Literature DB >> 24688521

Investigation of the association between clinical outcome and the cag pathogenicity-island and other virulence genes of Helicobacter pylori isolates from patients with dyspepsia in Eastern Turkey.

Gokben Ozbey1, Ulvi Demirel2, Cem Aygun2, Hasan Basri Ertas3.   

Abstract

The aims of our work were to determine the presence of the cag pathogenicity-island (cag PAI) and other virulence genes of Helicobacter pylori recovered from patients with gastritis and peptic ulcer, and to investigate the correlation of these virulence genes with clinical outcome. The presence of the cagA, the promoter regions of cagA, cagE, cagT, and the left end of cag-PAI (LEC), cag right junction (cagRJ), the plasticity region open reading frames (ORFs), vacA and oipA genes among 69 H. pylori isolates were determined by polymerase chain reaction. Intact cag PAI was detected in only one (1.4%) isolate. The cagA gene was identified in 52.1% and 76.2% of isolates from patients with dyspepsia (gastritis and peptic ulcer), respectively. The plasticity region ORFs i.e. JHP912 and JHP931 were predominantly detected in isolates from peptic ulcer. Less than 25% of the isolates carried other ORFs. Types I, II and III were the most commonly found among the isolates. None of the isolates possessed type Ib, 1c, IIIb, IV and V motifs. The most commonly vacA genotypes were s1am1a and s1m2 in isolates with peptic ulcer and gastritis, respectively. The results confirmed that the prevalence of oipA (Hp0638) gene was 75% and 85.7% in patients with gastritis and peptic ulcer, respectively. Furthermore, vacA s1am1a positivity was significantly related to peptic ulcer (p < 0.05).

Entities:  

Keywords:  Helicobacter pylori; cag pathogenicity-island; gastritis; peptic ulcer; polymerase chain reaction

Mesh:

Substances:

Year:  2014        PMID: 24688521      PMCID: PMC3958197          DOI: 10.1590/s1517-83822013000400034

Source DB:  PubMed          Journal:  Braz J Microbiol        ISSN: 1517-8382            Impact factor:   2.476


Introduction

Helicobacter pylori (H. pylori) is a bacterial pathogen which can cause gastritis, peptic ulcer and gastric carcinoma (Cremonini ; Saunders ). Strains of H. pylori are classified into two types (types I and II) (Xiang : Hofman ). Type I is a pathogenic form, correlates with severe disease status, expresses functional vacuolating cytotoxin A (vacA) and includes an approximately 40 kb cluster located at 3′ end of the cag pathogenicity island (cag PAI) (Censini ; Ikenoue ; Kersulyte ; Mattar ). Type II which is less virulent and includes a non-pathogenic form of vacA, lacks cag PAI (Censini ; Backert ). The cag PAI is separated the two groups (cagI and cagII) by a novel insertion sequence called IS605 and these include at least 14 and 16 open reading frames (ORFs), respectively (Censini ; Akopyants ; Audibert ; Mattar ). The cytotoxin associated gene E (cagE) gene which is needed for the induction of interleukin (IL)-8 from gastric epithelial cells is located in the cagI (Censini ; Ikenoue ; Tan ). The cagT gene has been reported to be a marker of the cagII region (Mattar ) and correlates with severe clinical outcomes (Mattar ; Pacheco ). Comparison of the genome sequence analysis of H. pylori 26695 and J99 strains demonstrated several regions of different G+C contents (Tomb ; Alm ; Occhialini ; Salih ). From these regions, a large region in strains J99 and 26695 has been named as the “plasticity region” (Alm ; Doig ; Salih ). In the J99 plasticity region (JHP914 to JHP951), the authors reported to observed to be 38 ORFs while 33 ORFs were not included in H. pylori 26695, and the majority of the ORFs encode putative proteins with unknown function (Occhialini ). However, some of ORFs have been determined to share similarity to genes encoding proteins included in DNA replication (JHP919 and JHP931) and other functions (JHP941 and JHP951) (Occhialini ; Salih ). Till date, we studied on the presence of several genes, such as cagA, vacA, cagE, induced by contact with epithelium (iceA) and blood adhesion binding antigen (babA2) among adults (Ozbey ) and children (Ozbey ) in Eastern Turkey. However, the data on identification of cag PAI and multiple virulence genes of H. pylori in Turkey is scarce. This study aimed to identify the presence of cag PAI and other virulence genes of H. pylori isolates from dyspeptic patients with gastritis and peptic ulcer in Elazig Province, the East of Turkey as well as to evaluate the relevance between the clinical outcome and the cag PAI and other virulence genes.

