Literature DB >> 24832664

Micro-eukaryotic diversity in hypolithons from miers valley, antarctica.

Jarishma K Gokul1, Angel Valverde2, Marla Tuffin3, Stephen Craig Cary4, Don A Cowan5.   

Abstract

The discovery of extensive and complex hypolithic communities in both cold and hot deserts has raised many questions regarding their ecology, biodiversity and relevance in terms of regional productivity. However, most hypolithic research has focused on the bacterial elements of the community. This study represents the first investigation of micro-eukaryotic communities in all three hypolith types. Here we show that Antarctic hypoliths support extensive populations of novel uncharacterized bryophyta, fungi and protists and suggest that well known producer-decomposer-predator interactions may create the necessary conditions for hypolithic productivity in Antarctic deserts.

Entities:  

Year:  2013        PMID: 24832664      PMCID: PMC4009862          DOI: 10.3390/biology2010331

Source DB:  PubMed          Journal:  Biology (Basel)        ISSN: 2079-7737


1. Introduction

Microbial life in terrestrial Antarctica soils is subjected to extreme low temperatures, low water availability, high salinity, high UV radiation, and low nutrient availability [1]. However, despite the many adverse environmental constraints this extreme ecosystem has been shown to support extensive microbial biomass [2]. Much of the microbial research in Antarctic terrestrial and aquatic ecosystems has focused on the bacterial populations, and to a lesser extent on the archaea [3,4] and viruses [5,6]. In contrast, eukaryotic microorganisms have received much less attention [7]. Hypolithic communities in the Dry Valleys region of eastern Antarctica colonize the ventral surface of quartz rocks at the rock-soil interface [8,9,10,11]. Hypoliths can be envisioned as a stress-avoidance strategy, where the overlying rock creates a favorable sub-lithic microhabitat with greater physical stability, increased water availability, desiccation buffering, and UV protection [9,12]. As they are typically dominated by cyanobacteria [8,13] or bryophytes [9], hypolithons represent an important contribution to regional productivity [14,15]. Fungal dominated hypoliths have also been described in Antarctica [9]. In an earlier study [11] we characterized the bacterial and eukaryotic phylogenetic diversity of two hypolith types: Type I (cyanobacteria-dominated) and Type III (moss-dominated). Here, we extend this research to Type II hypolithons (fungal-dominated) with a focus on the micro-eukaryotic communities. We also compare all three types of eukaryal communities in terms of habitat preferences.

2. Results and Discussion

Environmental DNA was used as template for construction of three separate clone libraries using universal 18S rRNA, 18S-28S rRNA (ITS), and microalgal 18S rRNA-specific PCR primers (Table 1). A total of 31 unique phylotypes was found (Table 2). Most of the sequences showed low identity values, indicating that the majority of sequences might represent novel taxa. Rarefaction curves (not shown) showed that more extensive sequencing would be required to capture the complete diversity within micro-eukaryotic communities in hypoliths. Incomplete sampling might be aggravated by the inherent limitations of the PCR approach, since several groups of micro-eukaryotes (e.g., multinucleated fungi) have multiple rRNA gene copy numbers that would be preferentially amplified because of primer competition [16].
Table 1

PCR primers used to amplify universal 18S rRNA, Internal Transcribed Spacer (ITS) and microalgal 18S regions of ribosomal RNA genes from eukaryotic microorganisms, and their respective PCR cycling conditions.

Primer SetSequence (5’- 3’)Region of AmplificationPCR ParametersReference
EukAAACCTGGTTGATCCTGCCAGT18S rRNA gene94 °C for 3 min; 30 cycles: 94 °C for 45 s, 50 °C for 1 min, 72 °C for 3 min; 72 °C for 20 min[20]
EukBTGATCCTTCTGCAGGTTCACCTAC
ITS1F CTTGGTCATTTAGAGGAAGTAATCITS1-ITS294 °C for 5 min; 35 cycles: 94 °C for 1 min, 50 °C for 1 min, 72 °C for 1 min; 72 °C for 20 min[21,22]
ITS4CTCCGCTTATTGATATGC
P45 ACCTGGTTGATCCTGCCAGTMicroalgal 18S94 °C for 1 min; 37 cycles: 92 °C for 50 s, 57 °C for 50 s, 72°C for 50 s; 72°C for 10 min[23]
P47TCTCAGGCTCCCTCTCCGGArRNA gene
Table 2

Affiliation of the clones sampled from hypolithic communities.

