The LexA regulated genes of the Clostridium difficile.

BACKGROUND: The SOS response including two main proteins LexA and RecA, maintains the integrity of bacterial genomes after DNA damage due to metabolic or environmental assaults. Additionally, derepression of LexA-regulated genes can result in mutations, genetic exchange and expression of virulence factors. Here we describe the first comprehensive description of the in silico LexA regulon in Clostridium difficile, an important human pathogen.
RESULTS: We grouped thirty C. difficile strains from different ribotypes and toxinotypes into three clusters according to lexA gene/protein variability. We applied in silico analysis coupled to surface plasmon resonance spectroscopy (SPR) and determined 16 LexA binding sites in C. difficile. Our data indicate that strains within the cluster, as defined by LexA variability, harbour several specific LexA regulon genes. In addition to core SOS genes: lexA, recA, ruvCA and uvrBA, we identified a LexA binding site on the pathogenicity locus (PaLoc) and in the putative promoter region of several genes involved in housekeeping, sporulation and antibiotic resistance.
CONCLUSIONS: Results presented here suggest that in C. difficile LexA is not merely a regulator of the DNA damage response genes but also controls the expression of dozen genes involved in various other biological functions. Our in vitro results indicate that in C. difficile inactivation of LexA repressor depends on repressor`s dissociation from the operators. We report that the repressor`s dissociation rates from operators differentiate, thus the determined LexA-DNA dissociation constants imply on the timing of SOS gene expression in C. difficile.

Background

Organisms have evolved gene regulatory systems to maintain their genetic integrity. The SOS regulatory network is a paradigm for bacterial response to DNA damage which is controlled by a global transcriptional repressor LexA and an inducer, the recombinase protein RecA. During normal bacterial growth, LexA binds to DNA recognition sequences (operator) positioned near or overlapping the promoter elements of the SOS genes and occludes RNA polymerase, preventing SOS gene transcription. Upon DNA damage, RecA polymerizes on single-stranded DNA (ssDNA) formed at sites of DNA damage, becomes activated (RecA*) and facilitates self-cleavage of LexA resulting in coordinated expression of SOS genes [1].

The SOS system was found in almost all eubacterial groups [2]. It was suggested that the LexA operator spread from Gram positive bacteria into Gram negative bacteria, which indicates on the evolutionary origin of the LexA protein [3]. In Escherichia coli, the consensus operator sequence (SOS box) has been identified as 5′-CTGTN8ACAG-3′ [4] and in the spore former Bacillus subtilis 5′-GAACN4GTTC-3′ [5]. The SOS response comprises a variety of physiological processes, not solely involved in the upkeep of the bacterial genome. LexA represses synthesis of toxins [6,7] and antibiotic resistance determinants [8], controls integron cassette recombination [9] and lateral transfer of virulence factor genes [10], as well as drug resistance genes [11].

Genes under the control of LexA differ significantly among species. B. subtilis LexA controls a regulon of over 60 genes [12] with only eight of these genes having orthologs in E. coli. Those genes play roles in SOS regulation and excision, recombinational and error-prone DNA repair [5].

C. difficile is a human pathogen causing a spectrum of intestinal diseases ranging from mild diarrhoea associated with antibiotic treatment to, in more severe cases, pseudomembraneous colitis [13]. Despite extensive research focused on the bacterium, knowledge regarding its SOS system is scarce [14]. Among other clostridia species, binding sites for LexA were identified in C. acetobutylicum and C. perfringens and resemble Bacillus LexA operator sequences [15,16]. As a suitable target site for LexA is sufficient for binding in vivo[4], we used a robust in silico approach [17] and predicted the LexA-regulated genes of several C. difficile strains. In addition, surface plasmon resonance (SPR) was used to confirm the interactions of LexA with regions defined in in silico experiments.