Materials and Methods

Isolates

A total of 69 H. pylori isolates (48 cases of gastritis and 21 cases of peptic ulcer) obtained from Turkish dyspeptic patients attending Gastroenterology Unit of Firat University Hospital between May and December 2011 were analyzed for the presence of cag PAI and other virulence genes. Ethics approval was given by the Medical Ethics Committee at Firat University and informed consent was ensured from each participant.

DNA extraction and Determination of the cag-PAI and other virulence genes

DNA samples from H. pylori isolates were extracted by QIAamp DNA mini kit (Qiagen, Germany) according to the manufacturer’s guidelines. PCR analyses were performed to amplify cagA, the cagA promoter region, cagE, cagT, and the LEC of the cag PAI, as described elsewhere (Ikenoue ; Kauser ) (Table 1).
Table 1

Oligonucleotide sequences and cycle conditions used for detecting the cag PAI and the other virulence genes of H. pylori isolates in the current study.

GenesPrimerOligonucleotide sequence (5′-3′)PCR conditionsSize (bp) of PCR productReferences
cag PAI
cagA1cagA-F1AACAGGACAAGTAGCTAGCC701
cagA-R1TATTAATGCGTGTGTGGCTG
cagA2cagA-F2GATAACAGGCAAGCTTTTGA349
cagA-R2CTGCAAAAGATTGTTTGGCAGA94 °C for 5 min (initial denaturation)
cagAP1cagAP-F1GTGGGTAAAAATGTGAATCG90 °C for 30 s; 52 °C for 30 s730
cagA-R2CTGCAAAAGATTGTTTGGCAGA70 °C for 1 min (40 cycles)
cagAP2cagAP-F2CTACTTGTCCCAACCATTTT70 °C for 10 min (final extension)1181(Ikenoue et al., 2001; Kauser et al., 2004, 2005a)
cagA-R2CTGCAAAAGATTGTTTGGCAGA
cagEcagE-F1GCGATTGTTATTGTGCTTGTAG329
cagE-R1GAAGTGGTTAAAAAATCAATGCCCC
cagTcagT-F1CCATGTTTATACGCCTGTGT301
cagT-R1CATCACCACACCCTTTTGAT
LECILEC-F1ACATTTTGGCTAAATAAACGCTG384
LEC-R1TCTCCATGTTGCCATTATGCT
LECIILEC-F2ATAGCGTTTTGTGCATAGAA877
LEC-R2ATCTTTAGTCTCTTTAGCTT
cag right junction
cagF4584 F (1)GTTAATACAAAAGGTGGTTTCCAAAAATC1000/800
cagR5280 R (3)GGTTGCACGCATTTTCCCTTAATC
cagF4584 F (1)GTTAATACAAAAGGTGGTTTCCAAAAATC400
miniIS605 R (8)CCGCTAAAGACGATTGGGCTT
fcn unk F (6)TGGATTAAATCTTAATGAATTATCG350(Kersulyte et al., 2000; Kauser et al., 2005a)
cagR5280 R (3)GGTTGCACGCATTTTCCCTTAATC94 °C for 30 s, 52 °C for 30 s
fcn unk F (6a)ACTCTATTTTGCTTGCAGTGCTTTTGG72 °C for 1 min (30 cycles)350
cagR5280 R (3)GGTTGCACGCATTTTCCCTTAATC
cagF4856 F (4)GCGATGAGAAGAATATCTTTAGCG350
cagR5280 R (3)GGTTGCACGCATTTTCCCTTAAT
IS606-1692 F (5)CTAACAATTTGCCATTATGCTGT2000
cagR5280 R (3)GGTTGCACGCATTTTCCCTTAATC