Representative CloneAccession No.Closest Sequence MatchAccession No.IdentityTypea
Eukaryote 18S rRNA
Euk75-A1KC352912Uncultured Eucalypta (Bryophyta)Y1787181%2/I
Euk75-A7KC352913Uncultured Tortula ruralis (Bryophyta)AF02368278%2/I
Euk75-A8KC352914Uncultured Tortula ruralis (Bryophyta)AF02368286%2/I
Euk75-A12KC352915Uncultured Tortula ruralis (Bryophyta)AF02368286%2/I
Euk75-B2KC352916Uncultured Tortula ruralis (Bryophyta)AF02368292%2/I
Euk75-B9KC352917Saccamoeba limax (Amoebozoa)AF29390298%2/I
Euk75-C4KC352918Platyamoeba contorta (Amoebozoa)DQ22995496%2/I
Euk134-C6KC352919Pottia truncata (Bryophyta)X9593599%4/II
Euk134-D11KC352920Uncultured eukaryoteHM490274100%4/II
Euk50-B10KC352921Uncultured eukaryoteEF02408791%5/III
Euk50-D10KC352922Cercomonas plasmodialis (Cercozoa)AF41126899%5/III
Microalgal 18S RNA
P50-A4KC352936Mnium hornum (Bryophyta)X8098595%5/III
P50-B3KC352937Uncultured eukaryoteEF02484599%5/III
P50-B6KC352938Mnium hornum (Bryophyta)X8098591%5/III
P50-E7KC352939Uncultured eukaryoteEF52688999%5/III
P75-EKC352940Bryoxiphium norvegicum (Bryophyta)AF22300885%2/I
P134-A2KC352941Uncultured eukaryoteFN394778100%4/II
P134-A11KC352942Uncultured eukaryoteHM490274100%4/II
IGS 28S-18S rRNA
ITS65-A1KC352923Uncultured Acremonium (Ascomycota)HE97753882%1/I
ITS65-A2KC352924Uncultured Acremonium (Ascomycota)HE97754485%1/I
ITS65-A5KC352925Uncultured Acremonium (Ascomycota)HE97754485%1/I
ITS65-A8KC352926Uncultured Acremonium (Ascomycota)HE97754478%1/I
ITS65-B6KC352927Uncultured Acremonium (Ascomycota)HE97754488%1/I
ITS65-C12KC352928Uncultured Acremonium (Ascomycota)HE97754488%1/I
ITS65-D2KC352929Uncultured Acremonium (Ascomycota)HE97754487%1/I
ITS65-D10KC352930Stromatonectria caraganae (Ascomycota)HQ11228880%1/I
ITS134-A1KC352931Verrucaria sp. (Ascomycota)FJ66485892%2/II
ITS50-B11KC352932Uncultured Acremonium (Ascomycota)HE97754484%5/III
ITS50-D2KC352933Uncultured Acremonium (Ascomycota)HE97753880%5/III
ITS50-E3KC352934Uncultured Acremonium (Ascomycota)HE97753886%5/III
ITS50-H7KC352935Uncultured Acremonium (Ascomycota)HE97753891%5/III

aSample no./hypolithon type.

Phylotypic analyses demonstrate that diverse communities of micro-eukaryotes inhabit Antarctic hypoliths (Table 2), showing both a broad range of taxa and a large functional diversity, including phototrophs (bryophyta) and a variety of heterotrophic organisms (fungi and protists). However, most of the clones showed low identity values, indicating that the majority of sequences might represent novel taxa. Further studies, using a polyphasic approach (i.e., including a combination of genotypic and phenotypic approaches) will be necessary to confirm this hypothesis. The phylotypic abundance data indicates that ascomycetes were present in all three hypolith types, but also possible habitat preferences for certain groups of eukaryotes. For example, amoebozoa were only found in Type I hypolithons (cyanobacteria dominated) whereas cercozoa were present only in Type III hypolithons (moss dominated) (Figure 1). Cyanobacteria can modify the surrounding environment [17], and play critical roles in the structuring of hypolithic communities [12,18]. For example, cyanobacteria produce UV-screening pigments, enzymes, and carotenoids that quench reactive oxygen species, solute-binding materials, water absorbing gels, antifreeze compounds, and ice-nucleating substances [19], which will reduce oxidative, osmotic, freeze-thaw, and dehydration stresses for all organisms embedded within the matrix. In contrast to open soil, hypoliths are also rich in inorganic nutrients, organic carbon and bacteria [18] that may provide substrates for eukaryotic heterotrophs such as protists and the metazoan microfauna. The presence of saprophytic, phagotrophic, parasitic and predatory eukaryotes would increase the inherent capacity for nutrient and energy transfer, thereby increasing trophic complexity and potential resilience to environmental change [12].
Figure 1

Relative distribution of phylotypes.