Results and discussion

Variability of the lexA gene in C. difficile

C. difficile has been described as a bacterium with highly mosaic genetic composition and multiple attempts have been made to distinguish between various strains and to correlate them with virulence [18]. We first analysed the variability of the repressor LexA encoding gene sequence among various C. difficile ribotypes (groups characterized by differences in intergenic regions of RNA operon and used worldwide for C. difficile typing) and toxinotypes (characterized by differences in toxin A and B coding region inside the pathogenicity locus called PaLoc) (Additional file 1: Table S1) [19]. Analysis revealed 17 single nucleotide polymorphisms (SNPs) in the lexA gene of 63C. difficile sequences among which four SNPs resulted in missense mutations but none of the mutations modified amino acids in the cleavage or active sites of LexA (Figure 1). Our analysis grouped the investigated strains into three clusters according to the C. difficile LexA (Figure 2). Cluster I encompassed 3 non-toxinogenic strains and strains of toxinotype 0; Cluster II encompassed strains of toxinotypes III, VIII, IX, and X and finally, Cluster III with the highest number of SNPs, was mostly composed of toxinotype V strains. Ribotypes for the above stated toxinotypes can be found in the Additional file 1: Table S1. Previous results showed that strains belonging to the epidemic ribotype 027 form a genome wide clade [20,21], typically characterised as the toxinotype III (North American pulsed field gel electrophoresis type 1 - NAP1, REA group BI). Interestingly, ribotypes 016, 019, 036, 075, 111, 122, 153, 156, 176, 208 and 273 are closely related to ribotype 027 by comparative genomics [20,21], and those ribotypes were found to encompass the lexA cluster II. Comparative phylogenomics along with MLST (multilocus sequence typing) and whole genome sequecing has shown that ribotype 078 lineage is different than other C. difficile lineages [22]. Moreover PCR ribotype 078 forms a phylogenetically coherent group with ribotypes 033, 045, 066, 078, 126 and 127 [23] – which encompasses lexA cluster III. Genetically distinct strains that belong to ribotypes 078 (V) and 126 (V) clustered together showing the highest number of SNPs in the lexA gene. The phylogenetic tree based on LexA variability reflects similarities to genetic lineages based on ribotype patterns and comparative genomics analysis.

Figure 1

Variability of gene . Representation of the C. difficile 630 strain lexA nucleotide sequence in comparison to repressor sequences of 62 other strains. Grey arrow denotes the nucleotide sequence of the CD630 lexA gene. Black arrows mark the position of domains in LexA. The number of strains with specific SNP and the corresponding nucleotide/aminoacid change is marked above the arrow. The ordinal number of nucleotides in lexA is presented below the arrow. The SNPs marked in blue encompass strains from cluster III, composed mainly of strains belonging to the toxinotype V. The position of the cleavage site and the catalytic residues is marked in purple.

Figure 2

Dendrogram of the aminoacid sequence allignments of LexA derived from genes of strains. PCR ribotypes and toxinotypes of the strains can be found in Additional file 1.

In silico screening for the LexA-regulated genes in C. difficile

To obtain insight into the LexA regulon genes, we performed in silico genome-wide prediction of LexA binding sites within promoter regions of C. difficile. Using the xFiToM software [24], we screened genomes of thirty C. difficile strains (Additional file 1: Table S1) for the C. acetobutylicum and C. perfringens consensus operator sequence of LexA [15,16], allowing for two mismatches in one of the two half sites positioned within 350 bp upstream to 35 bp downstream of a protein coding sequence. Among the thirty genomes, the search yielded at least one putative operator sequence upstream of more than 30 genes involved in a variety of biological processes e.g. DNA repair, transport, virulence and antibiotic resistance (Table 1).

