Literature DB >> 24799562

Disruption of the mitochondrial alternative oxidase (AOX) and uncoupling protein (UCP) alters rates of foliar nitrate and carbon assimilation in Arabidopsis thaliana.

Anthony Gandin1, Mykhaylo Denysyuk1, Asaph B Cousins2.   

Abstract

Under high light, the rates of photosynthetic CO2 assimilation can be influenced by reductant consumed by both foliar nitrate assimilation and mitochondrial alternative electron transport (mAET). Additionally, nitrate assimilation is dependent on reductant and carbon skeletons generated from both the chloroplast and mitochondria. However, it remains unclear how nitrate assimilation and mAET coordinate and contribute to photosynthesis. Here, hydroponically grown Arabidopsis thaliana T-DNA insertional mutants for alternative oxidase (AOX1A) and uncoupling protein (UCP1) fed either NO3 (-) or NH4 (+) were used to determine (i) the response of NO3 (-) uptake and assimilation to the disruption of mAET, and (ii) the interaction of N source (NO3 (-) versus NH4 (+)) and mAET on photosynthetic CO2 assimilation and electron transport. The results showed that foliar NO3 (-) assimilation was enhanced in both aox1a and ucp1 compared with the wild-type, suggesting that foliar NO3 (-) assimilation is probably driven by a decreased capacity of mAET and an increase in reductant within the cytosol. Wild-type plants had also higher rates of net CO2 assimilation (A net) and quantum yield of PSII (ϕPSII) under NO3 (-) feeding compared with NH4 (+) feeding. Additionally, under NO3 (-) feeding, A net and ϕPSII were decreased in aox1a and ucp1 compared with the wild type; however, under NH4 (+) they were not significantly different between genotypes. This indicates that NO3 (-) assimilation and mAET are both important to maintain optimal rates of photosynthesis, probably in regulating reductant accumulation and over-reduction of the chloroplastic electron transport chain. These results highlight the importance of mAET in partitioning energy between foliar nitrogen and carbon assimilation.
© The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Entities:  

Keywords:  Alternative oxidase; ammonium; energy balancing; nitrate assimilation; reductant; uncoupling protein.

Mesh:

Substances:

Year:  2014        PMID: 24799562      PMCID: PMC4071831          DOI: 10.1093/jxb/eru158

Source DB:  PubMed          Journal:  J Exp Bot        ISSN: 0022-0957            Impact factor:   6.992


Introduction

Nitrogen (N) availability is a major determinant of plant growth and productivity (Reich , 2006a). However, N fertilizers also represent a large economical cost and source of ground water pollution in agriculture systems. In higher plants, nitrate (NO3 –) and ammonium (NH4 +) are the two primary forms of assimilated inorganic N. The latter is typically assimilated directly into amino acids through the glutamine synthetase–glutamate synthase complex, whereas the former is first reduced to nitrite by cytosolic nitrate reductase and then to NH4 + by plastidic nitrite reductase (Epstein and Bloom, 2005). The assimilation of NO3 – has a higher energetic requirement compared with NH4 + assimilation (Noctor and Foyer, 1998; Scheurwater ; Escobar ) and in the leaves the cytosolic reduction of nitrate to nitrite may consume reductant exported from either the chloroplast or the mitochondria (Foyer ). On the other hand, nitrite reduction and NH4 + assimilation occur in the chloroplast stroma and consume reduced ferredoxin. Therefore, the complexity and compartmentalization of these pathways necessitates balancing photosynthetic energy supply and demand to optimize rates of NO3 – and CO2 assimilation. The availability of N is known to affect rates of photosynthesis and respiration (Reich ; Atkinson ), and there is a strong correlation between leaf N content and rates of respiration (Terashima and Evans, 1988; Makino and Osmond, 1991; Byrd ; Lusk and Reich, 2000). For example, the tricarboxylic acid (TCA) cycle enzymes fumarase, NAD-dependent isocitrate dehydrogenase (Makino and Osmond, 1991), and NAD-dependent malic enzyme (Noguchi and Terashima, 2006) are up-regulated under low N. Additionally, the expression and activity of several glycolytic and TCA cycle enzymes were differentially influenced following NH4 + or NO3 – feeding (Larsen ; Scheible ; Lancien ; Stitt, 1999). These changes in respiration are linked to the supply of carbon skeletons (e.g. 2-oxoglutarate, isocitrate, and citrate) from the TCA cycle to maintain optimum N assimilation and amino acid biosynthesis (Larsen ; Scheible ; Lancien ). Furthermore, the N source (NO3 – versus NH4 +) has been shown to change gene expression of the mitochondrial electron transport chain, particularly the alternative oxidase (AOX), type II NAD(P)H dehydrogenases, and uncoupling proteins (UCPs) of the mitochondrial alternative electron transport (mAET) (Escobar ; Patterson ). Additionally, the capacity and protein amount of AOX, a major component of mAET, increase under low NO3 – conditions (Sieger ; Watanabe ; Hachiya and Noguchi, 2011). The mAET bypasses one or more of the multiprotein complexes of the ‘classic’ electron transport chain, minimizing proton pumping across the inner membrane (Vanlerberghe and McIntosh, 1997; Rasmusson ). Consequently, mAET oxidizes NAD(P)H uncoupled from ATP production and has been proposed to dissipate excess reductant (Raghavendra and Padmasree, 2003). For example, mAET plays an important role in the response to several environmental constraints such as cold (Armstrong ; Watanabe ), elevated CO2 (Gandin ), drought (Bartoli ; Giraud ), phosphate limitation (GonzàLez-Meler ; Sieger ; Escobar ), high light stress (Ribas-Carbo ; Sweetlove ; Yoshida and Noguchi, 2009), and other reactive oxygen species-inducing stress conditions (Maxwell ). Additionally, it has been suggested that the capacity of mAET responds to changes in NO3 – assimilation (Dutilleul ; Escobar ). Reductant availability within the leaf cytoplasm probably often limits rates of de novo NO3 – assimilation. This is in part due to the low cytosolic NADH availability (0.3–0.7 μM), which is far below the 7 μM K m of nitrate reductase for NADH (Kaiser ; Heineke ). Therefore, conditions such as high light or perhaps high rates of photorespiration that increase cytosolic NADH concentrations have been suggested to increase rates of foliar NO3 – assimilation (Bloom ; Searles and Bloom, 2003; Rachmilevitch ; Guo ). Alternatively, NO3 – assimilation decreases under conditions that restrict the export of reductant via the malate shuttle from the chloroplast. It has also been reported in the literature that changes in mitochondrial electron transport, particularly the alternative non-phosphorylating pathways, could influence the de novo assimilation of N (Watanabe ). However, it remains unclear how the alternative non-phosphorylating pathways of the mitochondrial inner membrane influence foliar NO3 – assimilation. Additionally, it has been shown that both the alternative non-phosphorylating pathways of the mitochondrial inner membrane and N assimilation oxidize excess reductant produced by photosynthesis, photorespiratory glycine oxidation, and the TCA cycle (Sweetlove ; Gandin ). Therefore, the energy partitioning in the cell is probably balanced in part by both mitochondrial electron transport and NO3 – assimilation (Hachiya and Noguchi, 2011), avoiding chloroplast over-reduction and maintaining optimal rates of photosynthesis. The role of the mAET and NO3 – assimilation in energy consumption and dissipation is well accepted; however, their respective contribution and coordination remain unclear. Therefore, the aim of this research is to test the hypothesis that changes in mAET and NO3 – assimilation influence energy partitioning between N and carbon metabolism. To test this hypothesis, this study (i) investigated the influence of changes in mAET capacity on de novo NO3 – assimilation and (ii) determined the response of photosynthetic CO2 assimilation and electron transport to changes in N source (NO3 – versus NH4 +) in plants with disrupted mAET [wild type (WT) versus aox1a and ucp1].

