, 2H), 7.80 (d, J = 8.6 Hz, 2H),
9.86 (s, 1H).
Synthesis of 4-(3-Chloropropoxy)benzaldehyde
(43)
43 was synthesized in the
same manner as
that for compound 37 by using equimolar proportions of
4-hydroxybenzaldehyde (2.00 g, 16.4 mmol) and bromochloropropane (2.62
g, 16.4 mmol) using potassium carbonate (3.40 g, 24.6 mmol) as a base.
The mixture was refluxed for 3 h. The crude mass obtained upon workup
was purified by column chromatography employing a mobile phase of n-hexane/ethyl acetate 90:10 to yield yellow oil which eventually
turned solid upon prolonged standing (2.00 g, yield 61%): mp 28–31
°C (lit. 29 °C);[58]1H NMR (400 MHz, CDCl3, TMS) δ 2.40 (t, J = 7.4 Hz, 2H), 3.59 (t, J = 4.7 Hz, 2H), 3.99 (t, J = 6.1 Hz, 2H), 6.88 (d, J = 8.9 Hz, 2H),
7.70 (d, J = 8.8 Hz, 2H), 9.74 (s, 1H).
Synthesis
of 4-(3-Morpholin-4-ylpropoxy)benzaldehyde (44)
44 was synthesized in the same manner
as that for compound 37 by using equimolar proportions
of compound 43 (2.00 g, 10.1 mmol) and morpholine (0.90
g, 10.1 mmol) utilizing potassium carbonate (2.10 g, 15.15 mmol) as
a base. The mixture was refluxed for 6 h and the product was purified
by column chromatography (employing a mobile phase of ethyl acetate/methanol/2
M methanolicammonia 90:10:2) to yield 44 as dark brown
viscous oil (2.10 g, yield 82%): 1H NMR (400 MHz, CDCl3, TMS) δ 1.99 (q, J = 6.5 Hz, 2H),
2.37–2.50 (m, 4H), 2.52 (t, J = 7.3 Hz, 2H),
3.62–3.78 (s, 4H), 4.10 (t, J = 6.3 Hz, 2H),
6.99 (d, J = 8.7 Hz, 2H), 7.81 (d, J = 8.4 Hz, 2H), 9.85 (s, 1H).
Synthesis of 2-Chloro-1-morpholin-4-ylethanone
(45)
45 was synthesized by performing
diminutive
changes in the reported procedure.[43,44] A solution
of morpholine (0.87 g, 10.0 mmol) in DCM was added dropwise to an
ice cold vigorously stirred solution of equimolar proportions of chloroacetyl
chloride (1.13 g, 10.0 mmol) and triethylamine (1.50 g, 15.0 mmol)
in DCM. The mixture was brought to room temperature after 30 min and
allowed to stir for additional 3 h. After 3 h, the reaction mass was
evaporated under reduced pressure and the resulting crude product
was purified by column chromatography (employing a mobile phase of
DCM/methanol/2 M methanolicammonia 90:10:2), yielding the desired
product 45 as dark brown oil (1.45 g, yield 89%): bp
292–296 °C (lit. 294 °C);[44]1H NMR (400 MHz, CDCl3, TMS) δ 3.25–3.37
(m, 4H), 3.42 (t, J = 4.8 Hz, 2H), 3.45 (t, J = 4.8 Hz, 2H), 3.89 (s, 2H).
Synthesis of 4-(2-Morpholin-4-yl-2-oxoethoxy)benzaldehyde
(46)
46 was synthesized in the
same manner
as that for compound 37 by using equimolar proportions
of 4-hydroxybenzaldehyde (2.00 g, 16.4 mmol) and 45 (2.67
g, 16.4 mmol) utilizing potassium carbonate (3.40 g, 24.6 mmol) as
a base. The reaction mixture was refluxed for 6 h and the product
was purified by column chromatography (employing a mobile phase of
ethyl acetate/methanol/2 M methanolicammonia 90:10:2) to yield 46 as dark brown oil (3.10 g, yield 76%): 1H NMR
(400 MHz, CDCl3, TMS) δ 3.40–3.52 (m, 4H),
3.53–3.68 (m, 4H), 5.01 (s, 2H), 7.11 (d, J = 8.6 Hz, 2H), 7.86 (d, J = 8.6 Hz, 2H), 9.87 (s,
1H).
Synthesis of 4-Oxiranylmethoxybenzaldehyde (47)
47 was synthesized in the same manner as
that for compound 37 by using equimolar proportions of
4-hydroxybenzaldehyde (0.50 g, 4.09 mmol) and epibromhydrin (0.56,
4.09 mmol) utilizing potassium carbonate (0.85 g, 6.14 mmol) as a
base. The reaction mass was refluxed for 6 h and the product was purified
by column chromatography (utilizing a mobile phase of n-hexane/ethyl acetate 70:30) to yield compound 47 as
pale brown oil (0.44 g, yield 60%): bp >300 °C (lit. 327 °C);[59]1H NMR (400 MHz, CDCl3, TMS) δ 2.58–2.63 (m, 1H), 2.74 (t, J = 4.6 Hz, 1H), 3.17–3.25 (m, 1H), 3.78 (dd, J = 11.2, 6.2 Hz, 1H), 4.20 (dd, J = 11.2, 3.2 Hz,
1H), 6.84 (d, J = 8.5 Hz, 2H), 7.64 (d, J = 8.5 Hz, 2H), 9.69 (s, 1H).
Synthesis of 4-(2-Hydroxy-3-morpholin-4-ylpropoxy)benzaldehyde
(48)
This compound was synthesized by the procedure
used for compound 37, by alkylating morpholine (0.3 g,
3.44 mmol) with intermediate 47 (0.61 g, 3.44 mmol) utilizing
potassium carbonate (0.70 g, 5.16 mmol) as a base. The reaction mass
was refluxed for 6 h. It was then filtered and concentrated under
vacuum. The resulting crude product was purified by column chromatography
(employing a mobile phase of DCM/methanol/2 M methanolicammonia 90:10:2)
to yield compound 48 as a pale viscous brown oil (0.53
g, yield 58%): 1H NMR (400 MHz, CDCl3, TMS)
δ 2.42–2.75 (m, 6H), 3.61–3.87 (m, 5H), 4.03–4.23
(m, 3H), 7.03 (d, J = 8.7 Hz, 2H), 7.82 (d, J = 8.7 Hz, 2H), 9.86 (s, 1H).