Relative distribution of phylotypes. PCR primers used to amplify universal 18S rRNA, Internal Transcribed Spacer (ITS) and microalgal 18S regions of ribosomal RNA genes from eukaryotic microorganisms, and their respective PCR cycling conditions. Fungal sequences were classified into 13 ascomycete phylotypes (Table 2). Most (86%) were related to the genus Acremonium, while some sequences were affiliated to Stromatonectria and Verrucaria (7% each); although it is worth noting that sequence comparisons of the ITS region gave low similarity values (76%–92%). There have been a limited number of molecular diversity studies of hypolithic [11] and soil [7,24] fungi in the Antarctica, some of which show contrasting results. For example, Fell et al. [7] found that both ascomycetes (lichen-forming and decomposers) and basidiomycetes (decomposers and nematode pathogens) were widely distributed in soils, whereas Khan et al. [11] reported ascomycetes as the only members in hypolithic fungal communities. This apparent dichotomy in fungal distribution between open soils and hypolithic communities offers a potential line for future research. Much of the knowledge of fungal communities in Antarctica is based on culture-dependent techniques. To date, over 1,000 non-lichenized fungal species have been recorded [25], including numerous representatives of all of the major fungal groups (ascomycetes, basidiomycetes, zygomycetes and chytrids) but only a single member of the Glomeromycota. The most complete list of Antarctic fungal species known from culturing and collection comprises approximately 68% ascomycetes, 23% basidiomycetes and 5% zygomycetes, with the remaining 4% consisting of oomycetes, chytrids and myxomycetes [26]. Basidiomycetes are commonly associated with old or decaying wood. The complete absence of higher plants in east Antarctica, in particular those with woody components, may represent a significant constraint on the diversity of Antarctic basidiomycetes. Indeed, a recent study has shown that when exotic organic substrates were buried, there was a significant increase in fungal colony-forming units (CFU) in soils in direct contact with the introduced, sterile cellulosic substrates compared to background soil levels [27]. Fungi are often also found in association with bryophyte communities and are thought to exploit the release of dissolved organic C from moss structures due to damage caused by freeze-thaw cycles [28]. The vast majority of Antarctic fungi are mesophiles capable of growing at low temperatures [29]. This, together with their widespread occurrence, could suggest that many Antarctic fungi are particularly resilient cosmopolitan species and therefore likely to be relatively recent colonists [25]. Three OTUs belonging to protists were found (Table 2). Sequences related to amoebozoa showed relatively high homology, 98% and 96%, to members of the genera Saccamoeba and Platyamoeba, respectively. A cercozoa sequence was closely related to the genus Cercomonas (99%). Members of the genera Sacchamoeba, Platyamoeba and Cercomonas have been found previously in Antarctica [30,31] and their abundance and species diversity is greater than that of the nematodes. The protists have generally received much less attention than the bacteria and much of the research on protists is focused on aquatic ecosystems, where these organisms predate bacteria and contribute to the remineralization of major-, minor- and micro-nutrients [32]. In soils, cercozoa and amoeba are known to colonize the pore spaces of soils; however, the smaller pore spaces might provide a more protected or favorable environment with increasing moisture, which might sustain a higher bacterial population and in general, have higher organic matter than a coarser soil fraction with large pore spaces [33]. Amoebae, which are thought to be more resilient than nematodes because of rapid encysting abilities and short life cycle, are thought to be the major predators of bacteria and to make a substantial contribution to carbon and nutrient cycling [34]. Sequences belonging to bryophytes were classified into nine phylotypes (Table 2). In the Antarctic Dry Valleys, bryophytes represent the most “advanced” terrestrial photoautotrophs and are all primary producers providing an additional pathway other than vascular plants for C to enter the soil [35]. However, to our knowledge, there is little information available on hypolithic bryophyte traits. Temperate bryophytes are rich in secondary metabolites such as terpenes and phenolics, which are likely to be allelopathic, affecting decomposition and therefore nutrient cycling [36]. Moreover, mosses can enhance the amount of water infiltrating the soil [37]. Bryophytes do not have stomata and lose water readily from their tissues [38]. They also lack roots, and therefore, they are unable to extract water from depth in a drying soil. Mosses instead depend on the availability of water in the environment, from either humid air, the surface substrate or precipitation. As many species are adapted to survive long periods of desiccation, we suggest that bryophytes may contribute significantly to primary production in periods of moisture sufficiency. Affiliation of the clones sampled from hypolithic communities. aSample no./hypolithon type.