Materials and methods

Plant material and growth conditions

WT and T-DNA insertion lines for AOX1a (SALK_084897) and UCP1 (SAIL_536G01) plants of Arabidopsis thaliana (Sweetlove ; Giraud ; Gandin ) were grown hydroponically in a controlled environment growth chamber (Biochambers GC-16, Winnipeg, Manitoba, Canada) at a photosynthetic photon flux density (PPFD) of 160 μmol quanta m–2 s–1 at plant height, relative humidity of 50%, and air temperature of 23 °C and 18 °C during the day and night, respectively, with a 10h day. The SAIL_563G01 line was obtained from the TAIR collection and homozygous lines were screened by PCR of genomic DNA using the GACGAAGATGTGAAGTAGACC/TAGCATCTGAATTTCATAACCAATCTCGATACAC and GACGAAGATGTGAAGTAGACC/TCAGTTTCTTTTGGACG CATCG primer pairs. Homozygous lines were selfed and screened again by PCR using the same primer pair. Seeds were germinated on Rockwool cylinders (GroDan Cubes, Rockwool BV, Roemond, The Netherlands) for 7 d. Subsequently, seedlings were transferred to 14 litre containers filled with aerated nutrient solution containing 0.2mM NH4Cl, 0.2mM KNO3, 1.25mM CaSO4, 0.75mM MgSO4, 0.5mM KH2PO4, 0.04g l−1 FeDPTA, and micronutrients (Gibeaut ). Nutrient solution was replaced every 2 d.

Growth parameters, chlorophyll contents, and Rubisco activity

Total leaf area, leaf number, and rosette size were measured from digital pictures of whole plants using Image J software (NIH, Bethesda, MD, USA). Rosette size was calculated according to Feret’s diameter principle using ImageJ software (version 1.37, NIH, USA). Additionally, shoot and root were weighed separately (fresh weight), then dried for 96h at 65 °C and weighed again (dry weight). Leaf mass per area (LMA) was estimated as the ratio of dry weight to leaf area. Chlorophyll content was quantified according to Ritchie (2006). Rubisco activity was spectrophotometrically measured according to Walker in 100mM EPPS pH 8.0, 20mM MgCl2, 1mM EDTA, 1mM ATP, 5mM creatine phosphate, 20mM NaHCO3, 0.5mM ribulose-1,5-bisphosphate, 0.2mM NADH, 12.5U ml–1 creatine phosphate kinase, 250U ml–1 carbonic anhydrase, 22.5U ml–1 phosphoglycerolkinase, 20U ml–1 glyceraldehyde-3-phosphodehydrogenase, 56U ml–1 triose phosphate isomerase, and 20U ml–1 glycerol-3-phosphodehydrogenase.

