Literature DB >> 24841334

Molecular characterization of Enterotoxigenic Escherichia coli strains isolated from diarrheal patients in Korea during 2003-2011.

Kyung-Hwan Oh1, Dong Wook Kim2, Su-Mi Jung1, Seung-Hak Cho1.   

Abstract

Enterotoxigenic Escherichia coli (ETEC) is one of the major causes of infectious diarrhea in developing countries. In order to characterize the molecular features of human ETEC isolates from Korea, we investigated the profiles of enterotoxin and colonization factor (CF) genes by polymerase chain reaction (PCR) and performed multilocus sequence typing (MLST) with a total of 291 ETEC strains. The specimens comprised 258 domestic strains isolated from patients who had diarrhea and were from widely separated geographic regions in Korea and 33 inflow strains isolated from travelers visiting other Asian countries. Heat-stable toxin (STh)-possessing ETEC strains were more frequent than heat-labile toxin (LT)-possessing ETEC strains in the domestic isolates, while the detection rates of both enterotoxin genes were similar in the inflow isolates. The profile of CF genes of domestic isolates was similar to that of inflow isolates and the major CF types of the strains were CS3-CS21-CS1/PCF071 and CS2-CS3-CS21. Most of these 2 CF types were detected in ETEC strains that possess both lt and sth genes. The major MLSTST types of domestic isolates were ST171 and ST955. Moreover, the 2 major CF types were usually found concomitantly with the 2 major MLST STs, ST171 and ST955. In conclusion, our genotyping results may provide useful information for guiding the development of geographically specific vaccines against human ETEC isolates.

Entities:  

Mesh:

Substances:

Year:  2014        PMID: 24841334      PMCID: PMC4026316          DOI: 10.1371/journal.pone.0096896

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Enterotoxigenic Escherichia coli (ETEC) is a major cause of diarrhea and diarrheal deaths among young children and travelers in developing countries [1], [2]. The major virulence factors of diarrhea-causing ETEC strains are enterotoxins, that is, a heat-labile toxin (LT) and a heat-stable toxin (ST), that induce the watery diarrhea. The LT is an AB5 toxin with similarities to cholera toxin; it binds to ADP ribosylates the guanyl-nucleotied alpha regulatory binding protein of the adenylcyclase system thereby causing increased cyclic AMP levels. The ST is a small peptide molecule that activates guanylylcyclase, leading to the production of increased intracellular levels of cyclic GMP. The presence of the LT and/or ST leads to alterations in cellular signaling pathways that ultimately trigger increased chloride secretion and watery diarrhea [3], [4]. The LT toxin is encoded by eltAB, whereas the ST toxin is encoded by 2 different genes, estA and st1, which produce STh (originally isolated from ETEC in humans) and STp (originally from a pig isolate) [3]–[5]. Many ETEC strains also produce surface colonization factors (CFs), which mediate adherence to the small intestinal wall. To date, over 25 human ETEC CFs have been described and divided into 3 different families: (1) CFA/I-like group, including CFA/1, CS1, CS2, CS4, CS14, and CS17; (2) CS5-like group, including CS5, CS7, CS18, and CS20; and (3) another unique group, including CS3, CS6, and CS10 to CS12 [2], [6]. Targeting virulence factors such as toxins and CFs are the most effective approaches for ETEC vaccine development strategy [7], [8]. Human ETEC strains that originate from the same ETEC lineage may have inherited many of the same epidemiological and phenotypic traits. Therefore, defining these lineages could provide an additional basis on which to understand ETEC epidemiology and for identifying new vaccine antigens. Although several methods are available for performing lineage definition studies, multilocus sequence typing (MLST) is now widely adopted. MLST is a sequence-based typing system based on determination of short nucleotide sequences (approximately 500 bp) of 7 housekeeping genes and has recently become the method of choice for bacterial typing [9]. To identify ETEC lineages in the present study, we performed MLST and phylogenetic analyses on a collection of human ETEC strains isolated from diarrheal patients in Korea and travelers in different developing countries. We have reported the distribution of the genes that encode enterotoxins and their associated CF types, as well as the antibiotic susceptibility profile of ETEC isolates obtained from patients with diarrhea between 2003 and 2011 in Korea.