Table 1

predicted LexA binding sites in ribotypes

					Various toxinotypes				Toxinotype V		Toxinotype 0/nontoxinogenic
					O33	O27	O75	O17	O78	126	OO9	OO1	O12	OO5	O87	O14	O53
Gene accession number	GENE	Product	LexA BOX	Distance	1 strain	8 strains	2 strains	1 strain	3 strains	2 strains	1 strain	3 strains	3 strains	3 strains	1 strain	1 strain	1 strain
CDR20291_1854	lexA	Transcriptional regulator. LexA repressor	GAAC....GTTT	−51/-91	1	8	2	1	3	2	1	3	3	3	1	1	1
CDR20291_1169	recA	Protein RecA (Recombinase A)	GAAC....GTTT	−39/-41	1	8	2	1	3	2	1	3	3	3	1	1	1
CDR20291_2696	ruvC	Crossover junction endodeoxyribonuclease	GAAC....GTTT	−65	1	8	2	1	3	2	1	3	3	3	1	1	1
CDR20291_3234	uvrB	Excinuclease ABC subunit B	GAAC....GTTC	−30	1	8	2	1	3	2	1	3	3	3	1	1	1
CDR20291_0487	rusA	Putative RusA-like endodeoxyribonuclease	GAAC....GTTT	−122	1	4	1	1	3	2	NO	NO	1	NO	NO	1	NO
CDR20291_2024	trxB	Thioredoxin reductase	GAAC....GTTT	−216	NO	NO	NO	NO	NO	NO	1	NO	NO	NO	NO	NO	NO
63q42v1_580022	rps3	Putative 30S ribosomal protein S3	GAAC....GTTA	−284	NG	NG	1	NG	NG	NG	NG	1	NG	NG	NG	NO	NO
CDR20291_3107	sspB	Small. acid-soluble spore protein beta	GAAC....GTTC	34	1	8	2	1	3	2	1	3	3	3	1	1	1
CDR20291_0784	oppC	ABC-type transport system. oligopeptide	GAAC…GTTT	−285/-286	1	8	2	1	3	2	1	3	3	3	1	1	1
CDR20291_3532	soj	Small walker A ATPase, chromosome replication	GAAC....GTTT	−226	NO	8	2	1	NO	NO	1	3	3	3	NO	1	1
CDR20291_2297		Putative multidrug efflux pump	GAAC…TTTT	−138	1	8	2	1	3	2	1	3	3	3	1	1	1
63q42v1_310170		ABC-type multidrug-family	GAAC....CTTT	−154	1	8	2	1	3	2	1	3	3	3	1	1	1
CDR20291_3125	vanR	Regulatory protein vanR	GAAC....ATTT	−222	NO	8	2	NO	NO	NO	NO	NO	NO	NO	NO	NO	NO
CDR20291_0083	rplR	50S ribosomal protein L18	GAAC....GTTT	−261/-262	1	8	2	1	3	2	1	3	3	3	1	1	1
CDR20291_0060	rpoB	DNA-directed RNA polymerase subunit β	GAAC…GTTT	−42/-43	1	8	2	1	3	2	1	3	3	3	1	1	1
CDR20291_1619		Putative transcriptional regulator	GAAC…GTTT	30/31	1	8	2	1	3	2	1	3	3	3	1	1	1
63q42v1_570034		Helix-turn-helix domain protein	GAAC…CTTT	−97	NG	3	NG	1	NG	NG	NG	1	NG	1	NG	NG	NG
CDR20291_0882	potC	ABC-type transport system.	GAAC…GTTC	−207	1	8	2	1	3	2	1	3	3	3	1	1	1
CDR20291_0584	tcdA	Toxin A	GAAC....GTTT	−525	NG	8	2	NG	3	2	NG	3	3	3	1	1	1
CDR20291_3466		Putative cell wall hydrolase	GAAC…GTTT	−68	NO	8	NG	NO	NO	NO	NO	NO	NO	NO	NO	NO	NO
CDR20291_2689		Putative membrane protein	GAAC....GTTT	−111	NO	7	2	1	NO	NO	1	3	3	3	1	1	1
CDR20291_1611	moaB	Molybdenum cofactor biosynthesis	GAAC…GTTT	−6	NO	8	2	NO	NO	NO	1	3	NO	3	1	1	NO
CDR20291_2775	celG	Cellobiose-phosphate degrading protein	GAAC....GTTT	−314	NO	8	2	NO	NO	NO	NO	NO	NO	NO	NO	NO	NO
CDR20291_3372	phnH	Phosphonate metabolism protein	GAAC....CTTT	−34	NG	8	2	1	NG	NG	1	3	3	3	1	1	1
CDR20291_1600	thiC	Thiamine biosynthesis protein ThiC	GAAC....ATTT	−175	1	NO	NO	NO	3	2	NO	NO	NO	NO	NO	NO	NO
CDR20291_1940		N-carbamoyl-L-amino acid hydrolase	GAAC....GTTT	−147	NO	NO	NO	NO	NO	NO	NO	3	3	NO	NO	NO	1
CDR20291_2056		Endonuclease/exonuclease/phosphatase	GAAC....GTTT	−466	1	8	2	1	3	2	1	3	3	3	1	1	1
NAP07v1_640016		Two-component sensor histidine kinase	GAAC....GTTT	−217	NO	8	NO	NO	NO	NO	NO	NO	NO	NO	NO	NO	NO
CDR20291_0331	cbiQ	Cobalt transport protein	GAAC....GTTT	−122	1	8	2	1	3	2	1	3	3	3	1	1	1
CDR20291_2597		Putative oxidoreductase	GAAC....CTTC	2	1	8	2	1	3	2	1	3	3	3	1	1	1
NAP07v1_470051	aroF	P-2-dehydro-3-deoxyheptonate aldolase	GAAC....CTTT	−225	1	NO	NO	NO	3	2	NO	NO	NO	NO	NO	NO	NO
97b34v1_600001		Transposase	GAAC....GTTT	−217	NO	8	NO	NO	NO	NO	NO	NO	NO	NO	NO	NO	NO
CDE15v2_1270013		Putative cI repressor	GAAC....GTTC	−67	NG	NG	NG	NG	NG	NG	NG	NG	NG	NO	1	NO	NG
63q42v1_370450		Extrachromosomal origin protein	GAAC…GTTT	10	NG	NG	NG	NG	NG	NG	1	3	3	3	1	1	1
CDR20291_1803	vexP	ABC transporter. ATP-binding/permease	GTTC....TTTT	−85	NO	8	2	1	NO	NO	NO	1	2	NO	NO	NO	1
97b34v1_250108		ABC-type transport system. sugar-family	GAAC…GTTC	−267	NG	8	2	NG	NG	NG	NG	NG	NG	NG	NG	NG	NG