Nitrate uptake, content and assimilation

WT, aox1a and ucp1 A. thaliana plants were grown as described above in a hydroponic solution containing 0.2mM NO3 – at natural abundance 15/14N. Subsequently, plants were grown for 24h on a nutrient solution depleted of N (as above). Half of the plants were shifted to a nutrient solution supplemented with 0.2mM NO3 – enriched 25% with 15NO3 – and the other half were fed natural abundance 15NO3 as a control. In the first set of experiments, plants were labelled for up to 9h to look at the time course of NO3 uptake and assimilation (time effect, Supplementary Fig. S1 available at JXB online). Subsequent experiments were limited to 6h of feeding (irradiance effect, Fig. 1). After labelling, plants were rinsed in ultra-pure water then separated into shoots and roots, oven-dried, and ground to a fine powder in a mortar and pestle. Total 15N enrichment was measured using an elemental analyser (ECS 4010, Costech Analytical, Valencia, CA, USA) connected directly to a continuous flow isotope ratio mass spectrometer (Delta PlusXP, Thermofinnigan, Bremen, Germany) (Brenna ). Isotopic reference materials are interspersed with samples for isotope ratio calibration and acetanilide was used in a multipoint correction for N%.
Fig. 1.

Rates of foliar NO3 – uptake and assimilation, and free NO3 – content in wild-type, aox1a and ucp1 shoots of A. thaliana fed with 15NO3 – for 6h. Plants were exposed to either growth (A, 160 μmol quanta m–2 s–1) or saturating (B, 1000 μmol quanta m–2 s–1) light conditions during the feeding. Shown are the means ±SE of measurements made on five plants. An asterisk denotes a significant difference (P<0.05) between genotypes.

Rates of foliar NO3 – uptake and assimilation, and free NO3 – content in wild-type, aox1a and ucp1 shoots of A. thaliana fed with 15NO3 – for 6h. Plants were exposed to either growth (A, 160 μmol quanta m–2 s–1) or saturating (B, 1000 μmol quanta m–2 s–1) light conditions during the feeding. Shown are the means ±SE of measurements made on five plants. An asterisk denotes a significant difference (P<0.05) between genotypes. Free NO3 – was extracted from powder plant material, and 15N enrichment of free NO3 – was estimated by converting NO3 – to N2O using the denitrifying Pseudomonas aureofaciens (Sigman ; Casciotti ). The headspace N2O was sampled with a two-holed needle mounted on an autosampler (GC-PAL, CTC Analytics, Switzerland) and connected to a GasBench II (ThermoFinnigan) interface. Samples were cleaned of water and volatile organic compounds (VOCs) through a liquid nitrogen/ethanol slush trap (–110 °C), and of CO2 and H2O through an ascarite/magnesium perchlorate trap. Further removal of VOCs was achieved with a Supelco type F trap following the slush trap. Purified samples were separated through a Poraplot Q GC column (Varian, 25 m×0.32mm ID), run through a final nafion water trap (Permapure LLC, NJ) for trace water removal, and analysed by a continuous flow isotope ratio mass spectrometer (Delta PlusV, Thermofinnigan) (Brenna ). NO3 – assimilation was thus estimated as NO3 – assimilation=total 15N15NO3 –. Finally, total free NO3 – was quantified from powder using high-pressure liquid chromatography (Thayer and Huffaker, 1980).

Amino acid analysis

Leaf tissues were ground in 0.25ml of 0.1M HCl using a micropestle, and 400 μM aminobutyric acid was added as internal control. Samples were centrifuged for 20min at 24 000 g at 4 °C and the supernatant was collected and the pellets re-extracted with 0.25ml of 0.1M HCl. Supernatants were combined and filtered through a 45 μm polyvinylidene difluoride (PVDF) filter and stored at –80 °C until analysis. Amino acids were derivatized using 4-fluoro-7-nitro-2,1,3-benzoxadiazole (NBD-F) according to Aoyama by incubating 5 μl of the extract with 50mM borate buffer pH 9.5 and 3mM NDB-F reagent at 60 °C for 10min. Reactions were terminated by addition of 333mM tartrate buffer pH 2.0 and derivatized amino acids were separated using an Alliance® HPLC System (2695 Separations Module, Waters, Milford, MA, USA) and fluorometrically detected at 540nm with excitation at 470nm (2475 Multi-Wavelength Fluorescence Detector, Waters).

Feeding system for gas exchange and chlorophyll fluorescence

Twenty-four hours before the gas exchange measurements, plants were transferred to nutrient solution depleted in N source (neither NH4 + nor NO3 –) for starvation. Subsequently, plants were individually transferred 12h before measurements to stainless steel cuvettes sealed with Teflon caps. The root cuvettes were fed with a continuous flow of nutrient solution supplemented with either NO3 – or NH4 + using a custom-built multiplant feeding system. Nutrient solution was equally distributed between each of the six cuvettes using electronically controlled solenoid valves (ASCO RedHat II 8262, Florham Park, NJ, USA). Each individual stainless steel cuvette was housed within a sealed PVC tube containing temperature-controlled circulating water to maintain the root system at 25 °C.

Gas exchange and chlorophyll fluorescence

Gas exchange and chlorophyll fluorescence measurements were made on fully expanded leaves using a LI6400 (LICOR Biosciences, Lincoln, NE, USA) leaf chamber (LI6400-40). Gas exchange measurements were made at a pO2 of 18.6 kPa, a leaf temperature of 25 °C, a saturating light intensity of 1000 μmol quanta m−2 s−1 PAR (photosynthetically active radiation), and a CO2 partial pressure of 37.2 Pa. Light–response curves were made by decreasing light from 2000 to 1500, 1200, 1000, 800, 500, 200, 100, 40, and 20 μmol quanta m−2 s−1 PAR. The O2 response curves were made by modulating pO2 inside the chamber using two mass flow controllers (Aalborg, Orangeburg, NY, USA) to mix N and O2 gas proportional to 46.6, 32.6, 18.6, 9.3, and 1.9 kPa pO2. The order of pO2 during the measurements was randomized. Simultaneously, chlorophyll fluorescence measurements were made using a LI6400-40 pulse-modulated fluorometer and multiphase flash protocol (Loriaux ). The quantum yield of photosystem II (ϕPSII) and photochemical quenching (qP) were determined as (F m’–F s)/F m’) and (F m’–Fs)/(F m’–Fo’), respectively. The rate of linear electron transport through PSII (J f) was calculated from chlorophyll fluorescence measurements as J f=ϕPSII×Abs×I×0.48, where Abs is leaf absorption (=0.85), I is the incident irradiance, and assuming a relative excitation distribution to PSII of 0.48 (Laisk and Loreto, 1996). Furthermore, the rate of electron transport required to sustain the photosynthetic carbon reduction and photorespiratory cycles (J g) was calculated from gas exchange measurements as J g=(A net+R d) (4C c +8Г*)/(C c–Г*) where A net is net CO2 assimilation rate, R d is dark-type respiratory rate, C c is the chloroplastic CO2 partial pressure, and Г* is the CO2 compensation point in the absence of dark-type respiration.