Materials and Methods

Identification of Bacterial Isolates as ETEC

A total of 291 human clinical isolates were collected between the years 2003 to 2011 through a routine surveillance system, which performed laboratory examination to isolate clinical specimens from stools of diarrheal patients in Korea and positively identified as ETEC. To avoid any bias in data analysis, information related to the patients was blinded during the analysis of the isolates. Among these 291 isolates, 258 strains were isolated from patients with diarrhea in widely separated geographic regions in Korea (domestic isolates) and 33 ETEC strains were isolated from travelers visiting other Asian countries (1 from Mongolia, 3 from Vietnam, 1 from Egypt, 1 from China, 2 from Indonesia, 5 from India, 3 from Cambodia, 6 from Thailand, 1 from Turkey, 9 from Philippines, and 1 from Hong Kong) between 2010 and 2011 (inflow isolates). Individual colonies from positive ETEC samples were analyzed using separate polymerase chain reaction (PCR) assays for the LT and STh genes. Bacteria were directly inoculated into 3 mL of Luria-Bertani broth for enrichment and incubated overnight at 37°C under shaking conditions. After incubation, the enriched broth culture was centrifuged at 13,000 rpm (Sorvall, Biofuge Pico, Germany) for 1 min, and the pellet was heated at 100°C for 10 min. After centrifugation of the lysate, 5 mL of the supernatant was used for PCR. The primers used for detection of the LT genes were LT-F (GTACTTCGATAGAGGAACTCAAATGAATAT) and LT-R (ATTCTGGGTCTCCTCATTACAAGTATC), and those used for detection of STh genes were STh-F (TTCGCTCAGGATGCTAAACCA) and STh-R (TTAATAGCACCCGGTACAAGCAGG).

Detection of CF Genes

To detect CF genes, multiplex PCR assays were performed using the primers shown in Table 1. PCR assays were carried out in a 50 mL volume with 2U DNA Taq polymerase (Takara Ex Taq, Japan) in a thermal cycler (PTC-100; MJ Research, Watertown, MA, USA) under the following conditions: initial denaturation at 94°C for 5 min; 30 cycles each of 94°C for 1 min, 55°C for 1 min, 72°C for 1 min; and final cycle at 72°C for 5 min. The amplified PCR products were analyzed by gel electrophoresis in 2% agarose gels stained with ethidium bromide, visualized with ultraviolet illumination, and imaged with the Gel Doc 2000 documentation system (Bio-Rad, Hercules, CA, USA).
Table 1

Primer pairs of multiplex PCR for the detection of CFs.

Multiplex PCR groupSFsPrimer nameSequence (5′ to 3′)Product size (bp)References
Group 1CFAICFAI-FTGAGTGCTTCWGCAGTAGAGA20420
CFAI-R CAGCAAGTTTAACAATTACTTTTTTAGT
CS6CS6-F GGAGTGGTAAATGCAGGAAACT 41620
CS6-R GTACCAGACGAATATCCGCTATTA
CS4CS4-FTGAGTGCTTCWGCAGTAGAGA30020
CS4-R AAGTCACATCTGCGGTTGATAGAG
CS14CS14-FTGAGTGCTTCWGCAGTAGAGA35720
CS14-R TACTATTCGAAACACCTGCCG
Group 2CS3CS3-F GGTCTTTCACTGTCAGCTATGAGTT 13620
CS3-R TAATGTTAAATTATCCTGAGGAGCC
CS5CS5-F GCGTGACACGTCAGCTAATATAAAC 23520
CS5-R GGCATTCATATCAATAGAAATATGAGAC
CS7CS7-F TGCTCCCGTTACTAAAAATACG 41820
CS7-R GGCATTCATATCAATAGAAATATGAGAC
CS15CS15-F ATGCGTAGTAAATTATCCATTCTT 36420
CS15-R CTACTATGGGCGTCGTCAT
CS18CS18-F TTTGCTGCACTGCCTGCGAA 50220
CS18-R TAACAGTACCAGCTTTAACCTGAC
CS12CS12-F TTACGTCTCTGATCATGGCTGTTA 56220
CS12-R ATAGTCATTACTGCATTTGCATCAAC
Group 3CS2CS2-F TCTGCTCGTATCAATACCCAAGTT 14020
CS2-R GTGCCAGCGAATGAAACCTCTAAA
CS17/19CS17/19-FACTCTRTCGCATTAACCTATTCT16920
CS17/19-R GTCACTTTCATCGGAATTTGCGAG
CS8CS8-FTATGAGCCTKCTGGAAGTYATCAT52620
CS8-R TATTGTAGTATTATCAGTAGCAGCCA
CS21CS21-FTATGAGCCTKCTGGAAGTYATCAT29220
CS21-R GTTATTACGCACTTCGTCTGGT
CS1/PCF071RCS1/PCF071R-FACTCTRTCGCATTAACCTATTCT33420
CS1/PCF071R-R CCCTGATATTGACCAGCTGTTAGT
CS22CS22-F ATGCGTAGTAAATTATCCATTCTT 44220
CS22-R CATTTTTTTGGAAGGCTTTAATA
Group 4CS13CS13-F TTGATGTGATGGTTATCGCTT 21220
CS13-R AAAATCCAGGGTGGCGATCTG
CS20CS20-F ATGATTATGCCCTTTTAACTATGG 41320
CS20-R CAAGTTTTTGATCGCTTCCAATA