3. Experimental Section

3.1. Samples Collection

Six hypolith samples from all three Types (2 samples per Type) were obtained from Miers Valley (S78°05.01'–S78°05.921', E163°49.496'–E163°48.149'), Antarctica, in January 2011. The hypolithons were selected and classified as Type I, II or III during sampling. Classification was based on gross morphology of the biomass present on the ventral surfaces of the rocks [8,9]. Samples were recovered aseptically and stored in WhirlPak® bags at 4 °C in the field and during transport. Long term storage was at −80 °C in the laboratory, prior to further analysis.

3.2. DNA Extractions and PCR Amplifications

Total soil DNA was extracted using the method described by Von Sigler [39]. Briefly, 1mL of extraction buffer (50 mM NaCl; 50mM Tris-HCl at pH 7.6; 50 mM EDTA; 5% SDS) was added to 1 g of each soil sample in 2 mL vials containing 0.5 g mesh sea-sand. Then, 1 µL of 1M dithiothreitol (DTT) was added and mixed. Samples were shaken for 15 minutes at maximum speed (Vortex Genie 2; Scientific Industries Inc., USA) followed by 3 minutes of centrifugation at 14,000 × g. The supernatant was carefully decanted and 0.5× volumes of chloroform/isoamyl alcohol (24:1) was added to the tubes and mixed. This was followed by centrifugation at 14,000 × g for 3 minutes. The aqueous phase was transferred to a 2 mL sterile tube, and an equal volume of chloroform was added, vortexed and centrifuged as before. The aqueous phase was transferred to a sterile 1.5 mL and precipitated using sodium acetate and isopropanol. After centrifugation the pellet was washed by the addition of 70% ethanol, dry and resuspended in 25 µL of sterile distilled water. The presence of DNA was confirmed by gel electrophoresis on 1% agarose gels, viewed using the AlphaImager 3400 imaging system (Alpha Innotech Co., USA) and quantified using a NanoDrop® ND-1000 UV/Vis Spectrophotometer (NanoDrop Technologies, USA). The primers and parameters used for the PCR amplifications are described in Table 1. Reactions (25 µL) consisted of ~20 ng metagenomic DNA, 1x DreamTaq™ buffer, 0.2 mM of each dNTP, 0.5 µM of each primer and 0.2 U DreamTaq™ DNA polymerase (Fermentas, USA). PCR products were verified on 1% agarose gels and purified with the GFX™ PCR DNA and Band Purification Kit (GE healthcare, USA) and quantified using the NanoDrop® ND-1000 (NanoDrop Technologies, USA).

3.3. Clone Library Construction and Phylogenetic Analysis

Clone libraries were constructed after pooling equal amounts of amplicons from the individual samples for each hypolith type. Aliquots of the pooled products were cloned into Escherichia coli GeneHogs™ (Invitrogen) using pGEM-T cloning kit (Promega, USA) and transformants were selected by blue-white screening. The presence of the correctly sized insert was verified by colony PCR using the M13F and M13R vector primers (Fermentas, USA). ARDRA analysis (using AluI and HaeIII) was used to de-replicate clones. Restriction patterns were visualized on 2% agarose gels and analyzed using Gel-compare II (Applied Maths, Keistraat, Belgium). Plasmid DNA, from a representative of each unique restriction pattern, was extracted with QIAprep Spin Miniprep kit (Qiagen GmbH, Germany) and sequenced using the vector primer M13F with an ABI 3130 DNA Sequencer (Applied Biosystems). Putative chimeric sequences were filtered using Bellerophon [40]. Sequences of >97% identity (for 18S rRNA amplicons) and >95% (for ITS amplicons) were grouped into OTUs using CD-HIT suite [41]. Taxonomic assignments of representative OTUs were determined by BLAST searches of the NCBI GenBank database (http://www.ncbi.nlm.nih.gov/). Sequences obtained in this study were deposited in the NCBI GenBank database under accession numbers KC352912-KC352942.