Results

Leaf characteristics

Measurements of growth, leaf chlorophyll content, and Rubisco activity were made to characterize WT, aox1a, and ucp1 A. thaliana plants grown in hydroponic conditions. Shoot dry weight was 9 and 10% lower in ucp1 compared with the WT and aox1a, respectively (Table 1). However, leaf number, diameter of the rosette, LMA, and root biomass were similar between genotypes. Additionally, leaf chlorophyll content and Rubisco activity were similar, with an average chlorophyll a/b ratio of 1.8 and Rubisco activity of 48 μmol m–2 s–1, suggesting similar photosynthetic capacity in all three genotypes (Table 1).
Table 1.

Growth characteristics, chlorophyll ratio, and Rubisco activity in wild-type, aox1a, and ucp1 Arabidopsis thaliana

Root biomass (mg)Shoot biomass (mg)No. of leavesRosette diameter (cm)LMA (g m–2)Chl a/b Rubisco (μmol m–2 s–1)
WT88.6±6.9 a412.3±21.5 a21±1 a12.3±1.2 a68.7±5.4 a1.7±0.3 a49.0±3.7 a
aox1a 89.8±5.7 a415.1±18.1 a21±1 a12.6±0.8 a61.7±3.2 a1.9±0.4 a44.4±6.4 a
ucp1 76.5±5.0 a375.1±16.0 b20±1 a11.3±0.3 a67.5±5.9 a1.8±0.3 a51.0±4.2 a

Values represent the means ±SE of 10 biological replicates for growth characteristics and five biological replicates for chlorophyll and Rubisco measurements.

ANOVA results are indicated; different letters indicate significant differences between genotypes at P<0.05.

Growth characteristics, chlorophyll ratio, and Rubisco activity in wild-type, aox1a, and ucp1 Arabidopsis thaliana Values represent the means ±SE of 10 biological replicates for growth characteristics and five biological replicates for chlorophyll and Rubisco measurements. ANOVA results are indicated; different letters indicate significant differences between genotypes at P<0.05.

Nitrate uptake, accumulation, and assimilation

To estimate the impact of AOX1a and UCP1 function on de novo N uptake, rates of NO3 – uptake and assimilation were measured by feeding hydroponically grown plants 15N-enriched NO3 –. The uptake and accumulation of NO3 – were quantified from measurements of bulk leaf 15N and free 15NO3 –, respectively, relative to plants fed natural abundance NO3 –. The assimilation of NO3 – was estimated from differences between total leaf 15N minus 15NO3 – content. Rates of NO3 – uptake and assimilation were measured in WT plants at three time points after initiating feeding (3, 6, and 9h) to determine the optimum time. Rates of shoot NO3 – uptake, assimilation, and accumulation were similar after 3, 6, and 9h (Supplementary Fig. S1 at JXB online). However, rates of root NO3 – uptake and assimilation were higher at 3h compared with 6h and 9h. Therefore, NO3 – uptake, assimilation, and content were measured in WT, aox1a, and ucp1 plants after 6h of 15NO3 – feeding. Under 160 μmol quanta m–2 s–1 (growth irradiance), shoot NO3 – uptake was higher in ucp1 compared with aox1a and WT plants. However, shoot assimilation of NO3 – was higher in both aox1a and ucp1 compared with the WT, while shoot NO3 – content was similar between all three genotypes (Fig. 1). Regardless of the genotype, the uptake, assimilation, and content of NO3 – in the roots were similar (Supplementary Fig. S2 at JXB online). After 6h under high light (1000 μmol quanta m–2 s–1), shoot NO3 – uptake and assimilation were higher in ucp1 compared with the WT and aox1a; however, NO3 – content was lower (Fig. 1). Under the high light treatment, the root NO3 – uptake, assimilation, and content were similar between all three genotypes (Supplementary Fig. S2). Nineteen amino acids were quantified in leaves of A. thaliana WT, aox1a, and ucp1 fed either NO3 – or NH4 + as sole N source under both growth (160 μmol quanta m–2 s–1) and high (1000 μmol quanta m–2 s–1) irradiance. Asparagine, aspartate, and lysine contents were higher in the aox1a mutant plants compared with the WT, regardless of N source or irradiance (Fig. 2; Supplementary Table S1 at JXB online). However, only asparagine was significantly higher in ucp1 compared with the WT plants. In contrast, under growth irradiance, cysteine, glycine, and serine were lower in ucp1 compared with the WT, regardless of the N source. However, under saturating irradiance, glycine and serine were significantly decreased but cysteine was not in ucp1 compared with WT plants.
Fig. 2.