Multilocus Sequence Typing (MLST) Analysis

ETEC isolates were analyzed by MLST. The 7-gene (st7) MLST system of the EcMLST (www.Shigatox.net/mlst) was used for MLST. The MLST is based on the sequencing of internal fragments of the 7 housekeeping genes (aspC, clpX, fadD, icdA, lysP, mdh, and uidA). PCR products of the genes were amplified for each isolate using the primers whose sequences have been shown in Table 2. All PCR reactions were performed in 50-µL volumes using 10–100 ng of boiled bacterial DNA as the template. PCR products were purified using the QIAquick PCR Purification Kit (Qiagen, Hilden, Germany) and were sequenced in both directions using the same primer as that used for PCR. The MLST sequence type (ST) for each combination of alleles from sequences of 7 housekeeping genes was acquired on the EcMLST website and new allele numbers and STs were submitted to the EcMLST website.
Table 2

Primer epairs used for MLST.

LocusPrimer nameSequence (5′ to 3′)Product size (bp)
aspCaspC-F4 GTTTCGTGCCGATGAACGTC 594
aspC-R7 AAACCCTGGTAAGCGAAGTC
clpXclpX-F6 CTGGCGGTCGCGGTATACAA 672
clpX-R1 GACAACCGGCAGACGACCAA
fadDfadD-F6 GCTGCCGCTGTATCACATTT 580
fadD-R3 GCGCAGGAATCCTTCTTCAT
icdAicd-F2 CTGCGCCAGGAACTGGATCT 669
icd-R2 ACCGTGGGTGGCTTCAAACA
lysPlysP-F1 CTTACGCCGTGAATTAAAGG 628
lysP-R8 GGTTCCCTGGAAAGAGAAGC
mdhmdh-F3 GTCGATCTGAGCCATATCCCTAC 650
mdh-R4 TACTGACCGTCGCCTTCAAC
uidAuidA-277F CATTACGGCAAAGTGTGGGTCAAT 658
uidA-277R CCATCAGCACGTTATCGAATCCTT

Phylogenetic Analysis

The MLST sequences were aligned using the ClustalW method, and the phylogenetic trees were generated using the maximum likelihood (ML) method implemented in the PAUP* (Phylogenetic Analysis Using Parsimony, 4.0 b10), RAxML Blackbox webserver. ML topologies were evaluated by bootstrap analysis of 100 ML iterations, implemented in the RAxML web server. Phylogenetic networks of MLST sequences were constructed by the median-joining algorithm using Network 4.6.

Antimicrobial Susceptibility

Antimicrobial susceptibility testing for E. coli isolates was determined with the VITEK 2 automated system using AST- N169 Card (bioMérieux, France) according to the guidelines of the Clinical and Laboratory Standards Institute (CLSI). The following antibiotics were tested: ampicillin, amoxicillin/clavalanic acid, ampicillin/sulbactam, cephalothin, cefotaxime, cefotetan, cefoxitin, cefazolin, ceftriaxone, imipenem, chloramphenicol, gentamicin, amikacin, nalidixic acid, ciprofloxacin, tetracycline, trimethoprim/sulfamethoxazole. E. coli ATCC 25922 was used for quality control.