Synthesis of 4-{2-[4-(4-Fluorophenyl)piperazin-1-yl]ethoxy}benzaldehyde
(49)
49 was synthesized in the
same manner as that for compound 37 by using equimolar
proportions of compound 41 (0.46 g, 2.50 mmol) and 4-fluorophenylpiperazine
(0.45 g, 2.50 mmol) utilizing potassium carbonate (0.52 g, 3.75 mmol)
as a base. The reaction was refluxed for 48 h and the product was
purified by column chromatography (utilizing a mobile phase of n-hexane/ethyl acetate 70:30) to obtain compound 49 as a pale brown oil (0.50 g, yield 61%): 1H NMR (400
MHz, CDCl3, TMS) δ 2.53–2.76 (m, 4H), 2.79
(t, J = 5.4 Hz, 2H), 2.98–3.21 (m, 4H), 4.11
(t, J = 5.4 Hz, 2H), 6.71–6.82 (m, 2H), 6.87
(t, J = 8.7 Hz, 2H), 6.93 (d, J =
8.7 Hz, 2H), 7.73 (d, J = 8.4 Hz, 2H), 9.77 (s, 1H).
General Procedure for Synthesis of Compounds 50–73
To a well stirred suspension having
equimolar proportions of compound 36 and the corresponding
benzaldehyde (commercially available or synthesized) in toluene (3–10
mL) was added ammonium acetate (1–1.5 equiv). The reaction
mass was refluxed until completion (1–24 h) and intermittently
monitored using TLC. Upon completion of the reaction, the toluene
was evaporated under vacuum and the ensuing mass was purified by either
column chromatography or preparative TLC to obtain the desired compound.
The isolated compound was washed with water and dried under vacuum
to yield the title compounds 50–73.
Synthesis of (Z)-2-Benzylidene-3-oxo-2,3-dihydrobenzofuran-7-carboxamide
(50)
The title compound was prepared according
to general procedure using 36 (0.07 g, 0.39 mmol), ammonium
acetate (0.03 g, 0.39 mmol), and benzaldehyde (0.04 g, 0.39 mmol),
and the mixture was refluxed for 2 h. It was purified by column chromatography
(ethyl acetate/methanol 95:5) and obtained as a pale yellow solid
(0.07 g, yield 70%): mp 212–214 °C; 1H NMR
(400 MHz, DMSO-d6, TMS) δ 7.05 (s,
1H), 7.24 (t, J = 7.3 Hz, 1H,), 7.40 (t, J = 7.7 Hz, 1H,), 7.50 (m, 3H), 7.87 (s, 1H), 7.95 (m, 2H),
8.06 (m, 2H). Anal. Calcd for C16H11NO3·1H2O: C, 67.84; H, 4.63; N, 4.94. Found: C, 67.56;
H, 4.51; N, 4.80.
Synthesis of (Z)-3-Oxo-2(3′-phenoxybenzylidene)-2,3-dihydrobenzofuran-7-carboxamide
(51)
The title compound was obtained following
the general procedure using 36 (0.1 g, 0.56 mmol), ammonium
acetate (0.06 g, 0.78 mmol), and 3-phenoxybenzaldehyde (0.11 g, 0.56
mmol). The reaction mass was refluxed for 24 h and purified by column
chromatography (ethyl acetate/methanol 95:5) to yield pale yellow
solid (0.13 g, yield 65%): mp 195–198 °C; 1H NMR (400 MHz, DMSO-d6, TMS) δ
7.05 (s,1H), 7.06–7.10 (m, 3H), 7.17 (t, J = 7.4 Hz, 1H), 7.37–7.44 (m, 3H), 7.50 (t, J = 8.1 Hz, 1H), 7.64 (s, 1H), 7.79 (s, 1H), 7.84 (d, J = 7.9 Hz, 1H), 7.91 (s, 1H), 7.93 (dd, J = 7.6,
1.4 Hz, 1H), 8.04 (dd, J = 7.6, 1.3 Hz, 1H). Anal.
Calcd for C22H15NO4·1/2H2O: C, 72.12; H, 4.23; N, 3.92. Found: C,
71.98; H, 4.76; N, 3.49.
Synthesis of (Z)-2-(4′-Chlorobenzylidene)-3-oxo-2,3-dihydrobenzofuran-7-carboxamide
(52)
The title compound was synthesized as per
the general procedure using 36 (0.1 g, 0.56 mmol), ammonium
acetate (0.05 g, 0.6 mmol), and 4-chlorobenzaldehyde (0.08 g, 0.56
mmol), and the mixture was refluxed for 4 h. It was purified by column
chromatography (ethyl acetate/methanol 95:5) to yield a pale yellow
solid (0.11 g, yield 62%): mp 290–293 °C; 1H NMR (400 MHz, DMSO-d6, TMS) δ
8.06 (d, J = 7.1 Hz, 3H), 7.94 (d, J = 7.1 Hz, 2H), 7.57 (d, J = 8.5 Hz, 2H), 7.39 (t, J = 7.6 Hz, 1H), 7.07 (s, 1H), 7.82 (s, 1H). Anal. Calcd
for C16H10ClNO3: C, 64.12; H, 3.36;
N, 4.67. Found: C, 64.56; H, 3.43; N, 4.30.
Synthesis of (Z)-2-(4′-Hydroxy-3′-methoxybenzylidene)-3-oxo-2,3-dihydrobenzofuran-7-carboxamide
(53)
The title compound was prepared according
to the general procedure using 36 (0.1 g, 0.56 mmol),
ammonium acetate (0.06 g, 0.78 mmol), and 4-hydroxy-3-methoxybenzaldehyde
(0.09 g, 0.56 mmol), and the mixture was refluxed for an hour. The
product obtained was purified by column chromatography (ethyl acetate/methanol
95:5) to yield bright yellow solid (0.14 g, yield 80%): mp 268–270
°C; 1H NMR (400 MHz, DMSO-d6, TMS) δ 3.87 (s, 3H), 6.88 (d, J = 7.9 Hz,
1H,), 6.98 (s, 1H), 7.34–7.41 (m, 2H), 7.85 (s, 1H), 7.91 (d, J = 7.2 Hz, 1H,), 7.96 (s, 2H), 8.05 (d, J = 7.4 Hz, 1H,), 9.94 (s, 1H). Anal. Calcd for C17H13NO5·2/3H2O: C, 63.16; H, 4.47; N, 4.33. Found: C, 63.26; H, 4.77; N, 4.41.
Synthesis of (Z)-2-(4′-Methoxybenzylidene)-3-oxo-2,3-dihydrobenzofuran-7-carboxamide
(54)
The title compound was synthesized by following
the general procedure using 36 (0.15 g, 0.84 mmol), ammonium
acetate (0.07 g, 0.84 mmol), and 4-methoxybenzaldehyde (0.11 g, 0.84
mmol). The reaction mass was refluxed for 1.5 h and purified by column
chromatography (ethyl acetate/methanol 95:5) to yield a bright yellow
solid (0.20 g, yield 80%): mp 248–250 °C; 1H NMR (400 MHz, DMSO-d6, TMS) δ
3.84 (s, 3H), 7.04 (s, 1H), 7.07 (d, J = 7.6 Hz,
2H), 7.37 (t, J = 7.5 Hz, 1H), 7.82 (s, 1H), 7.87–7.99
(m, 2H), 8.03 (d, J = 7.2 Hz, 3H). Anal. Calcd for
C17H13NO4·1/2H2O: C, 67.10; H, 4.64; N, 4.60. Found: C, 67.29;
H, 4.45; N, 4.54.