Sequences of putative LexA operators and their positions (according to the start of the gene coding region). Numbers denote strains with the operator identified. NO marks the gene that was identified in the strain but a target LexA site was not found in its promoter region, NG marks that gene was not found in the genome of the strain.

Subsequently, we purified C. difficile LexA and RecA proteins with an N-terminal hexa-histidine tag (Additional file 2: Figure S1) as described for E. coli orthologs [25]. SPR analysis was performed to validate the in silico data and determine the LexA-operator interactions in vitro in real time. Most of the interaction sites were found in putative promoter regions of “common” putative SOS genes for the majority of the genomes tested and of putative LexA regulon genes encoding unusual SOS proteins. Out of 20 DNA fragments tested, the repressor interacted with 16 targets (Figure 3A, Additional file 3: Table S2). We determined interaction with operators in promoter regions of the core SOS response genes: recA, lexA, the genes of the uvrBA operon encoding for components of the UvrABC endonuclease catalyzing nucleotide excision repair and the ruvCA operon genes, encoding the nuclease that resolves Holliday junction intermediates in genetic recombination. In addition, LexA interacts with putative promoter regions of genes involved in sporulation (sspB), regulation of DnaA-dependent initiation of DNA replication (soj), several ABC transporters (potC, oppC, MicroScope:CDR20291_2297) and for homologue of a two-component system regulator of the vancomycin resistance cluster (vanR). The LexA repressor was also found to interact within PaLoc with operator identified 525 base pairs upstream of the toxin A gene (tcdA). While the regulation of toxin production in C. difficile is controlled in response to several environmental signals mediated by pleiotropic regulators (CcpA, CodY, SigD and SigH [26]), the possible regulation through the SOS system sheds new light on this issue. Furthermore, the subinhibitory concentration of SOS-inducing antibiotic ciprofloxacin was recently shown to increase the Toxin A gene expression in C. difficile[27]. Our SPR analysis revealed that also housekeeping genes required for ribosome function (rplR) and β subunit RNA polymerase (rpoB) belong to the LexA regulon, a feature of the SOS network not yet observed in bacteria. Thus, blockage of LexA self-cleavage could impede pivotal functions in C. difficile and this might provide a new approach to treat C. difficile infections. Moreover, although putative SOS genes are present in most of the analysed genomes, several of these genes encoding for putative cell wall hydrolase, transposase and for two component sensor histidine kinase seem to be regulated by LexA only in the 027 ribotype strains (Table 1). The in silico analysis showed operators in front of several genes upregulated exclusively in ribotype 075 and 027 (celG, vanR, ABC-type transport system). Furthermore, among the analysed genomes, exclusively in the closely related ribotypes 078, 126 and 033, the LexA target site was not found in front of the soj (regulation of DNA replication) and the phnH (phosphonate metabolism protein). Thus the mode of SOS regulation might be related to phylogenetic lineages.