Changes in the content of 19 different amino acids in aox1a and ucp1 leaves of A. thaliana fed with either NO3 – or NH4 + as sole N source and exposed to either growth (160 μmol quanta m–2 s–1) or saturating (1000 μmol quanta m–2 s–1) irradiance for 6h. Values represent the log2 of the mutant to WT ratio. Values in bold indicate differences statistically significantly different between the WT and mutants. (This figure is available in colour at JXB online.)

Changes in the content of 19 different amino acids in aox1a and ucp1 leaves of A. thaliana fed with either NO3 – or NH4 + as sole N source and exposed to either growth (160 μmol quanta m–2 s–1) or saturating (1000 μmol quanta m–2 s–1) irradiance for 6h. Values represent the log2 of the mutant to WT ratio. Values in bold indicate differences statistically significantly different between the WT and mutants. (This figure is available in colour at JXB online.)

Response of photosynthesis

Measurements of A net, ϕPSII, and the excitation pressure on the chloroplast electron transport chain (1–qP) were measured in WT, aox1a, and ucp1 plants fed either NO3 – or NH4 + to test the impact of two major electron sinks on photosynthesis. In WT plants, A net and ϕPSII increased while 1–qP decreased under NO3 – compared with NH4 + feeding (Fig. 3). However, in the aox1a and ucp1 plants the change in N source had no effect on A net, ϕPSII, or 1–qP. Under NO3 – and saturating irradiance, A net was lower in ucp1 compared with WT and aox1a plants; however, under non-saturating irradiances, A net was similar between genotypes. Furthermore, under NO3 –, the measured ϕPSII was lower and 1–qP higher in the ucp1 and aox1a plants compared with the WT plants, regardless of irradiance. Under NH4 + feeding, A net, ϕPSII, and 1–qP were not significantly different between ucp1, aox1a, and WT plants across all irradiances. There was a significant oxygen response of A net but not ϕPSII and 1–qP for all three genotypes regardless of N form (Fig. 4). In WT plants A net and ϕPSII were higher while 1–qP was lower under NO3 – compared with NH4 + feeding across all pO2; however, there was no difference in these parameters between N form in the ucp1 and aox1a plants (Fig. 4). Additionally, there was a significant difference in A net, ϕPSII, and 1–qP between WT and both mutant lines (ucp1 and aox1a) at all pO2 under NO3 – but not NH4 +.
Fig. 3.

Net CO2 assimilation rate (A net), quantum yield (ϕPSII), and excitation pressure (1–qP) in response to light intensity in wild-type, aox1a, and ucp1 leaves of A. thaliana fed either NO3 – or NH4 + as sole N source. Shown are the means of measurements made on three plants. The inset box within each panel presents the grand mean with the standard error, estimated from the MSE term in the ANOVA. Significant differences (P<0.05) were denoted by an asterisk either in the inset box when the genotype effect was significant or on the graph to indicate a significant genotype×irradiance interaction.

Fig. 4.

Net CO2 assimilation rate (A net), quantum yield (ϕPSII), and excitation pressure (1–qP) in response to O2 atmospheric partial pressure in wild-type, aox1a, and ucp1 leaves of A. thaliana fed with either NO3 – or NH4 + as sole N source. Shown are the means ±SE of measurements made on three plants. The inset box within each panel presents the grand mean with the standard error, estimated from the MSE term in the ANOVA. An asterisk denotes a significant difference (P<0.05) between genotypes.

Net CO2 assimilation rate (A net), quantum yield (ϕPSII), and excitation pressure (1–qP) in response to light intensity in wild-type, aox1a, and ucp1 leaves of A. thaliana fed either NO3 – or NH4 + as sole N source. Shown are the means of measurements made on three plants. The inset box within each panel presents the grand mean with the standard error, estimated from the MSE term in the ANOVA. Significant differences (P<0.05) were denoted by an asterisk either in the inset box when the genotype effect was significant or on the graph to indicate a significant genotype×irradiance interaction. Net CO2 assimilation rate (A net), quantum yield (ϕPSII), and excitation pressure (1–qP) in response to O2 atmospheric partial pressure in wild-type, aox1a, and ucp1 leaves of A. thaliana fed with either NO3 – or NH4 + as sole N source. Shown are the means ±SE of measurements made on three plants. The inset box within each panel presents the grand mean with the standard error, estimated from the MSE term in the ANOVA. An asterisk denotes a significant difference (P<0.05) between genotypes. The rate of linear electron transport through PSII estimated from chlorophyll fluorescence (J f) was compared with the electron transport demand required to sustain rates of CO2 assimilation and photorespiration (J g). The relationship between J f and J g was linear in response to irradiance and did not differ between NO3 – and NH4 + feeding for all three genotypes (Fig. 5A). Additionally, the relationship between J f and J g under NO3 – feeding was similar between all three genotypes in response to pO2; however, under NH4 + feeding, there was a significantly higher slope in the ucp1 plants (1.18) compared with aox1a (0.95) and WT (0.97) plants (Fig. 5B).
Fig. 5.

Correlation between the electron transport rate through PSII (J f) and the electron transport rate required for CO2 assimilation and photorespiration (J g) in wild-type, aox1a, and ucp1 leaves of A. thaliana fed with either NO3 – or NH4 + as sole N source. Correlation was established in response to light intensity (A; from 2000 to 20 μmol quanta m–2 s–1) and O2 partial pressure (B; from 46.6 to 1.9 kPa pO2).