cagF4584 F (1)GTTAATACAAAAGGTGGTTTCCAAAAATC400
Xins.R (7)CGCTCTCTAATTGTTCTAGGA
Plasticity region ORFsJHP912 FCAATAGCCTTGCTCACGCTTC624
JHP912 RGTTAAATGGTGAGAGCCTACG
JHP926 FGATGAGCAAATCAATGGCATG991
JHP926 RACCTTTCAATACCGCTAGAAG
JHP931FGTATTAGCGAAGTGCAATCAC1.133
JHP931RGCTAATTTGTTTAGGCGTAGC94 °C for 5 min (initial denaturation(Mukhopadhyay et al., 2000 Kauser et al., 2005a)
JHP933 FGAGTGAGTTTAAGCGAAC94 °C for 1 min, 62°C for 1 min708
JHP933 RCTTGTTGCTCTTGCAAGG72 °C for 1 min (35 cycles)
JHP944 FCTATGAGTGAAGAATTAACGC72 °C for 7 min (final extension)358
JHP944 RCGCTCCATTCCAATATCTTTG
JHP945 FCAATGCGACTAACAGCATAG1.028
JHP945 RCGCATTTGCTGTCATCTTTG
JHP947 FGATAATCCTACGCAGAACG611
JHP947 RGCTAAAGTCATTTGGCTGTC
JHP986 FGCATGTCCCAAATCGTAGG566
JHP986 RTGCATTTCGCATTGGCTCC
vacA signal and middle regions
vacAs1 or vacAs2VAIFATGAAAAAAACCCTTTTAC259 (s1)(Carrol et al., 2004)
VAIXRCGAATTGCAAGTGATGGT286 (s2)
vacAs1aSS1-FGTCAGCATCACACCGCAAC190
VA1-RCTGCTTGAATGCGCCAAAC(Atherton et al., 1995)
vacAs1bSS3-FAGCGCCATACCGCAAGAG187
VA1-RCTGCTTGAATGCGCCAAAC
vacAs1cS1C-FCTCTCGCTTTAGTGGGGYT213(Yamazaki et al., 2005)
VA1-RCTGCTTGAATGCGCCAAAC
vacAm1aVA3-FGGTCAAAATGCGGTCATGG94 °C for 30 s; 54 °C for 30 s300
VA3-RCCATTGGTACCTGTAGAAAC72 °C for 1 min (30 cycles)
vacAm1bVAm-F3GGCCCCAATGCAGTCATGGAT300(Kersulyte et al., 2000; Kauser et al., 2005a)
VAm-R3GCTGTTAGTGCCTAAAGAAGCAT
vacAm2VA4-FGGAGCCCCAGGAAACATTG400
VA4-RCATAACTAGCGCCTTGCAC
oipAHP0638-FGTTTTTGATGCATGGGATTT94 °C for 1 min; 52 °C 1 min;401(Veralovic et al., 1991; Kauser et al., 2005a)
HP0638-RGTGCATCTCTTATGGCTTT72°C for 1 min (35 cycles)
Primers which designed by Kersulyte , Mukhopadhyay , Veralovic and Kauser were used to determine the presence of the cag right junction (cagRJ), the plasticity region ORFs, vacA and oipA (Hp0638) genes (Table 1). Amplification reactions were performed using 2×PCR Master Mix kit (#K01071, Fermentas) following the manufacturer’s instructions in touchdown thermal cycler (Hybaid, England) with PCR conditions shown in Table 1. Ten μL aliquot of each amplicon was expose to gel electrophoresis on a 1.5% agarose gel and visualised using a UV transilluminator.

Statistical analysis

Fischer’s exact and χ 2 tests were used to analyze significant differences between the cag PAI and other virulence genes of H. pylori isolates with the clinical outcome. A probability of less than 0.05 was evaluated significant.