Statistical Analysis

GraphPad Prism version 6 was used for statistical analysis. For comparisons of two variables, chi-square test or Fisher exact test was used. A P value <0.05 was considered statistically significant.

Results

Profile of Enterotoxin and CF Genes in Domestic and Inflow Isolates

The 291 human ETEC strains represented 3 different enterotoxin profiles: ETEC-LT strains, ETEC-STh strains and ETEC-LT/STh strains. The profile of enterotoxin genes of domestic isolates was somewhat different from that of inflow isolates. In the domestic isolates, ETEC-LT/STh strains constituted 47.3% of the isolates, while ETEC-LT and ETEC STh accounted for only 16.3% and 36.4%. As shown in Table 3, a greater number of STh-possessing ETEC (ETEC-STh and ETEC-LT/STh) strains were detected than LT-possessing ETEC (ETEC-LT and ETEC-LT/STh) strains (83.7% vs. 63.6%) in the domestic ETEC cases. The detection rates of the 3 enterotoxin types were similar in the inflow isolates: ETEC-LT (36.4%, 12 of 33 strains), ETEC-STh (33.3%, 11 of 33 strains), and ETEC-LT/STh (30.3%, 10 of 33 strains). The frequency of ETEC-LT/STh strains was significantly higher in the domestic isolates than in the inflow isolates (P value <0.05).
Table 3

Prevalence of enterotoxins of ETEC isolates.

Enterotoxin typesNo. of Domestic isolates (n = 258)No. of Inflow isolates (n = 33) P valuea
LT42 (16.3%)12 (36.4%)0.008
STh94 (36.4%)11 (33.3%)0.443
LT/STh122 (47.3%)10 (30.3)0.047

Data represent results of the Fisher exact test comparing toxin types in domestic isolates and inflow isolates.

Data represent results of the Fisher exact test comparing toxin types in domestic isolates and inflow isolates. The CF gene profile of the domestic isolates was similar to that of inflow isolates. As shown in Figure 1, CS3 was predominantly isolated in both domestic and inflow human ETEC isolates (35% and 30%, respectively). In the domestic isolates, CS21, CS1/PCF071, CS2, CS6, and CS14 were frequently detected. In the inflow isolates, CS6, CS21, CS2, CS1/PCF071 and CS8 were frequently present. The proportion of CF-non typable strains was also high in both isolate groups (Figure 1 and Table S1, Table S2).
Figure 1

Profile of colonization factor (CF) genes in domestic and inflow isolates.

Ten non-typable strains were directly examined by electron microscopy. Seven (70%) among the ten strains possessed fimbriae (data not shown). This result indicates that the seven strains express CFs, but the genes encoding the CFs do not react with the PCR primers used in this study. Moreover, one hundred strains of all were re-confirmed CFs using mono-PCR with primers described in Rodas et al., 2009 (data not shown). The prevalent types of CF genes in the domestic isolates were CS3-CS21-CS1/PCF071, CS2-CS3-CS21, CS6, and CS14 and the major CF types of the inflow isolates were CS3-CS21-CS1/PCF071, CS6, and CS2-CS3. Interestingly, most strains of the CS3-CS21-CS1/PCF071 and CS2-CS3-CS21 types were detected in ETEC-LT/STh strains. The CS6 type was found more often in LT-possessing ETEC strains, while the CS14 type was more frequent in STh-possessing ETEC strains (Table 4).
Table 4

Prevalence of CFs and enterotoxins of ETEC isolates.

CF typesDomestic isolatesInflow isolates
No. of CFs-typeNo. of LTNo. of SThNo. of LT/SThNo. of CFs-typeNo. of LTNo. of SThNo. of LT/STh
CS3-CS21-CS1/PCF0713802364004
CS2-CS3-CS213100311001
CS62211746600
CS14152940000
CS2-CS351045014
CS360060000
CS3-CS2160060000
CS21-CS1/PCF07130030000
CS2110013030
CS3-CS1/PCF07130030000
CS6-CS800002101
CS3-CS4-CS1/PCF07110010000
CS220110000
CS1211000000
CS1311000000
CS4-CS611000000
CS4-CS6-CS2100001010
NT12225752211560
Total258429412233121110

NT; non typable.