Synthesis of (Z)-2-(2′-Hydroxybenzylidene)-3-oxo-2,3-dihydrobenzofuran-7-carboxamide
(55)
The compound was obtained by following
the general procedure using 36 (0.13 g, 0.73 mmol), ammonium
acetate (0.06 g, 0.78 mmol), and 2-hydroxybenzaldehyde (0.09 g, 0.73
mmol). The mixture was refluxed for 6 h and purified by column chromatography
(ethyl acetate/methanol 95:5) to yield a pale yellow solid (0.08 g,
yield 56%): mp 239–241 °C; 1H NMR (400 MHz,
DMSO-d6, TMS) δ 6.92 (t, J = 7.5 Hz, 1H), 6.97 (d, J = 8.0 Hz, 1H),
7.28–7.35 (m, 2H), 7.38 (t, J = 7.5 Hz, 1H),
7.84–7.90 (m, 2H), 7.92 (d, J = 7.8 Hz, 1H),
8.04 (d, J = 7.5 Hz, 1H), 8.20 (d, J = 7.5 Hz, 1H), 10.58 (s, 1H). Anal. Calcd for C16H11NO4·1/2H2O: C, 66.20; H, 4.17; N, 4.83. Found: C, 66.29; H, 4.43; N, 4.52.
Synthesis of (Z)-2-(3′-Hydroxybenzylidene)-3-oxo-2,3-dihydrobenzofuran-7-carboxamide
(56)
The title compound was prepared according
to the general procedure using 36 (0.10 g, 0.56 mmol),
ammonium acetate (0.05 g, 0.60 mmol), and 3-hydroxybenzaldehyde (0.07
g, 0.56 mmol), and the mixture was refluxed for 4 h. It was purified
by column chromatography (ethyl acetate/methanol 95:5) to obtain a
pale yellow solid (0.09 g, yield 61%): mp 238–240 °C; 1H NMR (400 MHz, DMSO-d6, TMS)
δ 6.90 (d, J = 8.0 Hz, 1H), 6.94 (s, 1H), 7.29
(t, J = 8.0 Hz, 1H), 7.35–7.42 (m, 2H), 7.51
(d, J = 7.6 Hz, 1H), 7.83–7.90 (m, 2H), 7.93
(d, J = 7.6 Hz, 1H), 8.05 (d, J =
7.3 Hz, 1H), 9.75 (s, 1H). Anal. Calcd for C16H11NO4: C, 64.21; H, 4.38; N, 4.68. Found: C, 64.10; H, 4.43;
N, 4.78.
Synthesis of (Z)-2-(4′-Hydroxybenzylidene)-3-oxo-2,3-dihydrobenzofuran-7-carboxamide
(57)
The target compound was prepared by following
the general procedure using 36 (0.10 g, 0.56 mmol), ammonium
acetate (0.05 g, 0.60 mmol), and 4-hydroxybenzaldehyde (0.07 g, 0.56
mmol). The reaction mass was refluxed for 4 h and purified by column
chromatography (ethyl acetate/methanol 95:5) to obtain a pale yellow
solid (0.10 g, yield 67%): mp 298–300 °C; 1H NMR (400 MHz, DMSO-d6, TMS) δ
6.89 (d, J = 8.6 Hz, 2H), 6.99 (s, 1H), 7.36 (t, J = 7.6 Hz, 1H), 7.85 (s, 1H), 7.88–7.94 (m, 4H),
8.02 (d, J = 7.6 Hz, 1H), 10.35 (s, 1H). Anal. Calcd
for C16H11NO4: C, 64.21; H, 4.38;
N, 4.68. Found: C, 64.65; H, 4.43; N, 4.90.
Synthesis of (Z)-2-(3′,4′-Dihydroxybenzylidene)-3-oxo-2,3-dihydrobenzofuran-7-carboxamide
(58)
The title compound was synthesized according
to the general procedure using 36 (0.07 g, 0.39 mmol),
ammonium acetate (0.05 g, 0.60 mmol), and 3,4-dihydroxybenzaldehyde
(0.05 g, 0.39 mmol), and the mixture was refluxed for 4 h. The reaction
mixture was purified by column chromatography (ethyl acetate/methanol
95:5) to obtain a dark brown solid (0.17 g, yield 56%): mp 257–259
°C; 1H NMR (400 MHz, DMSO-d6, TMS) δ 6.81–6.94 (m, 2H), 7.30–7.49 (m, 2H),
7.77–7.88 (m, 2H), 7.90 (d, J = 7.5 Hz, 1H),
8.02 (d, J = 7.3 Hz, 1H), 9.23 (bs, 1H), 9.92 (bs,
1H). Anal. Calcd for C16H11NO5·1H2O: C, 61.15; H, 3.83; N, 4.46. Found: C, 61.52; H, 3.91; N,
5.14.
Synthesis of (Z)-2-(2′,4′-Dihydroxybenzylidene)-3-oxo-2,3-dihydrobenzofuran-7-carboxamide
(59)
The target compound was prepared according
to the general procedure using 36 (0.07 g, 0.39 mmol),
ammonium acetate (0.03 g, 0.39 mmol), and 2,4-dihydroxybenzaldehyde
(0.05 g, 0.39 mmol). The reaction lasted for almost 10 h and the mixture
was purified by column chromatography (ethyl acetate/methanol 95:5)
to obtain a brick red solid (0.19 g, yield 65%): mp >300 °C; 1H NMR (400 MHz, DMSO-d6, TMS)
δ 6.81–6.94 (m, 2H), 7.30–7.49 (m, 2H), 7.77–7.88
(m, 2H), 7.90 (d, J = 7.5 Hz, 1H), 8.02 (d, J = 7.3 Hz, 1H), 9.23 (bs, 1H), 9.92 (bs, 1H). Anal. Calcd
for C16H11NO5: C, 64.65; H, 3.73;
N, 4.71. Found: C, 64.76; H, 3.98; N, 4.60.
Synthesis of (Z)-2-(3′,5′-Dihydroxybenzylidene)-3-oxo-2,3-dihydrobenzofuran-7-carboxamide
(60)
The title compound was synthesized according
to the general procedure using 36 (0.07 g, 0.39 mmol),
ammonium acetate (0.03 g, 0.39 mmol), and 3,5-dihydroxybenzaldehyde
(0.05 g, 0.39 mmol). The mixture was refluxed for 18 h and the title
compound was purified by column chromatography (ethyl acetate/methanol
95:5) to obtain a light brown solid (0.19 g, yield 65%): mp >300
°C; 1H NMR (400 MHz, DMSO-d6, TMS)
δ 6.39 (s, 1H), 6.81 (s, 1H), 6.87 (s, 2H), 7.38 (t, J = 7.4 Hz, 1H), 7.76 (s, 1H), 7.87 (s, 1H), 7.92 (d, J = 6.8 Hz, 1H), 8.05 (d, J = 7.6 Hz, 1H),
9.54 (s, 2H). Anal. Calcd for C16H11NO5: C, 64.65; H, 3.73; N, 4.71. Found: C, 64.52; H, 3.43; N, 5.14.