Results

Table 2 shows the distribution of the cag PAI and other virulence genes of H. pylori isolates from cases of gastritis and peptic ulcer. The prevalence of LECI, LECII, cagE, the promoter region of the cagA and cagA were detected more (14.3%, 19%, 38.1%, 47.6% and 76.2%, respectively) in isolates from peptic ulcer. One isolate (1.4%; 1 of 69) were observed to possess the intact cag PAI.
Table 2

Distribution of the cag PAI and the other virulence genes of H. pylori isolates from cases of gastritis and peptic ulcer.

cag PAIGastritis (n = 48) (%)Peptic ulcer (n = 21) (%)
 LEC15 (10.4)3 (14.3)
 LEC23 (6.3)4 (19)
cagT17 (35.4)7 (33.3)
cagE16 (33.3)8 (38.1)
cagAP8 (16.7)10 (47.6)
cagA25 (52.1)16 (76.2)
cagRJ region
 Type I3 (6.3)1 (4.8)
 Type Ia04 (19)
 Type II2 (4.2)0
 Type III4 (8.3)0
 Type IIIa1 (2.1)5 (23.8)
ORFs
 JHP91225 (52.1)14 (66.7)
 JHP9261 (2.1)0 (0)
 JHP93115 (31.3)9 (42.9)
 JHP93310 (20.8)5 (23.8)
 JHP9448 (16.7)3 (14.3)
 JHP94511 (22.9)4 (19)
 JHP9866 (12.5)1 (4.8)
vacA alleles
vacAs1a35 (72.9)19 (90.5)*
vacAs1b2 (4.2)0 (0)
vacAs211 (22.9)2 (9.5)
vacAm1a10 (20.8)15 (71.4)*
vacAm238 (79.2)6 (28.6)
oipA36 (75)18 (85.7)

significant p < 0.05.

Types I (6.3%), II (4.2%) and III (8.3%) were observed predominantly in isolates from gastritis. However, Ia (19%) and IIIa (23.8%) motifs were the most common types in peptic ulcer isolates. None of the isolates contained type Ib, 1c, IIIb, IV and V motifs. The most predominant plasticity region ORFs were JHP912 and JHP931 and these two ORFs were identified more in isolates from peptic ulcer. Less than 25% of the isolates carried other ORFs (JHP926, JHP933, JHP944, JHP945, JHP986). The vacA s1am1a was the most extensively vacA genotype found in isolates with peptic ulcer while s1m2 was the most predominant genotype in patients with gastritis. However, no vacAs1c, vacAm1b and vacAs2m1 genotypes were demonstrated in the current study. The oipA gene was observed in 75% of isolates with gastritis and 85.7% of isolates with peptic ulcer. Assesing the association between the cag PAI and other virulent genes with clinical outcome, vacA s1am1a genotype was shown to be statistically significant with peptic ulcer (p < 0.05).