NT; non typable.

MLST Analyses of the Isolates

MLST of the 258 domestic human ETEC isolates represented 65 different MLST STs: 21 sequence types were known STs, and 44 new STs were recovered (Table S3). ST171 were the most common, with a frequency of 24% (62/258) and were constantly represented in each year between 2003 and 2011. The other predominant STs were ST955 (21%, 53/258) and ST964, ST656 (7%, 18/258) (Figure 2 and Table S1). Analysis of the 33 inflow isolates identified 16 different STs, which contained 7 new STs (43.8%, Table S3). The most frequent ST type was ST949, that is, 15% (5/33), and this was followed by ST171, ST273, ST951 (12%, 4/33), ST713 (9%, 3/33) and ST705, ST955 (6%, 2/33) (Figure 2 and Table S2). Interestingly, 8 STs (ST273, ST706, ST710, ST713, ST733, ST951, ST960, and ST961) were found only in inflow ETEC isolates, and not in domestic isolates. ST171 strains represented various CF types, including 2 major CF types (CS3-CS21-CS1/PCF071 and CS2-CS3-CS21) and other CF types (CS6, CS3, CS21-CS1/PCF071, CS2-CS3, CS3-CS1/PCF071, CS14, and CS12). ST955 strains also showed various CF types: CS3-CS21-CS1/PCF071, CS2-CS3-CS21, CS3-CS21, CS3-CS1/PCF071, CS2-CS3, CS6, and CS12. As shown in Table 5, 2 major CF types, CS3-CS21-CS1/PCF071 and CS2-CS3-CS21, were usually found in the 2 major domestic MLST STs, ST171 and ST955; 89% (34/38) of strains possessing the CS3-CS21-CS1/PCF071 type and 93% (29/31) of strains possessing the CS2-CS3-CS21 type were found in the 2 major MLST STs. However, there were more NT (not typeable) CF types in the strains of other MLST STs.
Figure 2

MLST sequence types in domestic and inflow isolates.

Table 5

Prevalence of MLST sequence types and CF types of domestic and inflow isolates.

Isolate groupsMajor MLST sequence types (n)No. of major – and oter CF types
CS3-CS21-CS1/PCF071CS2-CS3-CS21CS6CS14CS2-CS3Etc.NT
Domestic isolatesST171 (62)1513302821
ST955 (53)191610278
ST964 (18)01000017
ST656 (18)00100017
ST949 (8)2020004
Inflow isolatesST949 (5)0010013
ST171 (4)0100003
ST273 (4)4000000
ST951 (4)0000400

etc.: Includes types present at lower incidence than the major types, NT; non typable.

etc.: Includes types present at lower incidence than the major types, NT; non typable. The phylogenetic trees of the STs analyzed above were generated and compared with those of 3 other reference strains (E. coli K12, EHEC EDL933, and ETEC H10407). Phylogenetic analysis showed that 7 STs (ST971, ST782, ST965, ST656, ST964, ST966, and ST963) were closely related to those of E. coli K12. EHEC EDL933 also has a close phylogenetic relationship with some STs such as ST988, ST737, ST985, ST986, ST982, and ST259. ETEC H10407 represented the ST171 type as similar as other many ETEC strains (Figure 3).
Figure 3

Phylogenetic networks of the isolates according to MLST STs.

The sizes of the circles are proportional to the number of MLST STs. The major MLST STs such as ST171 and ST955 were 23% (66/291) and 19% (55/291).

Phylogenetic networks of the isolates according to MLST STs.

The sizes of the circles are proportional to the number of MLST STs. The major MLST STs such as ST171 and ST955 were 23% (66/291) and 19% (55/291).

Antibiotic Resistance Analyses of the Isolates

Antibiotic resistance rates of domestic and inflow isolates are shown in Table 6. The isolates of both groups showed a higher resistance to ampicillin (30% and 49%, respectively), nalidixic acid (38% and 36%, respectively), and trimethoprim-sulfamethoxazole (26% and 27%, respectively) when compared with other antibiotics. Resistance to imipenem and amikacin was not found in any ETEC strains. The inflow isolates conferred a stronger resistance to antibiotics of the cephem class. However, no significant association was found between the ETEC genotype and antimicrobial susceptibility.
Table 6

Comparison of antibiotic resistance of domestic and inflow isolates.