Synthesis of (Z)-2-(2′,5′-Dihydroxybenzylidene)-3-oxo-2,3-dihydrobenzofuran-7-carboxamide
(61)
The target compound was synthesized following
the general procedure using 36 (0.07 g, 0.39 mmol), ammonium
acetate (0.03 g, 0.39 mmol), and 2,5-dihydroxybenzaldehyde (0.05 g,
0.39 mmol), and the mixture was refluxed for 21 h. The title compound
was purified by column chromatography (ethyl acetate/methanol 95:5)
to obtain a dark brown solid (0.16 g, yield 55%): mp >300 °C; 1H NMR (400 MHz, DMSO-d6, TMS)
δ 6.78 (s, 1H), 6.80 (s, 1H), 7.25 (s, 1H), 7.38 (t, J = 7.4 Hz, 1H), 7.54 (s, 1H), 7.78 (s, 1H), 7.87 (s, 1H),
7.92 (d, J = 7.5 Hz, 1H), 8.05 (d, J = 7.5 Hz, 1H), 9.04 (s, 1H), 9.85 (s, 1H). Anal. Calcd for C16H11NO5: C, 64.65; H, 3.73; N, 4.71.
Found: C, 64.90; H, 4.03; N, 4.59.
Synthesis of (Z)-2-[3′-(2-Morpholin-4-ylethoxy)benzylidene]-3-oxo-2,3-dihydrobenzofuran-7-carboxamide
(62)
The title compound was synthesized according
to the general procedure using 36 (0.07 g, 0.39 mmol),
ammonium acetate (0.03 g, 0.39 mmol), and compound 37 (0.09 g, 0.39 mmol), and the mixture was refluxed for 6 h and purified
by flash chromatography (employing a mobile phase of ethyl acetate/methanol/2
M methanolicammonia 90:10:2) to yield a bright yellow solid (0.11
g, yield 68%): mp 189–193 °C; 1H NMR (400 MHz,
DMSO-d6, TMS) δ 2.55–2.62
(m, 4H), 2.75 (t, J = 5.6 Hz, 2H), 3.59 (t, J = 4.0 Hz, 4H), 4.18 (t, J = 5.6 Hz, 2H),
7.02 (s, 1H), 7.06 (d, J = 8.4 Hz, 1H), 7.40 (t, J = 7.8 Hz, 2H), 7.59 (d, J = 7.5 Hz, 1H),
7.72 (s, 1H), 7.86 (s, 1H), 7.93 (d, J = 8.3 Hz,
1H), 7.96 (d, J = 8.4 Hz, 1H), 8.07 (d, J = 7.4 Hz, 1H). Anal. Calcd for C22H22N2O5·3/4H2O:
C, 64.77; H, 5.81; N, 6.87: found: C, 65.12; H, 5.74; N, 6.90.
Synthesis
of (Z)-3-Oxo-2-[3′-(2-piperidine-1-ylethoxy)benzylidene]-2,3-dihydrobenzofuran-7-carboxamide
(63)
The target compound was prepared by following
the general procedure using 36 (0.09 g, 0.50 mmol), ammonium
acetate (0.04 g, 0.50 mmol), and compound 38 (0.12 g,
0.50 mmol). The mixture was refluxed for 4 h and purified by flash
chromatography (employing a mobile phase of ethyl acetate/methanol/2
M methanolicammonia 90:10:2) to obtain bright yellow solid (0.12
g, yield 61%): mp 187–191 °C; 1H NMR (400 MHz,
DMSO-d6, TMS) δ 1.09–1.28
(m, 2H), 1.33–1.58 (m, 8H), 2.74 (t, J = 5.4
Hz, 2H), 4.18 (t, J = 5.6 Hz, 2H), 7.03 (s, 1H),
7.05 (d, J = 8.0 Hz, 1H), 7.40 (t, J = 8.0 Hz, 2H), 7.60 (d, J = 6.9 Hz, 1H), 7.71 (s,
1H), 7.92 (s,1H), 7.96 (d, J = 8.0 Hz, 2H), 8.06
(d, J = 6.9 Hz, 1H). Anal. Calcd for C23H24N2O4: C, 70.39; H, 6.16; N, 7.14.
Found: C, 70.26; H, 6.39; N, 7.49.
Synthesis of (Z)-3-Oxo-2-[4′-(2-piperidine-1-ylethoxy)benzylidene]-2,3-dihydrobenzofuran-7-carboxamide
(64)
The title compound was synthesized according
to the general procedure using 36 (0.11 g, 0.60 mmol),
ammonium acetate (0.05 g, 0.60 mmol), and 40 (0.14 g,
0.60 mmol). The reaction mixture was refluxed for 10 h and purified
by flash chromatography (employing a mobile phase of ethyl acetate/methanol/2
M methanolicammonia 90:10:5) to yield a bright yellow solid (0.13
g, yield 66%): mp 210–213 °C; 1H NMR (400 MHz,
DMSO-d6, TMS) δ 1.33–1.41
(m, 2H), 1.49 (q, J = 5.6 Hz, 4H), 2.43 (s, 4H),
2.67 (t, J = 5.4 Hz, 2H), 4.16 (t, J = 5.9 Hz, 2H), 7.03 (s, 1H), 7.06 (d, J = 8.7 Hz,
2H), 7.37 (t, J = 7.6 Hz, 1H), 7.82 (s, 1H), 7.91
(d, J = 7.3 Hz, 1H), 7.93 (s, 1H), 8.01 (d, J = 8.3 Hz, 2H), 8.04 (s, 1H). Anal. Calcd for C23H24N2O4·1/2H2O: C, 68.81; H, 6.28; N, 6.98. Found: C, 68.96; H, 6.28;
N, 6.98.
Synthesis of (Z)-2-[4′-(2-Morpholin-4-ylethoxy)benzylidene]-3-oxo-2,3-dihydrobenzofuran-7-carboxamide
(65)
The title compound was prepared according
to the general procedure using 36 (0.12 g, 0.70 mmol),
ammonium acetate (0.06 g, 0.70 mmol), and compound 39 (0.17 g, 0.70 mmol), and the mixture was refluxed for 5 h. It was
purified by flash chromatography (employing a mobile phase of ethyl
acetate/methanol/2 M methanolicammonia 90:10:2) to obtain a bright
yellow solid (0.17 g, yield 64%): mp 216–220 °C; 1H NMR (400 MHz, DMSO-d6, TMS)
δ 2.46–2.48 (m, 4H), 2.71 (t, J = 5.3
Hz, 2H), 3.58 (t, J = 4.4 Hz, 4H), 4.19 (t, J = 5.5 Hz, 2H), 7.03 (s, 1H), 7.08 (d, J = 8.4 Hz, 2H), 7.37 (t, J = 7.6 Hz, 1H), 7.82 (s,
1H), 7.91 (d, J = 7.8 Hz, 1H), 7.94 (s, 1H), 8.01
(d, J = 8.4 Hz, 2H), 8.04 (s, 1H). Anal. Calcd for
C22H22N2O5·1/2H2O: C, 65.50; H, 5.75; N, 6.94: found: C,
65.73; H, 5.74; N, 6.90.