Figure 3

LexA regulon genes. (A) SPR sensorgrams of the binding of C. difficile LexA with in silico predicted target DNA sites. Selection of LexA target genes determined by in silico and analysed by SPR. LexA (20 nM) was injected for 60 s across the chip-immobilized DNA fragments containing either of the putative operators and dissociation was followed for 540 s. The representative sensorgrams are shown and the dissociation constants presented as average values of triplicate experiments presented with standard deviation. By n.d. we mark if dissociation rate constant was not determined and the response units are marked by RU. With the MEME tool determined motifs for the target DNA sites found in promoter regions of the genes higher affinity CDR20291_2056, lexA, uvrB, recA, sspB, ruvC, CDR20291_2689, oppC, tcdA, 97b34v1_250108, showing high affinity for LexA (B) or of the genes rplR, rpoB, soj, potC, vanR, CDR20291_2297 to which LexA does not bind stably (C).

Cross-reaction of SOS system components in E. coli and C. difficile

Induction of SOS gene expression is synchronized and the level, timing and duration of expression of the individual LexA regulon genes differs significantly (1). In E. coli, LexA bound to target DNA cannot interact with RecA* and only unbound repressor is proteolytically inactivated [25]. Thus the rate of LexA dissociation from operators controls the precise timing of SOS gene expression following induction. Consequently genes with lower affinity LexA target sites are expressed prior to genes with high affinity operators [1,5]. To follow up on these results, we used SPR to study interaction of the chip-immobilized C. difficile RecA* with LexA interacting with either specific or non-specific DNA. We showed that as in E. coli, the C. difficile LexA repressor interaction with RecA* is prevented by binding to specific DNA targets (Figure 4). In addition, we showed that the key SOS players of E. coli and C. difficile can cross-react in vitro (Figure 4). Hence, our data indicated that the mode of regulation of the C. difficile SOS response resembles the one described for E. coli. Nevertheless, in contrast to the E. coli SOS system, we observed among the investigated C. difficile genes, a slowest LexA dissociation from operators of the core SOS genes, recA, lexA and uvrB (Figure 3A and B, Table 2), implying that these are the last genes upregulated upon SOS induction. For instance, LexA dissociation from the E. coli recA operator is more than 20-times faster than from C. difficile with regard to the dissociation constants of 4.8 ± 2.1 × 10−3 s−1 (21) and 1.7 ± 0.5 × 10−4 s−1, respectively.

Figure 4

Specific DNA precludes RecA*-LexA interaction. Interaction of C. difficile LexA repressor (2.6 μM) incubated with specific, 22-bp recA operator (A) or with non-specific DNA fragment, recA operator with modified six nucleotides (B), with the chip-immobilized C. difficile RecA* (~2000 response units). The used DNA interacting with repressor was in 1.4 μM (black line), 2.7 μM (red line), 4.0 μM (green line), 5.4 μM (blue line), 8.1 μM (pink line) concentration. The cyan line presents sensorgram of the free DNA at 8.1 μM concentration interacting with the RecA*. (C) In vitro repressor cleavage pattern exhibits that purified E. coli and C. difficile key SOS players can cross-react. C. difficile proteins are marked as RecA* (CD), LexA (CD) and E. coli proteins as RecA* (EC) and LexA (EC), respectively. Time course (min) of either C. difficile or E. coli RecA*-induced inactivation of LexA (CD) or LexA (EC) repressor. Quantification of LexA is presented on the gel above the respective band as the ratio (%) of the protein density value of the initial sample (0 min) relative to the density value obtained from the proteins after indicated time points after addition of RecA*, shown with standard deviation.