Antibicrobial agentsAntibiotic resistances (%) of isolates
Domestic isolatesInflow isolates
β-lactams
Ampicillin (AM)3049
β-lactam/β-lactamase inhibitor combinations
Ampicillin-sulbactam (SAM)1128
Amoxicillin/Clavulanic Acid (AMC)33
Cephems
Cephalothin (CF)1227
Cefazolin (CZ)1021
Ceftriaxone (CRO)312
Cefotaxime (CTX)312
Cefoxitin (FOX)20
Carbapenems
Imipenem (IPM)00
Quinolones
Nalidixic Acid (NA)3836
Ciprofloxacin (CIP)20
Aminoglycosides
Amikacin (AN)00
Gentamicin (GM)50
Tetracyclines
Tetracycline (TE)2918
Phenicols
Chloramphenicol (C)30
Folate pathway inhibitors
Trimethoprim-sulfamethoxazole (SXT)2627

Discussion

ETEC is an important pathogen responsible for traveler’s diarrhea and causes about 700,000 childhood deaths per year, mostly in young children [10]. A variety of strategies have been pursued in attempts to develop a vaccine against ETEC. The most promising vaccine candidate to date is a killed whole-cell vaccine comprising different ETEC strains that express the most prevalent enterotoxins and CFs [11], [12]. The relative proportions of enterotoxin- and CF-possessing isolates seem to vary from 1 geographical area to another in both diarrhea and control patients with ETEC infection [2]. Our results also showed that the proportions of enterotoxins were different between the domestic and inflow isolates. The proportion of enterotoxin types of the domestic isolates identified here is similar to those for other studies conducted in Bangladesh [13] and Egypt [14], while other studies in Argentina [15], India [16], and Peru [17] reported that LT-producing ETEC were predominant. Clemens et al. [19] reported that ETEC strains that only express the LT are considered less important as pathogens. The identification of CFs is more important for epidemiological studies and for the development of CF-based vaccines against ETEC because ETEC organisms carrying more than 1 CF gene are common [20], [21]. In this study, CS3 and CS21 were the most prevalent CFs detected in both domestic and inflow strains. In other studies, CFA/I was the most prevalent CF type [2], [14], [18], while strains possessing CFA/1 were rarely detected in this study. Interestingly, CS6 was found more in inflow strains (17%) than domestic strains (6%). Thus, variations in the prevalence of CF antigens may be related to location. Of strong interest, 2 major prevalent CF gene types were found in ETEC strains isolated in Korea. Moreover, we observed a strong correlation between some CF genes and enterotoxin types. In brief, we have demonstrated that STh and CS3/CS21 genes are the most prevalent enterotoxin and CF genes in the domestic ETEC isolates in Korea. Resistance to common antibiotics such as ampicillin, tetracycline and trimethoprim-sulfamethoxazole was frequently detected in ETEC strains, consistent with reports from other authors [22]–[27]. High-level resistance to antibiotics has developed in part because of heavy clinical use of antibiotics, since these drugs are associated with excellent safety and have a low cost. Therefore, empirical use of these antibiotics should be limited. Moreover, among the cephems, high resistance to cephalothin underscores the importance of ongoing surveillance. However, we did not find any association between the genotypes and antibiotic susceptibility profiles of ETEC strains. MLST is a very useful tool for determination of bacterial lineages [28]–[30]. Therefore, we used MLST to characterize ETEC lineages in association with the distribution of enterotoxin and CF genes. In general, we observed that different MLST STs were associated with different CFs. These genes appeared to be spread across several different lineages. Such genes have been reported to spread through horizontal transfer by transposable elements [31], [32]. However, a strong association was found between the major CF types and MLST types. Two major CF types were usually found in 2 major MLST STs, that is, ST171 and ST955, in the domestic isolates. Currently, there is no licensed vaccine for use against ETEC diarrhea. To our knowledge, this study is the first to report the distribution of enterotoxin and CF genes in ETEC strains from Korea. We have also provided information regarding ETEC lineages, obtained using MLST, and the antimicrobial susceptibility profile of the isolates. Our data on the frequency and geographic association of the various antigenic virulence factors will provide useful information for strategies to develop novel and effective anti-ETEC vaccines. Profile of enterotoxin- and CF genes, MLST sequence types and antobiotic resistance of domestic ETEC isolates. (XLSX) Click here for additional data file. Profile of enterotoxin- and CF genes, MLST sequence types and antobiotic resistance of inflow ETEC isolates. (XLSX) Click here for additional data file. New MLST sequence types of domestic and inflow ETEC isolates. (XLSX) Click here for additional data file.
  30 in total