Synthesis of (Z)-2-{4′-[2-(4-Methylpiperazin-1-yl)ethoxy]benzylidene}-3-oxo-2,3-dihydrobenzofuran-7-carboxamide
(66)
The target compound was synthesized following
the general procedure using 36 (0.08 g, 0.45 mmol), ammonium
acetate (0.03 g, 0.45 mmol), and 42 (0.13 g, 0.45 mmol),
and the mixture was refluxed for 12 h. It was purified by preparative
TLC (employing a mobile phase of DCM/methanol/2 M methanolicammonia
90:10:2) to yield compound 66 as a yellowish brown solid
(0.11 g, yield 62%): mp 210–212 °C; 1H NMR
(400 MHz, DMSO-d6, TMS) δ 2.24 (s,
3H), 2.30–2.47 (m, 5H), 2.52–2.66 (m, 3H), 2.72 (t, J = 5.1 Hz, 2H), 4.17 (t, J = 5.4 Hz, 2H),
7.03 (s, 1H), 7.07 (d, J = 8.4 Hz, 2H), 7.37 (t, J = 7.5 Hz, 1H), 7.82 (s, 1H), 7.91 (d, J = 7.9 Hz, 1H), 7.94 (s, 1H), 7.99–8.06 (m, 3H). Anal. Calcd
for C23H25N3O4·1/2H2O: C, 66.40; H, 6.29; N, 10.09.
Found: C, 66.76; H, 6.55; N, 9.74.
Synthesis of (Z)-2-[4′-(3-Morpholin-4-ylpropoxy)benzylidene]-3-oxo-2,3-dihydrobenzofuran-7-carboxamide
(67)
The target compound was prepared as per
the general procedure using 36 (0.39 g, 2.20 mmol), ammonium
acetate (0.15 g, 2.20 mmol), and 44 (0.55 g, 2.20 mmol).
The reaction mass was refluxed for 4 h and purified by column chromatography
(employing a mobile phase of DCM/methanol/2 M methanolicammonia 90:10:2)
to yield compound 67 as a bright yellow solid (0.61 g,
yield 68%): mp 186–190 °C; 1H NMR (400 MHz,
DMSO-d6, TMS) δ 1.91 (q, J = 7.0 Hz, 2H), 2.32–2.40 (m, 4H), 2.43 (t, J = 7.4 Hz, 2H), 3.58 (t, J = 4.3 Hz, 4H),
4.12 (t, J = 6.0 Hz, 2H), 7.04 (s, 1H), 7.06 (d, J = 8.0 Hz, 2H), 7.38 (t, J = 7.6 Hz, 1H),
7.83 (s, 1H), 7.92 (d, J = 8.2 Hz, 1H), 7.95 (s,
1H), 7.99–8.06 (m, 3H). Anal. Calcd for C23H24N2O5·1/2H2O: C, 66.17; H, 6.04; N, 6.71. Found: C, 65.91; H, 6.01;
N, 6.69.
Synthesis of (Z)-2-[4′-(2-Morpholin-4-yl-2-oxoethoxy)benzylidene]-3-oxo-2,3-dihydrobenzofuran-7-carboxamide
(68)
The target compound was synthesized according
to the general procedure using 36 (0.39 g, 2.20 mmol),
ammonium acetate (0.15 g, 2.20 mmol), and compound 46 (0.55 g, 2.20 mmol), and the mixture was refluxed for 15 h and purified
by column chromatography (employing a mobile phase of DCM/methanol/2
M methanolicammonia 90:10:2) to yield compound 68 as
a yellowish brown solid (0.68 g, yield 76%): mp 258–260 °C; 1H NMR (400 MHz, DMSO-d6, TMS)
δ 3.41–3.51 (m, 4H), 3.51–3.68 (m, 4H), 4.98 (s,
2H), 7.04 (s, 1H), 7.06 (d, J = 7.8 Hz, 2H), 7.38
(t, J = 7.7 Hz, 1H), 7.83 (s, 1H), 7.90–8.06
(m, 5H). Anal. Calcd for C22H20N2O6: C, 64.70; H, 4.94; N, 6.86. Found: C, 65.06; H, 4.81;
N, 6.80.
Synthesis of (Z)-2-(4′-Oxiranylmethoxybenzylidene)-3-oxo-2,3-dihydrobenzofuran-7-carboxamide
(69)
The title compound was obtained according
to the general procedure using 36 (0.39 g, 2.20 mmol),
ammonium acetate (0.15 g, 2.20 mmol), and 47 (0.39 g,
2.20 mmol). The reaction mixture was refluxed for 8 h and purified
by column chromatography (employing a mobile phase of n-hexane/ethyl acetate 60:40) to yield compound 69 as
a yellowish brown solid (0.44 g, yield 59%): mp 167–170 °C; 1H NMR (400 MHz, DMSO-d6, TMS)
δ 2.71–2.76 (m, 1H), 2.88 (t, J = 4.6
Hz, 1H), 3.36–3.39 (m, 1H), 3.94 (dd, J =
11.2, 4.2 Hz, 1H), 4.46 (dd, J = 11.2, 3.2 Hz, 1H),
7.05 (s, 1H), 7.11 (d, J = 8.8 Hz, 2H), 7.39 (t, J = 8.2 Hz, 1H), 7.84 (s, 1H), 7.93 (d, J = 7.1 Hz, 2H), 7.96 (s, 1H), 8.04 (d, J = 8.2 Hz,
2H). Anal. Calcd for C19H15NO5: C,
67.65; H, 4.48; N, 4.15. Found: C, 67.41; H, 4.57; N, 4.13.
Synthesis
of (Z)-2-[4′-(2-Hydroxy-3-morpholin-4-ylpropoxy)benzylidene]-3-oxo-2,3-dihydrobenzofuran-7-carboxamide
(70)
The target compound was prepared by following
the general procedure using 36 (0.39 g, 2.20 mmol), ammonium
acetate (0.15 g, 2.20 mmol), and compound 48 (0.58 g,
2.20 mmol). The reaction mass was refluxed for 18 h and purified by
column chromatography (employing a mobile phase of DCM/methanol/2
M methanolicammonia 90:10:2) to yield 70 as a yellowish
brown solid (0.48 g, yield 52%): mp 210–212 °C; 1H NMR (400 MHz, DMSO-d6, TMS) δ
2.34–2.47 (m, 6H), 3.57 (t, J = 4.3 Hz, 4H),
3.93–4.05 (m, 2H), 4.10 (d, J = 7.2 Hz, 1H),
4.97 (s, 1H), 7.04 (s, 1H), 7.08 (d, J = 8.5 Hz,
2H), 7.38 (t, J = 7.7 Hz, 1H), 7.83 (s, 1H), 7.92
(d, J = 7.6 Hz, 1H), 7.95 (s, 1H), 8.00–8.07
(m, 3H). Anal. Calcd for C23H24N2O6·1H2O: C, 62.43; H, 5.92; N, 6.33: found:
C, 62.19; H, 5.74; N, 6.59.