Table 2

Target DNA sequences of the putative SOS genes of the R20291 strain used for the SPR analysis

GENE	Function	Product	Putative LexA operator (R20291 strain) (5`- -3`)	Distance from CDS
lexA	SOS response	Transcriptional regulator. LexA repressor	AGGAACAAATGTTTGC	−51/-91
recA	SOS response/DNA repair	Protein RecA (Recombinase A)	GAGAACAAATGTTTGT	−39/-41
ruvC	DNA repair	Crossover junction endodeoxyribonuclease	TAGAACATAAGTTTTT	−65
uvrB	DNA repair	Excinuclease ABC subunit B	AGGAACTAATGTTCGA	−30
sspB	Spores	Small. acid-soluble spore protein beta	CAGAACAGTAGTTCCA	34
oppC	Spores/ABC transporter	ABC-type transport system. oligopeptide-family	TAGAACATAAAAATTT	−285/-286
soj	Regulation of DNA replication	protein Soj	TTGAACTTTAGTTTCT	−226
CDR20291_2297	Antibiotics	Putative multidrug efflux pump	AAGAACATCTGAAAAG	−138
vanR	Antibiotics	Response regulator VanR	CAGAACTATTATTTTA	−222
rplR	DNA/RNA	50S ribosomal protein L18	ATGAACTTAGGTTTCT	−261/-262
rpoB	DNA/RNA	DNA-directed RNA polymerase subunit beta	ATGAACTATTGTTTTA	−42/-43
potC	Biofilm	ABC-type transport system. spermidine/putrescine	TGGAACTTTGGTTCAG	−207
tcdA	Toxicity	Toxin A	GTGAACCAATGTTTGA	−525
CDR20291_2689	Cell wall/membrane	Putative membrane protein	TGGAACTTTAGTTCTA	−111
CDR20291_2056	Signalling	Putative endonuclease/exonuclease/phosphatase	AAAAACACCCGTTCTGCAAACATTCGTTCTG	−466
NAP07v1_640016	Signalling/Chemotaxis	Two-component sensor histidine kinase	GAGAACCTGTGTTTTT	−217
cbiQ	Transport	Cobalt transport protein	ATGAACCATGGTTTAG	−122
aroF	Transport	Phospho-2-dehydro-3-deoxyheptonate aldolase	ATGAACTATTCTTTCT	−225
vexP	ABC transporter	ABC transporter. ATP-binding/permease protein	AAGTTCAAATTTTTGA	−85
97b34v1_250108	ABC transporter	ABC-type transport system sugar-family	AAGAACTAAAGTTCCT	−267

We propose that in C. difficile, strong repression of core SOS genes affects the magnitude of the system`s induction. Thus, the low association and non-stable LexA binding to putative regulatory regions of genes encoding the RNA polymerase β subunit (rpoB), 50S ribosomal protein (rplR), spermidine/putrescine permease (potC), vancomycin response regulator (vanR) and putative multidrug-efflux-pump [MicroScope: CDR20291_2297], indicates that LexA contributes to fine-tuning of expression of these genes independently of substantial recA induction (Figure 3).

The paradigm of the SOS system is that DNA repair genes are rapidly induced in the SOS response to deal with DNA lesions [1,2,28]. However, comparison of induction of LexA regulon genes in B. subtilis and E. coli in response to double-strand breaks reveals diversity [29]. After DNA damage, the velocity of assembly of RecA* is similar but in contrast to E. coli, a limited set of LexA-regulated genes are induced early in the response in B. subtilis. Our in vitro results suggest that also in C. difficile, induction of the LexA-regulated DNA repair genes might be induced later in the SOS response as the core SOS gene promoter regions harbour high affinity LexA targets. According to the differences in LexA-operator affinities we predict that upon DNA damage, various biological processes will be derepressed without induction of the SOS DNA repair.

Conclusions

We have generated maps of LexA target sites within the genomes of C. difficile strains. We predict that SOS functions in C. difficile are not solely involved in the DNA repair but are probably linked to other biological functions (virulence factors, sporulation,…). As C. difficile infection is a growing problem in healthcare facilities and community patients, further characterisation of the LexA-regulon could provide key insights into pathogenesis. Our data suggest that molecules targeting key SOS proteins could block several houskeeping functions and could provide next generation of C. difficile antibiotics. Furthermore, the defined differences in lexA gene group C. difficile strains into three clusters which correlated well with phylogentic lineages suggested by comparative genomic approaches.