Correlation between the electron transport rate through PSII (J f) and the electron transport rate required for CO2 assimilation and photorespiration (J g) in wild-type, aox1a, and ucp1 leaves of A. thaliana fed with either NO3 – or NH4 + as sole N source. Correlation was established in response to light intensity (A; from 2000 to 20 μmol quanta m–2 s–1) and O2 partial pressure (B; from 46.6 to 1.9 kPa pO2).

Discussion

The disruption of mAET had significant impacts on both foliar N and carbon metabolism in A. thaliana. For example, the loss of the uncoupling protein UCP1 or the alternative oxidase AOX1a increased rates of foliar NO3 – assimilation compared with WT plants. Additionally, A net was lower in ucp1 plants compared with the WT and aox1a lines in NO3 –-fed plants. However, under NH4 +, rates of A net were not significantly different between genotypes. As discussed below, these data demonstrate that UCP1 and AOX1a are important for balancing the energy partitioning between N and carbon metabolism.

Disruption of alternative mitochondrial electron transport enhances foliar nitrate assimilation

The rates of foliar NO3 – assimilation were higher in the aox1a and ucp1 plants compared with the WT under the non-saturating growth light (160 μmol photons m–2 s–1) conditions (Fig. 1). Low light conditions would probably decrease the amount of reductant exported from the chloroplast, and the competition for reductant between NO3 – assimilation and mitochondrial electron transport would be high. Under these conditions, the availability of NADH for the cytosolic conversion of NO3 – to NO2 – and the chloroplastic reduction of NO2 – to NH4 + by ferredoxin would be limiting. Therefore, the increase in NO3 – assimilation in the upc1 and aox1a plants under low light is probably attributed to an increased availability of cytosolic reductant because of decreased consumption by the mitochondria. The increased NO3 – assimilation in the ucp1 and aox1a plants also corresponded to a higher amino acid content (Fig. 2, Supplementary Table S1 at JXB online) and lower total leaf carbon to N ratio as previously observed in tobacco plants deficient in the mitochondrial complex I (CMS mutant) (Dutilleul ) and in AOX1a (Watanabe ). Alternatively, at saturating light (1000 μmol photons m–2 s–1), the export of excess reductant from the chloroplast into the cytosol will be high and will not limit rates for NO3 – assimilation. In fact under high light, there was only a small increase in NO3 – assimilation with the loss of UCP1 and there was no change in NO3 – assimilation with the absence of AOX1a. Generally, the effect of lack of UCP1 on N metabolism was more marked than that of the lack of AOX1a. The expression of UCP1 has been shown to be up-regulated in the aox1a mutant (Watanabee , 2010). Given the potentially overlapping function of these two respiratory components, UCP1 may partly compensate for the loss of AOX1a, which would therefore diminish the impact of the genetic manipulation. However, AOX content has been shown to decrease in the ucp1 mutant (Sweetlove ). The higher rates of foliar NO3 – assimilation in the ucp1 and aox1a plants also require an increase in carbon skeletons for the de novo synthesis of amino acids. The present results show a significant increase in aspartate and asparagine levels in mutants compared with the WT. The aspartate pathway drives the synthesis of several amino acids that may contribute to generate additional energy under stress conditions (Galili, 2011). This pathway has been suggested to operate in combination with the TCA cycle in inducing the catapleurotic fluxes with energy deprivation conditions. However, anapleurotic fluxes can also supply amino acid synthesis with carbon skeletons. In aox1a and ucp1 mutants, it is likely that asparagine family synthesis was driven by reductant accumulation and carbon skeleton availability leaking out of the TCA cycle. It has been demonstrated that the carbon needed for the synthesis of amino acids comes primarily from the partial operation of the TCA cycle (Chen and Gadal, 1990; Tcherkez ; Sweetlove ). Additionally, it has been reported that there is an increase in the anaplerotic production of carbon skeletons through an incomplete TCA cycle with increased NO3 – assimilation (Scheible ; Stitt, 1999). Therefore, the increase in NO3 – assimilation and overall amino acid content observed in the ucp1 and aox1a lines probably increased the TCA production of carbon skeletons. This would further increase NADH production available via the malate shuttle for de novo NO3 – assimilation. Root NO3 – assimilation was not altered by the loss of UCP1 and AOX1a, suggesting a more important role for AOX1a and UPC1 in photosynthetic tissue. This is supported by 6-fold higher AOX1a transcripts in the shoot compared with the root in A. thaliana; however, the UCP1 expression level is similar between root and shoot tissues (Watanabe ). Furthermore, the AOX1d transcript level is enhanced in the root of aox1a mutants, but not in the shoot, suggesting a potential compensatory effect for the loss of AOX1a in the roots (Watanabe ). Taken together, AOX1a and potentially UCP1 appears to have a more predominant role in shoot than root tissues and plays an important role in regulating de novo shoot assimilation of NO3 –, particularly when the reductant availability is limiting.

Alternative mitochondrial electron transport and nitrate assimilation synergistically optimize photosynthesis