Synthesis of (Z)-2-(4′-{2-[4-(4-Fluorophenyl)piperazin-1-yl]ethoxy}benzylidene)-3-oxo-2,3-dihydrobenzofuran-7-carboxamide
(71)
The title compound was prepared as per
the general procedure using 36 (0.39 g, 2.20 mmol), ammonium
acetate (0.15 g, 2.20 mmol), and 49 (0.72 g, 2.20 mmol),
and the mixture was refluxed for 8 h and purified by column chromatography
employing a mobile phase of n-hexane/ethyl acetate
50:50 to yield compound 71 as a bright yellow solid (0.62
g, yield 58%): mp 206–208 °C; 1H NMR (400 MHz,
DMSO-d6, TMS) δ 2.65 (t, J = 4.9 Hz, 4H), 2.79 (t, J = 5.8 Hz, 2H),
3.09 (t, J = 4.4 Hz, 4H), 4.24 (t, J = 6.0 Hz, 2H), 6.90–7.13 (m, 8H), 7.38 (t, J = 7.7 Hz, 1H), 7.83 (s, 1H), 7.92 (d, J = 7.1 Hz,
1H), 7.95 (s, 1H), 8.00–8.03 (m, 2H). Anal. Calcd for C28H26FN3O4·1H2O: C, 65.55; H, 5.40; N, 8.19. Found: C, 65.15; H, 5.62; N, 7.98.
Synthesis of (Z)-2-{4-[2-(4-Methylpiperazin-1-yl)ethanesulfonylamino]benzylidene}-3-oxo-2,3-dihydrobenzofuran-7-carboxamide
(72)
Compound 72 was prepared by
following the general procedure using 36 (0.39 g, 2.20
mmol), ammonium acetate (0.15 g, 2.20 mmol), and compound 72d (0.68 g, 2.20 mmol). The reaction mass was refluxed for 6 h and
purified by column chromatography (mobile phase of DCM/methanol/2
M methanolicammonia 90:10:2) to yield 72 as a yellowish
brown solid (0.55 g, 52%): mp 265–268 °C; 1H NMR (400 MHz, DMSO-d6, TMS) δ
1.88 (s, 3H), 2.43–2.47 (m, 4H), 2.59–2.68 (m, 4H),
3.16 (t, J = 7.1 Hz, 2H), 4.02 (t, J = 7.7 Hz, 2H), 7.01 (s, 1H), 7.11 (d, J = 8.1 Hz,
2H), 7.37 (t, J = 8.0 Hz, 1H), 7.80–7.93 (m,
4H), 7.96–8.16 (m, 3H). Anal. Calcd for C23H26N4O5S·1.5H2O: C, 57.25;
H, 5.71; N, 11.61. Found: C, 57.51; H, 5.62; N, 11.87.
Synthesis
of (Z)-2-(4-(3-(4-Methylpiperazin-1-yl)propylsulfonamido)benzylidene)-3-oxo-2,3-dihydrobenzofuran-7-carboxamide
(73)
The title compound was prepared by following
the general procedure using 36 (0.39 g, 2.20 mmol), ammonium
acetate (0.15 g, 2.20 mmol), and compound 72e (0.71 g,
2.20 mmol). The reaction mass was refluxed for 8 h and purified by
column chromatography (mobile phase of DCM/methanol/2 M methanolicammonia 90:10:2) to yield 73 as a yellowish brown solid
(0.60 g, 55%): mp 287–290 °C; 1H NMR (400 MHz,
DMSO-d6, TMS) δ 1.85 (s, 3H), 2.36–2.47
(m, 4H), 3.29–3.41 (m, 4H), 3.60 (q, J = 7.6
Hz, 2H), 3.84 (t, J = 7.4 Hz, 2H), 4.13 (t, J = 7.1 Hz, 2H), 7.03 (s, 1H), 7.24–7.32 (m, 2H),
7.39 (t, J = 8.2 Hz, 1H), 7.84 (s, 1H), 7.86–7.98
(m, 3H), 8.06 (d, J = 8.3 Hz, 3H). Anal. Calcd for
C24H28N4O5S·1H2O: C, 57.36; H, 6.02; N, 11.15. Found: C, 57.46; H, 5.75;
N, 11.46.
Synthesis of 4-Aminobenzaldehyde (72a)
72a was synthesized by following the same
protocol as
that of compound 6 by treating 4-nitrobenzaldehyde (1.0
g, 6.6 mmol) with tin chloride dihydrate (4.5 g, 19.8 mmol) in refluxing
ethyl acetate for 4 h. The reaction was worked up as per the above-mentioned
procedure (for compound 6) and the sample purified by
column chromatography (n-hexane/ethyl acetate 50:50)
to yield compound 72a as pale yellow solid (0.46 g, yield
58%): mp 69–72 °C (lit. 70–72 °C);[60]1H NMR (400 MHz, DMSO-d6, TMS) δ 5.91 (s, 2H), 6.78 (d, J = 8.4 Hz, 2H), 7.89 (d, J = 8.4 Hz, 2H), 9.76 (s,1H).
Synthesis of 2-Chloro-N-(4-formylphenyl)ethanesulfonamide
(72b)
72b was synthesized by following
the same procedure as for compound 45 by using equimolar
proportions of 72a (1.21 g, 10.0 mmol), chloroethanesulfonyl
chloride (1.63 g, 10.0 mmol), and triethylamine (1.0 g, 10.0 mmol).
The mixture was allowed to stir at room temperature for 6 h and the
product was purified by column chromatography (n-hexane/ethyl acetate 80:20) to yield compound 72b as
a pale brown solid (1.70 g, 70%): 1H NMR (400 MHz, DMSO-d6, TMS) δ 3.35 (t, J =
7.1 Hz, 2H), 3.52 (t, J = 7.0 Hz, 2H), 7.45 (d, J = 8.8 Hz, 2H), 7.72 (s, 1H), 8.05 (d, J = 8.9 Hz, 2H), 9.95 (s, 1H).
Synthesis of 3-Chloro-N-(4-formylphenyl)propane-1-sulfonamide
(72c)
The title compound was synthesized in
the same way as that of compound 45 using equimolar proportions
of 72a (1.21 g, 10.0 mmol), chloropropanesulfonyl chloride
(1.77 g, 10.0 mmol), and triethylamine (1.0 g, 10.0 mmol). The mixture
was allowed to stir at room temperature for 6 h and the product was
purified by column chromatography (n-hexane/ethyl
acetate 80:20) to yield compound 72c as a white solid
(1.69 g, 65%): 1H NMR (400 MHz, CDCl3, TMS)
δ 3.78 (q, J = 7.1 Hz, 2H), 3.95 (t, J = 7.2 Hz, 2H), 4.35 (t, J = 7.1 Hz, 2H),
7.31 (d, J = 7.5 Hz, 2H), 7.80 (s, 1H), 8.09 (d, J = 7.5 Hz, 2H), 9.90 (s, 1H).