Materials and Methods

Source

The C. difficile genomes were obtained from an opened access NCBI database [30] and an undisclosed access to MicroScope platform [31]. The strains used for amplification with PCR and sequencing belong to the strain collection of the Institute of Public Health Maribor. The list of strains used for analysis of the LexA variability and regulon is presented in the Additional file 1: Table S1.

Variability of lexA gene

Variability of lexA in C. difficile was compared by analysis of alignment and phylogenetic trees of nucleotides and amino acid sequences performed with Vector NTI (Invitrogen) and with the interactive viewer for phylogenetic trees: Dendroscope [32]. Sixty three sequences were analysed in total (NCBI – 9 strains, MicroScope – 44 strains, PCR product of in-house strains – 10). Strains CD196, R20291 and 630 were obtained from both databases. List of strains used for lexA gene variability can be found in Additional file 1: Table S1.

In silico determination of the C. difficile SOS regulon

The search for LexA binding sites was performed for 30 genomes (Additional file 1: Table S1). The number of strains covering ribotypes was as follows: ribotype 027 – eight strains; ribotypes: 078, 001, 005 and 012 - three strains from each; ribotypes 075 and 126 two strains from each and one genome from each ribotypes 017, 087, 014, 053. The analysis was performed with xFiToM software [24]. The searched motifs, based on C. acetobutylicum and C. perfringens consensus, were as follows: GAACnnnnGTTT, GAACnnnnGTTC, GAACnnnnnTTT, GAACnnnnnTTC. The default options were used with the limitation to 350 base pairs upstream to 35 bp downstream of a protein coding sequence. An exception was the promoter region of the putative endonuclease/exonuclease/phosphatase (MicroScope: CDR20291_2056) where we found 2 operators positioned approximately 460 upstream of the coding sequence and hence, we included the targets in the analysis. The results were subjected to manual check by extraction of gene sequences along with 1000 base pairs upstream and downstream followed by alignment and re-search of the binding sites.

Cloning, expression and isolation of recombinant C. difficile LexA and RecA protein

The C. difficile 630 chromosomal DNA was extracted by the Genomic DNA purification kit (Thermo Scientific) according to the manufacturer`s instructions. The lexA and recA genes were amplified by PCR from the chromosomal DNA using specific primers (DinR_U 5′-GCGCGGATCCAGTGATGTTATGTATTTAGATC-3′ - DinR_D 5′-CGCACGCGTCTATTTAATAACTCTAAATAC-3′) and (RecA_U 5′-GCGCGGATCCAGTGTAGATCAAGAAAAATTAAAAG-3′ - RecA_D 5′-CGCACGCGTTTATTCTTCTACAATTTCTTTTG-3′), respectively. The PCR products were then purified and cut with BamHI and MluI and cloned into pET8c vector digested by the same enzyme to create plasmids pDinRCD and pRecACD for expression of proteins fusion with N-terminal His6 tag. Large-scale expression of proteins was performed in the E. coli BL21 (DE3) strain and purified from the bacterial cytoplasm by Ni-NTA affinity chromatography as described for the E. coli key SOS proteins [25]. PD10 desalting columns (GE Healthcare) were used for exchange of the buffer. The proteins were stored at −80°C in 20 mM NaH2PO4 (pH 7.4), 0.2 mM NaCl. Protein concentrations were determined using NanoDrop1000 (Thermo Scientific) and extinction coefficients at 280 nm of 7450 M−1 cm−1 for recombinant LexA and 16055 M−1 cm−1 for recombinant RecA.