Discussion

Since its first identification by Censini in 1996, the cag PAI part of the H. pylori genome has been widely studied so far (Olbermann ; Rizzato ). Conflicting results have been obtained in studies on the prevalence of cagA gene in different geographical regions of the world. The prevalence of the cagA gene was 60–70% in Western countries (Rudi ) but the prevalence in East Asian countries was detected to be found in more than 90% of cases (Maeda ; Yamaoka ). This study was similar to that reported in Turkey (Salih ) and Western countries (Covacc ; Arents ) where cagA gene were observed to be higher in peptic ulcer patients compared to gastritis. We confirmed that no relevance between the cagA and gastroduodenal disease in the present study which was in accordance with previous studies (Hussein ; Baghaei ). However, other studies (Gunn ; Basso ) represented an association. Previous studies reported that strains which lack the cagT gene had a defective ‘molecular syringe’ (Rohde ; Kauser ). We represented that isolates from gastritis and peptic ulcer carried cagE and cagT with almost similar proportion. In a study performed in England, most of strains obtained from ulcer patients retained the cagE and cagT (Kauser ). A pevious study has shown that the cagE is a better marker of an intact cag PAI in Japanese strains (Ikenoue ) which is in contrast with our findings. Kauser and Matteo described that a conserved LEC region was rearranged more in strains related to severe pathology worldwide. The prevalence of the cag PAI varies in different geographical regions. There was only one report concerning the distribution of the cag PAI and the ORFs of H. pylori strains in Turkey (Salih ). Previous reports showed that an intact cag PAI gene was highly observed in Japanese, Malaysia and Singapore strains, least found in European and African strains, and very poorly found in Peruvian, Indian, Iranian and Turkish strains (Kauser et al., 20004; Baghaei ; Salih ; Schmidt ). Our results also support the findings (Baghaei ; Rudi ) indicated that an intact cag PAI gene was detected to be low prevalence in Iranian and Turkish strains. This could be due to geographical closeness, the similar condition of life and diet in Iran and Turkey (Baghaei ). An intact cag PAI may be underestimated when a selective primers were used since cag PAI was encoded by ~ 40 kb gene (Schmidt ). Five main types (I, II, III, IV and V) were detected at the cag RJ region and scientists reported that the three types (I, II and III) were prevalent (Kersulyte ). The authors indicated that type IIIa or type I were observed in 28.8% of the motifs in England strains and some of the European strains share similar profiles with the Asian strains (Kauser ) The results of the current study are also supportive of a previous study that Turkish strains showed to be predominant of types I, II and III which were no associated with the severity of the disease (Salih ). Among the plasticity region ORFs, JHP940 and JHP947 have been observed more in strains with gastric cancer (Occhialini ). Our data is similar to the previous reports in Costa Rica, Netherlands and Turkey where the prevalence of JHP0945 was almost similar proportions between H. pylori isolates obtained from gastritis and peptic ulcer (Occhialini ; de Jonge ; Salih ) but different from a study (Sugimoto ) which demonstrated that the prevalence of JHP0945 was found to be higher in isolates with peptic ulcer. We observed that JHP0931 gene was not associated with clinical disease in the present work which was in consistent with a study in Costa Rica (Occhialini ). However, Salih found that JHP912 and JHP931 genes was significant association in cases with peptic ulcer in Turkey. The H. pylori oipA which have great antigenic characteristics and increase the serum level of IL-8 besides the clinically important demonstration of peptic ulcer, is an important virulence factor (Yamaoka ; Zambon ; Kudo et al., 2004). We showed no significant correlation between the oipA gene and peptic ulcer, in contrast with a previous study (Salih ) performed in Turkey. In a study carried out in Turkey, the authors detected that the most predominantly genotype among type II isolates was s1/m2, but except for one patient with gastritis and gastric ulcer possessed s1/m2 genotype, all type I isolates had s1/m1 genotype (Nagiyev ). This study showed that none of H. pylori isolates had vacAm1b genotype. Our study is concurrence with previous studies (Blaser ; Salih ) which reported that s1a/m1a was the most prevalent genotype among isolates with peptic ulcer. In contrast, s1c/m1b and s1a/m1b strains were the predominant genotypes in East Asian countries (Yamazaki ). We found that the s1m2 strains were predominantly detected in isolates from gastritis. Our findings were similar to the previous reports in Turkey (Erzin ; Nagiyev ) where the vacAs1a strains showed to be significantly correlated with peptic ulcer. In conclusion, this study suggests that cagA, oipA, JHP912, JHP931 and vacA s1am1a were the most common genes in isolates with peptic ulcer, and vacAs1am1a was significantly correlated with peptic ulcer. When considering the worldwide distribution of H. pylori as a common pathogen, further larger scale researches are necessary to be conducted in strains obtained from different geographical regions in order to assess the possible role of cag PAI and other virulence genes in different clinical outcomes which is correlated with H. pylori infections.
  50 in total

1.  Correlation between Helicobacter pylori OipA protein expression and oipA gene switch status.

Authors:  Takahiko Kudo; Zhannat Z Nurgalieva; Margaret E Conner; Sue Crawford; Stefan Odenbreit; Rainer Haas; David Y Graham; Yoshio Yamaoka
Journal:  J Clin Microbiol       Date:  2004-05       Impact factor: 5.948