The present results demonstrate that both NO3 – assimilation and mAET optimize rates of photosynthetic CO2 assimilation; however, independently neither is sufficient to influence A net. For example, A net was higher under NO3 – compared with NH4 + feeding in WT plants but not in the aox1a and ucp1 mutants, despite increased NO3 – assimilation in these plants. Additionally, under NH4 + feeding, there was not a significant difference in A net between the WT and the two mutant lines (ucp1 and aox1a). This suggests that the increase in A net under NO3 – is dependent on functional AOX1A and UCP1, and that NO3 – assimilation alone is insufficient to alter A net. Furthermore, the loss of AOX1A and UCP1 had no effect on A net or leaf photochemistry under NH4 +. In WT plants, A net and ϕPSII were 12–17% higher under NO3 –- compared with NH4 +-fed plants, respectively. An increase in A net and ϕPSII under NO3 – versus NH4 + feeding has been previously described in barley (Bloom ), wheat (Bloom ), tomato (Searles and Bloom, 2003), and maize (Cousins and Bloom, 2003). The foliar reduction of NO3 – to NH4 + requires cytosolic NADH, typically generated from reductant exported from the chloroplast, and ferredoxin within the chloroplast. Therefore, NO3 – assimilation may compete for reductant with Rubisco-mediated assimilation of CO2 (Bloom ). However, under the conditions used here and as previously reported (Bloom , 2002; Cousins and Bloom, 2003; Searles and Bloom, 2003), the rates of A net were higher in NO3 –- versus NH4 +-fed plants. This suggests that the consumption of reductant via NO3 – assimilation stimulates rates of net CO2 assimilation and ϕPSII, probably through optimizing the ATP/NADPH production within chloroplasts. Additionally, the present data indicate that NO3 – assimilation contributes to protect the chloroplast electron transport chain from over-reduction and therefore ensures optimal rates of CO2 assimilation. The measured A net was lower in NO3 –-fed ucp1 mutants compared with WT plants; however, there was no difference in A net between ucp1 and WT plants under NH4 + feeding (Fig. 3). The decrease in A net seen under NO3 – feeding is consistent with these plants grown in soil as reported by Sweetlove . These authors attributed the decrease in A net in the ucp1 compared with the WT to a restricted flux through the photorespiratory pathway and an associated limited regeneration of ribulose-1,5-bisphosphate. A decrease in the glycine to serine conversion could affect methionine synthesis through C1 metabolism. Both serine and methionine are precursors of cysteine synthesis, which is at a low level in ucp1 compared with the WT. These data are similar to those of Sweetlove , who also showed a lower amount of glycine and serine in the ucp1 mutant compared with the WT (Fig. 2). However, it was found that the difference in A net between the ucp1 mutant and the WT was constant in response to O2 availability (from 1.9 kPa to 46.6 kPa O2). This suggests that UCP1 optimizes A net regardless of rates of photorespiration and probably plays an important role in balancing the energy supply with demand between N and carbon metabolism within the leaf. The N feeding experiments demonstrated that NO3 – assimilation could compensate for the lack of excess reductant consumption by the mitochondria in the absence of UCP1. However, A net was not enhanced in aox1a and ucp1 mutants fed with NO3 – as seen in WT plants, suggesting that the stimulation of CO2 fixation by NO3 – assimilation is dependent on a fully functional mAET. In the ucp1 mutants fed with NH4 +, the electron production by the chloroplastic electron transport chain increased significantly with decreasing oxygen compared with the electron demand for A net and photorespiration (Fig. 5B). This shift between electron production and demand indicates extra electron transport to alternative chloroplastic sinks such as the Mehler reaction. In addition to the Mehler reaction, other alternative electron sinks such as the cyclic electron flux and chlororespiration have been reported to optimize ATP synthesis, balance the production of the chloroplastic ratio of ATP/NADPH, and avoid over-reduction of the photosynthetic electron transport chain (Johnson, 2005). In ucp1 mutants fed NH4 + under non-photorespiratory conditions, the change in J f/J g suggests that the Mehler reaction has a greater influence on linear electron flow compared with other genotypes and treatments. This would avoid excess NADPH accumulation within the stroma due to the loss of two other major electron sinks (mitochondria alternative pathways and NO3 – assimilation) while still maintaining rates of linear electron transport.

Conclusion

In summary the importance of mAET in foliar de novo NO3 – assimilation in A. thaliana, particularly under conditions that limit reductant availability (low light), is demonstrated in the present work. Additionally, the data show that both mAET and NO3 – assimilation influence rates of photosynthetic CO2 assimilation and electron transport. mAET and NO3 – assimilation appear to function synergistically to avoid excess reductant accumulation and over-reduction of the chloroplast. Finally, the data demonstrate that mitochondrial respiration significantly contributes to the energy balancing between N and carbon metabolism.

Supplementary data

Supplementary data are available at JXB online. Figure S1. Rates of NO3 – uptake and assimilation, and free NO3 – content in wild-type shoots and roots of A. thaliana fed with 15NO3 – for 3, 6, or 9h. Table S1. Amino acid levels (nmol mg–1 DW) in shoots of wild-type, aox1a, and ucp1 Arabidopsis thaliana fed either NO3 – or NH4 + as sole N source. Figure S2. Rates of NO3 – uptake and assimilation, and free NO3 – content in wild-type, aox1a, and ucp1 roots of A. thaliana fed with 15NO3 – for 6h.
  49 in total

1.  A bacterial method for the nitrogen isotopic analysis of nitrate in seawater and freshwater.

Authors:  D M Sigman; K L Casciotti; M Andreani; C Barford; M Galanter; J K Böhlke
Journal:  Anal Chem       Date:  2001-09-01       Impact factor: 6.986

2.  A Comparison of Dark Respiration between C(3) and C(4) Plants.

Authors:  G T Byrd; R F Sage; R H Brown
Journal:  Plant Physiol       Date:  1992-09       Impact factor: 8.340

3.  The alternative oxidase lowers mitochondrial reactive oxygen production in plant cells.

Authors:  D P Maxwell; Y Wang; L McIntosh
Journal:  Proc Natl Acad Sci U S A       Date:  1999-07-06       Impact factor: 11.205

4.  Simultaneous expression of NAD-dependent isocitrate dehydrogenase and other krebs cycle genes after nitrate resupply to short-term nitrogen-starved tobacco

Authors: 
Journal:  Plant Physiol       Date:  1999-07       Impact factor: 8.340

5.  Impact of temperature on the relationship between respiration and nitrogen concentration in roots: an analysis of scaling relationships, Q10 values and thermal acclimation ratios.