Surface plasmon resonance assays

C. difficile LexA-operator measurements were performed on a Biacore T100 (GE Healthcare) at 25°C as described [6]. The 3′-biotynilated 5-CGCTCGAGTAGTAAC-TEG-Bio-3′primer was immobilized on the flow cell 2 (Fc2) of the streptavidin sensor chip (GE Healthcare) in SPR buffer containing 20 mM Tris–HCl (pH 7.4), 140 mM NaCl, 0.005% surfactant P20 (GE Healthcare). To prepare double stranded DNA (dsDNA) fragments with the predicted C. difficile LexA operators, complementary pairs of primers presented in Additional file 3: Table S2 were dissolved in 20 mM NaH2PO4 (pH 7.4), 0.14 M NaCl and mixed in 1:1.5 (mol : mol) ratio for the longer to shorter primer, respectively. Primers were annealed in temperature gradient from 95°C to 4°C (~ 1.5 h) in PCR machine (Eppendorf). So prepared DNA fragments were approximately 22 bp duplex DNAs with 15-nucleotide overhangs complementary to the chip-immobilized primer. Approximately 44 response units of either DNA fragment were hybridised at 2 μl min−1 to the Fc2. The interaction of C. difficile LexA with the chip-immobilized DNAs was analysed by injecting repressor in SPR buffer in 20 nM concentration across the chip surface at 100 μl min−1 for a minute and dissociation was followed for 9 minutes. The regeneration of the surface was achieved injecting 12 s pulse of 50 mM NaOH at 100 μl min−1. The experiments were performed in triplicates and the representative sensorgrams are shown. Data were fitted to a 1:1 binding model to obtain the dissociation rates constants. Program MEME was used to determine LexA binding motifs [33].

SPR C. difficile RecA*-LexA interaction measurements were performed on a Biacore X (GE Healthcare) at 25°C as described to study the interaction among the key E. coli SOS proteins [25]. Experiments were performed in SPR_2 buffer (20 mM NaH2PO4 (pH 7.4), 150 mM NaCl, 2 mM MgCl2, 1 mM DTT, 1 mM ATP (Sigma Aldrich), 0.005% surfactant P20 (GE Healthcare). C. diffcile LexA repressor (2.6 μM), interacting with either the 22 bp recA operator DNA fragment or with the 22 bp non-specific DNA fragment derived from the recA operator, was passed over the sensor chip with immobilized RecA* (~2000 response units). LexA specific DNA (recA operator) or non-specific DNA, with 6 nucleotide changed in comparison to the specific DNA, was prepared by hybridising primers (1:1 mol to mol ratio) 5′-CAAGAGAACAAATGTTTGTAGA-3′ and 5′-TCTACAAACATTTGTTCTCTTG-3′or 5′-CAAGACCGGAAATCCTTGTAGA-3′ and 5′-TCTACAAGGATTTCCGGTCTTG-3′, respectively. The RecA*-LexA interaction was assayed at 10 μl/min for 60 s and the dissociation followed for 60 s. The sensor chip was regenerated as described [25].

Repressor cleavage assay

Activation of either E. coli or C. difficile RecA (10 μM) nucleoprotein filament was performed on ice for 2 h as described [34]. RecA*-stimulated (~2 μM) cleavage of LexA were performed in 20 mM Tris, pH 7.4, 5 mM MgCl2, 1 mM ATP-γ-S (Sigma), and 1 mM DTT as described [25]. Samples were resolved on 12% SDS PAGE gels in MOPS running buffer (Invitrogen) and stained by Page blue protein stain (Thermo Scientific). The resolved bands were quantified using a G:Box (Syngene). The integrated optical densities of the LexA monomers were determined. The LexA levels throughout the time course were compared and are presented as the ratio of the density value for the sample at time indicated as 0 min relative to the density value obtained from the samples obtained later in the LexA cleavage reaction. The experiments were performed two times and representative gels are shown.

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

BMW, NP and MB designed and performed most of the experiments, VH, NP and GA contributed to SPR experiments, NP and DZB contributed to expression and cleavage experiments; BD and MR contributed toward strain and genome selection. All authors contributed to analysis of the results and during the preparation of the manuscript.

Additional file 1: Table S1

List of genomes used for analysis of SOS regulon and LexA variability. The names of the strains used for SOS regulon analysis are additionally bolded.

Click here for file

Additional file 2: Figure S1

Comassie stained C. difficile (CD) LexA and RecA proteins and the LexA protein from Escherichia coli (EC). Proteins used in the study were more than 95% pure. Approximately 5 μg of each protein was loaded on the SDS-PAGE gel.

Click here for file

Additional file 3: Table S2

Pairs of primers used to construct double stranded DNAs harbouring predicted LexA target sites. Putative LexA operators are underlined.

Click here for file