4. Conclusions

Hypoliths were examined at a single time point using only one molecular approach (i.e., clone libraries). Thus, an in-depth analysis is necessary to elucidate the “true” diversity of the micro-eukaryotes existing in Antarctic hypolithons. However, in spite of its limitations, this baseline study gives insight to the existing micro-eukaryotic community supported by hypoliths in the Miers Dry Valley, Antarctica. We show that these communities are represented by a wide diversity of lower eukaryotes (bryophyta, fungi and protists). The presence of these organisms supports the concept that hypolithic communities constitute complex multi-domain food webs in an environment which is generally considered to be characterised by low diversity and complexity. The phototrophic bryophyte component is thought to provide a significant contribution to primary productivity in periods of moisture sufficiency. Protists feed on bacterial populations and contribute to standing biomass. Fungi participate in decomposition and recycling, maintaining the balance of nutrients in the discrete and “self-contained” hypolithic microhabitats. The hypothesis that the partitioned activity of co-colonizers may create the necessary conditions for sustained hypolithic productivity is currently being tested in our research group.
  16 in total

1.  Comparison of eukaryotic phytobenthic community composition in a polluted river by partial 18S rRNA gene cloning and sequencing.

Authors:  U Dorigo; A Bérard; J F Humbert
Journal:  Microb Ecol       Date:  2002-10-14       Impact factor: 4.552

2.  Ecology: widespread colonization by polar hypoliths.

Authors:  Charles S Cockell; M Dale Stokes
Journal:  Nature       Date:  2004-09-23       Impact factor: 49.962

Review 3.  Microbial colonization and controls in dryland systems.

Authors:  Stephen B Pointing; Jayne Belnap
Journal:  Nat Rev Microbiol       Date:  2012-07-09       Impact factor: 60.633

4.  Hypolithic communities: important nitrogen sources in Antarctic desert soils.

Authors:  D A Cowan; J A Sohm; T P Makhalanyane; D G Capone; T G A Green; S C Cary; I M Tuffin
Journal:  Environ Microbiol Rep       Date:  2011-06-16       Impact factor: 3.541

Review 5.  On the rocks: the microbiology of Antarctic Dry Valley soils.

Authors:  S Craig Cary; Ian R McDonald; John E Barrett; Don A Cowan
Journal:  Nat Rev Microbiol       Date:  2010-02       Impact factor: 60.633

6.  Cryptic microbial communities in Antarctic deserts.

Authors:  Don A Cowan
Journal:  Proc Natl Acad Sci U S A       Date:  2009-11-18       Impact factor: 11.205

7.  Virophage control of antarctic algal host-virus dynamics.

Authors:  Sheree Yau; Federico M Lauro; Matthew Z DeMaere; Mark V Brown; Torsten Thomas; Mark J Raftery; Cynthia Andrews-Pfannkoch; Matthew Lewis; Jeffrey M Hoffman; John A Gibson; Ricardo Cavicchioli
Journal:  Proc Natl Acad Sci U S A       Date:  2011-03-28       Impact factor: 11.205

8.  Temperature-dependent global gene expression in the Antarctic archaeon Methanococcoides burtonii.

Authors:  S Campanaro; T J Williams; D W Burg; D De Francisci; L Treu; F M Lauro; R Cavicchioli
Journal:  Environ Microbiol       Date:  2010-11-08       Impact factor: 5.491

9.  PCR-based diversity estimates of artificial and environmental 18S rRNA gene libraries.

Authors:  Marianne Potvin; Connie Lovejoy
Journal:  J Eukaryot Microbiol       Date:  2009 Mar-Apr       Impact factor: 3.346

10.  Highly specialized microbial diversity in hyper-arid polar desert.

Authors:  Stephen B Pointing; Yuki Chan; Donnabella C Lacap; Maggie C Y Lau; Joel A Jurgens; Roberta L Farrell
Journal:  Proc Natl Acad Sci U S A       Date:  2009-10-22       Impact factor: 11.205

View more
  2 in total

1.  Protection of Antarctic microbial communities - 'out of sight, out of mind'.

Authors:  Kevin A Hughes; Don A Cowan; Annick Wilmotte
Journal:  Front Microbiol       Date:  2015-02-25       Impact factor: 5.640

2.  Comparative Metagenomic Analysis Reveals Mechanisms for Stress Response in Hypoliths from Extreme Hyperarid Deserts.

Authors:  Phuong Thi Le; Thulani P Makhalanyane; Leandro D Guerrero; Surendra Vikram; Yves Van de Peer; Don A Cowan
Journal:  Genome Biol Evol       Date:  2016-09-11       Impact factor: 3.416

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.