Authors:  Lindsey J Atkinson; Martin A Hellicar; Alastair H Fitter; Owen K Atkin
Journal:  New Phytol       Date:  2007       Impact factor: 10.151

6.  Measurement of the oxygen isotopic composition of nitrate in seawater and freshwater using the denitrifier method.

Authors:  K L Casciotti; D M Sigman; M Galanter Hastings; J K Böhlke; A Hilkert
Journal:  Anal Chem       Date:  2002-10-01       Impact factor: 6.986

Review 7.  Integrative response of plant mitochondrial electron transport chain to nitrogen source.

Authors:  Takushi Hachiya; Ko Noguchi
Journal:  Plant Cell Rep       Date:  2010-12-04       Impact factor: 4.570

8.  Mitochondria-driven changes in leaf NAD status exert a crucial influence on the control of nitrate assimilation and the integration of carbon and nitrogen metabolism.

Authors:  Christelle Dutilleul; Caroline Lelarge; Jean-Louis Prioul; Rosine De Paepe; Christine H Foyer; Graham Noctor
Journal:  Plant Physiol       Date:  2005-08-26       Impact factor: 8.340

9.  Reorganization of the alternative pathways of the Arabidopsis respiratory chain by nitrogen supply: opposing effects of ammonium and nitrate.

Authors:  Matthew A Escobar; Daniela A Geisler; Allan G Rasmusson
Journal:  Plant J       Date:  2006-03       Impact factor: 6.417

10.  Mitochondrial uncoupling protein is required for efficient photosynthesis.

Authors:  Lee J Sweetlove; Anna Lytovchenko; Megan Morgan; Adriano Nunes-Nesi; Nicolas L Taylor; Charles J Baxter; Ira Eickmeier; Alisdair R Fernie
Journal:  Proc Natl Acad Sci U S A       Date:  2006-12-05       Impact factor: 11.205

View more
  9 in total

1.  Importance of the alternative oxidase (AOX) pathway in regulating cellular redox and ROS homeostasis to optimize photosynthesis during restriction of the cytochrome oxidase pathway in Arabidopsis thaliana.

Authors:  Abhaypratap Vishwakarma; Sarada Devi Tetali; Jennifer Selinski; Renate Scheibe; Kollipara Padmasree
Journal:  Ann Bot       Date:  2015-08-20       Impact factor: 4.357

2.  Alternative Oxidase Isoforms Are Differentially Activated by Tricarboxylic Acid Cycle Intermediates.

Authors:  Jennifer Selinski; Andreas Hartmann; Gabriele Deckers-Hebestreit; David A Day; James Whelan; Renate Scheibe
Journal:  Plant Physiol       Date:  2017-12-05       Impact factor: 8.340

Review 3.  Roles of mitochondrial energy dissipation systems in plant development and acclimation to stress.

Authors:  Xiaojun Pu; Xin Lv; Tinghong Tan; Faqiong Fu; Gongwei Qin; Honghui Lin
Journal:  Ann Bot       Date:  2015-05-18       Impact factor: 4.357

4.  UCP1 and AOX1a contribute to regulation of carbon and nitrogen metabolism and yield in Arabidopsis under low nitrogen stress.

Authors:  Xinyan Qiao; Mengjiao Ruan; Tao Yu; Chaiyan Cui; Cuiyun Chen; Yuanzhi Zhu; Fanglin Li; Shengwang Wang; Xiaofan Na; Xiaomin Wang; Yurong Bi
Journal:  Cell Mol Life Sci       Date:  2022-01-02       Impact factor: 9.261

5.  Impairment of Respiratory Chain Function and Involvement of Alternative Respiratory Pathway in Mitochondria of Potato Tubers Infected by Pectobacteriumcarotovorum subsp. carotovorum.

Authors:  Minzhi Ma; Suleman Muhammad; Jiangong Duan; Lu Bai; Hongyu Li
Journal:  Foods       Date:  2022-05-27

6.  Growth at Elevated CO2 Requires Acclimation of the Respiratory Chain to Support Photosynthesis.

Authors:  Keshav Dahal; Greg C Vanlerberghe
Journal:  Plant Physiol       Date:  2018-07-24       Impact factor: 8.340

7.  Transcriptome response signatures associated with the overexpression of a mitochondrial uncoupling protein (AtUCP1) in tobacco.

Authors:  Alessandra Vasconcellos Nunes Laitz; Marcio Luis Acencio; Ilara G F Budzinski; Mônica T V Labate; Ney Lemke; Paulo Eduardo Martins Ribolla; Ivan G Maia
Journal:  PLoS One       Date:  2015-06-24       Impact factor: 3.240

8.  Transcriptomic Analysis of Responses to Imbalanced Carbon: Nitrogen Availabilities in Rice Seedlings.

Authors:  Aobo Huang; Yuying Sang; Wenfeng Sun; Ying Fu; Zhenbiao Yang
Journal:  PLoS One       Date:  2016-11-07       Impact factor: 3.240

9.  Distinct roles of alternative oxidase pathway during the greening process of etiolated algae.

Authors:  Ying Liu; Hua Zhang; Yan Cui; Yanli Zheng; Hui Chen; Zhangli Hu; Qingyu Wu
Journal:  Sci China Life Sci       Date:  2020-07-23       Impact factor: 6.038

  9 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.