Synthesis of N-(4-Formylphenyl)-2-(4-methylpiperazin-1-yl)ethanesulfonamide
(72d)
72d was obtained in the same
way as that of compound 37 using equimolar proportions
of 72b (1.20 g, 5.0 mmol), N-methylpiperazine
(0.5 g, 5.0 mmol), and potassium carbonate (1.0 g, 7.5 mmol) when
refluxed for 6 h, and the product was purified by column chromatography
(mobile phase of DCM/methanol/2 M methanolicammonia 90:10:2) to yield 72d as a pale brown solid (0.96 g, 62%): 1H NMR
(400 MHz, DMSO-d6, TMS) δ 2.10 (s,
3H), 2.67–2.89 (m, 6H), 3.15–3.21 (m, 4H), 3.46 (t, J = 7.1 Hz, 2H), 7.39 (d, J = 8.8 Hz, 2H),
7.69 (s, 1H), 7.90 (d, J = 8.9 Hz, 2H), 9.91 (s,
1H).
Synthesis of N-(4-Formylphenyl)-3-(4-methylpiperazin-1-yl)propane-1-sulfonamide
(72e)
Compound 72e was obtained
in the same way as that of compound 37 using equimolar
proportions of 72c (2.61 g, 10.0 mmol), N-methylpiperazine (1.0 g, 10.0 mmol), and potassium carbonate (2.1
g, 15.0 mmol) when refluxed for 6 h, and the product was purified
by column chromatography (mobile phase of DCM/methanol/2 M methanolicammonia 90:10:2) to yield 72e as a pale brown solid (1.75
g, 54%): 1H NMR (400 MHz, CDCl3, TMS) δ
1.73–1.95 (m, 4H), 2.06–2.40 (m, 7H), 3.62 (q, J = 7.2 Hz, 2H), 3.85 (t, J = 7.5 Hz, 2H),
4.12 (t, 7.3 Hz, 2H), 7.33 (d, J = 7.5 Hz, 2H), 7.69
(s, 1H), 7.92 (d, J = 7.5 Hz, 2H), 9.90 (s, 1H).
Biological Methods. PARP-1 Inhibition Assay
Inhibitory
activity of the synthesized PARP-1 inhibitors was determined using
a commercially available 96-well assay kit (catalog no. 4677-096-K;
universal colorimetricPARP assay kit from Trevigen, Inc., Gaithersburg,
MD) according to the instructions provided by the manufacturer (with
diminutive modifications) and our prior reports.[21,22] Briefly, the stock solutions of the various test compounds were
made in dimethylsulfoxide (DMSO) and then serially diluted with distilled
water to the required concentrations. In the beginning the strip wells
were rehydrated by adding 50 μL of 1× PARP buffer into
each well followed by incubation for 30 min. After 30 min, the microplate
strip plate was tapped a few times upside down onto the paper towels.
Care was taken to avoid the splashing of the sample back into wells.
The paper towels were discarded after each tapping to ensure thorough
drying before proceeding with the assay. In the first phase of the
assay, the ribosylation reaction was initiated into the wells by adding
10 μL of the inhibitor solution, 15 μL of diluted PARP-1
enzyme (providing 0.5 unit/well), and 25 μL of PARPcocktail
(containing of biotinylated NAD+, activated DNA in Tris-Cl,
pH 8.0, and EDTA). They were serially added into each well (PARP buffer
was added instead of the inhibitor solution and enzyme solution in
the case of the blank reading, while PARP buffer was added instead
of the inhibitor solution in the case of the negative control). 3-Aminobenzamide
(3-AB), veliparib, and olaparib were used as positive controls. The
strip wells were then incubated at room temperature for 60 min and
then washed twice with 200 μL of a 0.1% Triton solution in phosphate
buffered saline (PBS: Na2HPO4, NaH2PO4, and NaCl) and twice with 200 μL of PBS. The
wells were dried thoroughly as mentioned before and then a 50 μL
of diluted Strep-HRP (containing a mixture of 1× Strep diluent
and Strep-HRP enzyme in distilled water, respectively) was added to
each well, and the strips were further incubated at room temperature
for 60 min to detect the degree of ribosylation. After the wells were
washed twice with 200 μL of 0.1% Triton solution in PBS and
200 μL of PBS, the wells were dried and 50 μL of TACS-Sapphire
colorimetric substrate was added to each well and allowed to stand
in the dark for 10–15 min. The intensity of the blue color
that developed in each well was measured on a microplate reader at
630 nm. Reaction was stopped by the addition of 50 μL of 5%
phosphoric acid to each well, and the absorbance was measured at 450
nm. All samples were tested in triplicate. Compounds that inhibited
PARP-1 activity by ≥50% at a concentration of 25 μM (in
the case of DHBF-7-carboxamide derivatives) and 10 μM (in the
case of DHBF-3-one-7-carboxamide derivatives) were further tested
to obtain IC50 values. To determine the IC50 value for each inhibitor, dose–response curves were generated
with five to six different concentrations, averaging absorbance values
of each inhibitor concentration (values correlated after deducting
the blank reading). The data were plotted against the log of the concentration
of each respective inhibitor (semilog plot), and the IC50 value for each plot was obtained using regression wizard from Sigma
Plot, version 10.0 (San Jose, CA). Data presented are the results
of at least two independent experiments done in triplicate. The results
of these studies are presented as the mean ± standard deviation
(SD).
Cell Lines
Chicken DT40 B cell lines used in this study
were obtained from the laboratory of Dr. Takeda; Laboratory of Radiation
Genetics, Graduate School of Medicine, Kyoto University (Kyoto, Japan).
Measurement of Cellular Sensitivity to Drugs
To measure
drug cytotoxicity, cells were continuously exposed to various drug
concentrations for 72 h in triplicate. Two-hundred DT40 cells were
seeded into 384-well white plate (no. 6007680 PerkinElmer Life Sciences)
in 40 μL of medium per well. Cell viability was determined using
the ATPlite one-step kit (PerkinElmer). A 20 μL ATPlite solution
was added to each well. After 5 min, luminescence was measured by
EnVision 2104 multilabel reader (PerkinElmer). The ATP level in untreated
cells was defined as 100%. Percent viability of treated cells was
defined as (ATP level of treated cell/ATP level of untreated cells)
× 100. Further information on this assay is described in ref (61).