1.  [Antimicrobial resistance among species of Salmonella, Shigella, Escherichia, and aeromonas isolated from children with diarrhea in 7 Argentinian centers].

Authors:  N Binsztein; A M Picandet; R Notario; E Patrito; M E De Lesa; A De Petris; D Maurel; O Nader; M Rivas; M Szefner; M Vergara
Journal:  Rev Latinoam Microbiol       Date:  1999 Jul-Sep

2.  Clonal clustering and colonization factors among thermolabile and porcine thermostable enterotoxin-producing Escherichia coli.

Authors:  Håvard Valvatne; Hans Steinsland; Halvor Sommerfelt
Journal:  APMIS       Date:  2002-09       Impact factor: 3.205

Review 3.  Colonization factors of human enterotoxigenic Escherichia coli (ETEC).

Authors:  W Gaastra; A M Svennerholm
Journal:  Trends Microbiol       Date:  1996-11       Impact factor: 17.079

4.  Phenotypic characteristics of enterotoxigenic Escherichia coli associated with acute diarrhea among Israeli young adults.

Authors:  Dani Cohen; Joshua Tobias; Anya Spungin-Bialik; Tamar Sela; Raid Kayouf; Yael Volovik; Miri Yavzori; Moshe Ephros
Journal:  Foodborne Pathog Dis       Date:  2010-10       Impact factor: 3.171

Review 5.  Pathogenic Escherichia coli.

Authors:  James B Kaper; James P Nataro; Harry L Mobley
Journal:  Nat Rev Microbiol       Date:  2004-02       Impact factor: 60.633

6.  Design and validation of a multiplex polymerase chain reaction for the identification of enterotoxigenic Escherichia coli and associated colonization factor antigens.

Authors:  Rania A Nada; Hind I Shaheen; Iman Touni; Dina Fahmy; Adam W Armstrong; Matthew Weiner; John D Klena
Journal:  Diagn Microbiol Infect Dis       Date:  2010-03-31       Impact factor: 2.803

7.  Enterotoxigenic Escherichia coli multilocus sequence types in Guatemala and Mexico.

Authors:  Matilda Nicklasson; John Klena; Claudia Rodas; August Louis Bourgeois; Olga Torres; Ann Mari Svennerholm; Asa Sjoling
Journal:  Emerg Infect Dis       Date:  2010-01       Impact factor: 6.883

8.  Development of pathogenicity-driven definitions of outcomes for a field trial of a killed oral vaccine against enterotoxigenic Escherichia coli in Egypt: application of an evidence-based method.

Authors:  John Clemens; Stephen Savarino; Remon Abu-Elyazeed; Mohammad Safwat; Malla Rao; Thomas Wierzba; Ann-Marie Svennerholm; Jan Holmgren; Robert Frenck; Eunsik Park; Abdollah Naficy
Journal:  J Infect Dis       Date:  2004-05-25       Impact factor: 5.226

Review 9.  Enterotoxigenic Escherichia coli virulence factors and vaccine approaches.

Authors:  Donata R Sizemore; Kenneth L Roland; Una S Ryan
Journal:  Expert Rev Vaccines       Date:  2004-10       Impact factor: 5.217

10.  Colonization factors of enterotoxigenic Escherichia coli isolated from children in north India.

Authors:  H Sommerfelt; H Steinsland; H M Grewal; G I Viboud; N Bhandari; W Gaastra; A M Svennerholm; M K Bhan
Journal:  J Infect Dis       Date:  1996-10       Impact factor: 5.226

View more
  13 in total

Review 1.  Pili Assembled by the Chaperone/Usher Pathway in Escherichia coli and Salmonella.