2.  The complete genome sequence of the gastric pathogen Helicobacter pylori.

Authors:  J F Tomb; O White; A R Kerlavage; R A Clayton; G G Sutton; R D Fleischmann; K A Ketchum; H P Klenk; S Gill; B A Dougherty; K Nelson; J Quackenbush; L Zhou; E F Kirkness; S Peterson; B Loftus; D Richardson; R Dodson; H G Khalak; A Glodek; K McKenney; L M Fitzegerald; N Lee; M D Adams; E K Hickey; D E Berg; J D Gocayne; T R Utterback; J D Peterson; J M Kelley; M D Cotton; J M Weidman; C Fujii; C Bowman; L Watthey; E Wallin; W S Hayes; M Borodovsky; P D Karp; H O Smith; C M Fraser; J C Venter
Journal:  Nature       Date:  1997-08-07       Impact factor: 49.962

3.  Prevalence and genotypes of Helicobacter pylori in gastric biopsy specimens from patients with gastroduodenal pathologies in the Cukurova Region of Turkey.

Authors:  Togrul Nagiyev; Erkan Yula; Bahri Abayli; Fatih Koksal
Journal:  J Clin Microbiol       Date:  2009-10-21       Impact factor: 5.948

4.  Role of Helicobacter pylori plasticity region genes in development of gastroduodenal diseases.

Authors:  Mitsushige Sugimoto; Masahide Watada; Sung Woo Jung; David Y Graham; Yoshio Yamaoka
Journal:  J Clin Microbiol       Date:  2011-11-23       Impact factor: 5.948

5.  Relationship between Helicobacter pylori iceA, cagA, and vacA status and clinical outcome: studies in four different countries.

Authors:  Y Yamaoka; T Kodama; O Gutierrez; J G Kim; K Kashima; D Y Graham
Journal:  J Clin Microbiol       Date:  1999-07       Impact factor: 5.948

6.  The Helicobacter pylori plasticity region locus jhp0947-jhp0949 is associated with duodenal ulcer disease and interleukin-12 production in monocyte cells.

Authors:  Ramon de Jonge; Ernst J Kuipers; Sabine C L Langeveld; Ruud J L F Loffeld; Jeroen Stoof; Arnoud H M van Vliet; Johannes G Kusters
Journal:  FEMS Immunol Med Microbiol       Date:  2004-06-01

7.  Genomic-sequence comparison of two unrelated isolates of the human gastric pathogen Helicobacter pylori.

Authors:  R A Alm; L S Ling; D T Moir; B L King; E D Brown; P C Doig; D R Smith; B Noonan; B C Guild; B L deJonge; G Carmel; P J Tummino; A Caruso; M Uria-Nickelsen; D M Mills; C Ives; R Gibson; D Merberg; S D Mills; Q Jiang; D E Taylor; G F Vovis; T J Trust
Journal:  Nature       Date:  1999-01-14       Impact factor: 49.962

8.  A novel sheathed surface organelle of the Helicobacter pylori cag type IV secretion system.

Authors:  Manfred Rohde; Jürgen Püls; Renate Buhrdorf; Wolfgang Fischer; Rainer Haas
Journal:  Mol Microbiol       Date:  2003-07       Impact factor: 3.501

9.  Infection with Helicobacter pylori strains possessing cagA is associated with an increased risk of developing adenocarcinoma of the stomach.

Authors:  M J Blaser; G I Perez-Perez; H Kleanthous; T L Cover; R M Peek; P H Chyou; G N Stemmermann; A Nomura
Journal:  Cancer Res       Date:  1995-05-15       Impact factor: 12.701

10.  Inter-species horizontal transfer resulting in core-genome and niche-adaptive variation within Helicobacter pylori.

Authors:  Nigel J Saunders; Prawit Boonmee; John F Peden; Stephen A Jarvis
Journal:  BMC Genomics       Date:  2005-01-27       Impact factor: 3.969

View more
  1 in total

1.  Molecular characterization and prevalence of antibiotic resistance in Helicobacter pylori isolates in Kuala Lumpur, Malaysia.

Authors:  Alfizah Hanafiah; Hasyanee Binmaeil; Raja Affendi Raja Ali; Isa Mohamed Rose; Bruno S Lopes
Journal:  Infect Drug Resist       Date:  2019-09-27       Impact factor: 4.003

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.