Molecular Modeling
Computational work was carried out
on a Dell Precision 490 dual processor workstation with the Linux
operating system (Ubuntu 12.04 LTS). The initial protein structure
of PARP-1 bound with benzoxazinone inhibitor (PDBcode 4L6S)[32] was refined by default parameters in Protein Preparation
Wizard implemented in Maestro, version 9.5, and the Impact program,
version 6.0 (Schrödinger, LLC, New York, NY, 2013), in which
the protonation states of the ionizable residues were treated to their
dominant ionic forms at physiological pH. Refined PARP structure was
further used to generate a defined grid centered on a bound benzoxazinone
inhibitor. Proposed and synthesized inhibitors were docked using the
bound inhibitor grid. The inhibitory structures were built using the
build tool in Maestro, version 9.5, and energy-minimized by the Macromodel
program, version 10.1 (Schrödinger, LLC., New York, NY, 2013),
using the steepest descent followed by truncated Newton conjugate
gradient protocol. LigPrep tool, version 2.7, was used to obtain the
low-energy 3D structures of all inhibitors. Default settings were
used, but the “Generate Tautomers” option was not selected.
Resultant inhibitor structures were docked within the active site
of PARP-1 using the “Extra Precision” (XP) mode of Glide
docking program, version 6.0, and the default parameters. The images
were generated using PYMOL, version 1.6.
Cloning and Protein Production
The Zn1/Zn3 (a fusion
of residues 1–96 and residues 207–366) and the WGR-CAT
(residues 518–1014) fragments of PARP-1 used for crystallography
were expressed from the pET24 expression vector with a C-terminal
hexahistidine tag as previously described.[62] PARP-1 proteins were expressed in Escherichia coli and purified as previously described using a three-column purification
protocol.[63]
Crystallization of the
PARP-1/DNA Complex
Crystals
of the activated PARP-1complex were grown as previously published
with minor modification.[23] In brief, crystals
were grown in sitting drop vapor diffusion at 20 °C in 3.0 μL
droplets that combined a 2.1 μL mixture of protein (300 μM
Zn1/Zn3 and WGR-CAT in 25 mM Hepes, pH 8.0, 150 mM NaCl, 1 mM EDTA,
and 0.1 mM TCEP) with 475 μM 26-bp palindromic DNA duplex (5′
GCCTACCGGTTCGCGAACCGGTAGGC 3′) and 0.9 μL
of well solution (6.8% PEG 3350, 2% ethylene glycol, and 100 mM Hepes,
pH 7.5). Crystals were grown to their largest size after approximately
3–4 weeks, upon which they were collected and soaked with inhibitors
by hanging drop diffusion at 22 °C in 7 μL droplets consisting
of 5 mM inhibitor in well solution (6.5% PEG 3350, 1.9% ethylene glycol,
5% DMSO, 75 mM NaCl, 0.5 mM EDTA, 0.05 mM TCEP, and 95 mM Hepes, pH
7.5). After 1–7 days of soaking, crystals were quickly transferred
to a cryo solution (3% PEG 3350, 25% ethylene glycol, 25 mM NaCl,
0.05 mM TCEP, 25 mM Hepes, pH 7.5, and 5 mM inhibitor in 5% DMSO)
prior to flash-cooling in liquid nitrogen. X-ray diffraction data
were collected at beamline X29A of the National Synchrotron Light
Source (NSLS, Brookhaven National Laboratory), and processed using
Xia2 (Supporting Information Table S1).[64]
Structure Determination and Refinement
The structure
of activated PARP-1 (PDBcode 4DQY)[23] was used
as a starting model. The weighted Fo – Fc electron density maps calculated after rigid
body refinement in REFMAC5 from the CCP4 suite resulted in significant
difference density in one catalytic domain of the two present in the
asymmetric unit, which was used to position the inhibitor. As with
the original structure, the second copy of the PARP-1complex is not
as well-defined, presumably because of flexibility. Thus, the bound
compounds were only modeled in one copy of the catalytic domain. The
inhibitors were placed according to their benzamide portion of DHBF
scaffold, which has a well-established binding site. The constructed
model was refined in REFMAC5 using restrained and TLS refinement.[65] The refined models exhibit good geometry and
agree well with the original structure 4DQY, and the bound compounds are well represented
in the final electron density maps (Figure 3). Coordinates and structure factors have been deposited in the Protein
Data Bank (see Table S1 for the PDB entries).
Absolute Configuration Determination for 12a
The absolute structure of (R)-(−)-12a with (S)-(−)-α-methylbenzylamine
was confirmed based on 1215 Bijvoet pairs measured with Cu Kα
radiation on a Bruker Kappa Apex-II DUO diffractometer. Refinement
of the Flack parameter[66] resulted in X = −0.12(15), and the Hooft parameter[67] was Y = −0.09(7), corresponding
to a probability of 1.000 that the configuration shown in Figure 2 is correct, in agreement with the known (S)-configuration of the amine. (CCDC 977479; full details
are in Supporting Information Tables S2–S8).
Authors: Thomas D Penning; Gui-Dong Zhu; Viraj B Gandhi; Jianchun Gong; Sheela Thomas; Wilfried Lubisch; Roland Grandel; Wolfgang Wernet; Chang H Park; Elizabeth H Fry; Xuesong Liu; Yan Shi; Vered Klinghofer; Eric F Johnson; Cherrie K Donawho; David J Frost; Velitchka Bontcheva-Diaz; Jennifer J Bouska; Amanda M Olson; Kennan C Marsh; Yan Luo; Saul H Rosenberg; Vincent L Giranda Journal: Bioorg Med Chem Date: 2008-05-27 Impact factor: 3.641
Authors: Richard A Hartz; Vijay T Ahuja; Maria Rafalski; William D Schmitz; Allison B Brenner; Derek J Denhart; Jonathan L Ditta; Jeffrey A Deskus; Eddy W Yue; Argyrios G Arvanitis; Snjezana Lelas; Yu-Wen Li; Thaddeus F Molski; Harvey Wong; James E Grace; Kimberley A Lentz; Jianqing Li; Nicholas J Lodge; Robert Zaczek; Andrew P Combs; Richard E Olson; Ronald J Mattson; Joanne J Bronson; John E Macor Journal: J Med Chem Date: 2009-07-23 Impact factor: 7.446
Authors: Ana M Mendes-Pereira; Sarah A Martin; Rachel Brough; Afshan McCarthy; Jessica R Taylor; Jung-Sik Kim; Todd Waldman; Christopher J Lord; Alan Ashworth Journal: EMBO Mol Med Date: 2009-09 Impact factor: 12.137
Authors: Junko Murai; Shar-yin N Huang; Benu Brata Das; Amelie Renaud; Yiping Zhang; James H Doroshow; Jiuping Ji; Shunichi Takeda; Yves Pommier Journal: Cancer Res Date: 2012-11-01 Impact factor: 13.312
Authors: Gytis Jankevicius; Markus Hassler; Barbara Golia; Vladimir Rybin; Martin Zacharias; Gyula Timinszky; Andreas G Ladurner Journal: Nat Struct Mol Biol Date: 2013-03-10 Impact factor: 15.369