Authors:  Glenn T Werneburg; David G Thanassi
Journal:  EcoSal Plus       Date:  2018-03

2.  Murine immunization with CS21 pili or LngA major subunit of enterotoxigenic Escherichia coli (ETEC) elicits systemic and mucosal immune responses and inhibits ETEC gut colonization.

Authors:  Chengxian Zhang; Junaid Iqbal; Oscar G Gómez-Duarte
Journal:  Vet Microbiol       Date:  2016-02-06       Impact factor: 3.293

3.  Outbreak of CTX-M-15-Producing Enterotoxigenic Escherichia coli O159:H20 in the Republic of Korea in 2016.

Authors:  Jin Seok Kim; Jungsun Park; Eunkyung Shin; Soojin Kim; Sung Suck Oh; Hyo-Jin Yang; Dae-Won Kim; Kyung-Hwan Oh; Yonghoon Kim; Min Kim; Mun Ju Kwon; Kyoungin Na; Jin Lee; En-Hi Cho; Byung-Hak Kang; Hyo-Sun Kwak; Won Keun Seong; Junyoung Kim
Journal:  Antimicrob Agents Chemother       Date:  2017-08-24       Impact factor: 5.191

4.  Comparative genomic analysis of a multiple antimicrobial resistant enterotoxigenic E. coli O157 lineage from Australian pigs.

Authors:  Ethan Wyrsch; Piklu Roy Chowdhury; Sam Abraham; Jerran Santos; Aaron E Darling; Ian G Charles; Toni A Chapman; Steven P Djordjevic
Journal:  BMC Genomics       Date:  2015-03-10       Impact factor: 3.969

5.  Identification and antimicrobial resistance prevalence of pathogenic Escherichia coli strains from treated wastewater effluents in Eastern Cape, South Africa.

Authors:  Martins A Adefisoye; Anthony I Okoh
Journal:  Microbiologyopen       Date:  2016-01-13       Impact factor: 3.139

6.  Comparative genomic analysis and characteristics of NCCP15740, the major type of enterotoxigenic Escherichia coli in Korea.

Authors:  Taesoo Kwon; Si-Yun Chung; Young-Seok Bak; Seung-Hak Cho; Young-Hee Jung; Su-Jin Jung; Sang-Gyun Roh; Je-Seop Park; Cheorl-Ho Kim; Won Kim
Journal:  Gut Pathog       Date:  2017-09-20       Impact factor: 4.181

7.  Comparative genomic analysis of enterotoxigenic Escherichia coli O159 strains isolated from diarrheal patients in Korea.

Authors:  Si-Yun Chung; Taesoo Kwon; Seung-Hak Cho; Won Kim; Young-Seok Bak; Joung Je Park; Cheorl-Ho Kim
Journal:  Gut Pathog       Date:  2019-02-21       Impact factor: 4.181

8.  Petting Zoo Animals as an Emerging Reservoir of Extended-Spectrum β-Lactamase and AmpC-Producing Enterobacteriaceae.

Authors:  Anat Shnaiderman-Torban; Amir Steinman; Gal Meidan; Yossi Paitan; Wiessam Abu Ahmad; Shiri Navon-Venezia
Journal:  Front Microbiol       Date:  2019-10-30       Impact factor: 5.640

9.  The LT1 and LT2 variants of the enterotoxigenic Escherichia coli (ETEC) heat-labile toxin (LT) are associated with major ETEC lineages.

Authors:  Enrique Joffré; Åsa Sjöling
Journal:  Gut Microbes       Date:  2016

10.  Identification and Characterization of Human Monoclonal Antibodies for Immunoprophylaxis against Enterotoxigenic Escherichia coli Infection.

Authors:  Serena Giuntini; Matteo Stoppato; Maja Sedic; Monir Ejemel; Jessica R Pondish; Danielle Wisheart; Zachary A Schiller; William D Thomas; Eileen M Barry; Lisa A Cavacini; Mark S Klempner; Yang Wang
Journal:  Infect Immun       Date:  2018-07-23       Impact factor: 3.441

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.