Gene detection and toxin production evaluation of hemolysin BL of Bacillus cereus isolated from milk and dairy products marketed in Brazil.

Bacillus cereusis an ubiquitous, spore-forming bacteria that can survive pasteurization and the majority of the heating processes used in the dairy industry. Besides, it is a pathogen responsible for different types of food poisoning. One type of foodborne disease caused by B.cereusis the diarrheal syndrome, which is caused by the ingestion of vegetative cells producing toxins in the small intestine. One virulence factor for the diarrheal syndrome is the toxin hemolysin BL (HBL), a three-component protein formed by the L1, L2 and B components. In order to evaluate the presence of diarrheal strains isolated from milk and dairy products, 63 B. cereus isolates were obtained from 260 samples of UHT milk, pasteurized milk and powdered milk, sold in commercial establishments and from different brands. The isolates were subjected to the Polymerase Chain Reaction (PCR) for the detection of the encoding genes for the L1, L2 and B components and the toxin production capacity were evaluated with an immunoassay. A total of 23 [36.5%] isolates were identified carrying simultaneously the three tested genes, from which, 20 [86.9%] showed toxigenic capacity. 26 [41.3%] isolates did not carry any of genes tested and the other 14 [22.2%] were positive for one or two of them. The results showed a high toxigenic capacity among the B. cereus isolates able to produce the HBL, indicating a potential risk for consumers.

Introduction

Bacillus cereus is a widely distributed bacteria that can be found in the soil and in the water. Different kinds of food and food products can be contaminated with the microorganism, including milk and dairy products, meat, rice, pasta, herbs and condiments (Kramer and Gilbert, 1989; Arnesen ). B. cereus is able to produce a wide range of potentially pathogenic substances including hemolysins, phospholipase C, metalloproteases, collagenases, beta-lactamases and enterotoxins. The complete virulence importance of these substances has not yet been completely elucidated (Martínez-Blanch ). Two different foodborne diseases are attributed to B. cereus: emetic syndrome and diarrheal syndrome. Both diseases have mild manifestation and, in most cases, are self-limited, although severe cases resulting in the death of the patient have been reported (Mahler ).

The diarrheal syndrome is caused by the ingestion of vegetative cells of B. cereus present in food, and once the microorganism reach the small intestine it starts the colonization and then the toxin production (Arnesen ). The production of the diarrheal toxins occurs, in its most, at the exponential growth phase of B. cereus (Kotiranta ). The mechanism of action of such toxins are not completely know, but it is believed that the diarrhea is caused by the formation of pores in the cellular membrane, what induces the loss of Na+ and Cl− ions and water, resulting in an electrolyte imbalance (Bhunia, 2008). The symptoms are abdominal pain, cramps and watery diarrhea that start in 8 to 16 hours after the ingestion of contaminated food lasting for 12 to 24 hours. The foods most associated to the diarrheal syndrome are milk and dairy products, vegetables and beef (Kotiranta ).

The toxins that are considered the main virulence factors of the diarrheal syndrome are the hemolysin BL (HBL), nonhemolytic enterotoxin (NHE) and cytotoxin K (CytK). In addition enterotoxin FM (EntFM), enterotoxin T (BceT) and hemolysin II (Hly II) were also described as potential diarrheal toxins, although there are no data showing that they can cause food poisoning (Kotiranta ; Hendriksen ). HBL is a three-component toxin consisting of two lytic proteins, L1 and L2, that are encoded by hblD and hblC genes respectively, and a binding component B encoded by hblA gene. The presence of all three components is necessary for the toxin activity (Lindback and Granum, 2006).

The distribution of HBL genes within the B. cereus species is quite diverse and strains show different capability of producing diarrheal toxins. Several factors can group such strains based on growth temperature, food matrix and nutritional availability to name a few (Carlin ).

The aim of this study was to evaluate the presence of the HBL encoding genes and the toxin production of B. cereus cultures isolated from milk and dairy products commercialized in the Brazil.

Materials and Methods

B. cereus isolation and identification

Two hundred and sixty samples of dairy products were analyzed (pasteurized milk, UHT milk and powdered milk). The samples were cultured in selective agar plates and then confirmed as B. cereus by biochemistry tests according to previously described methods (Silva ). Strain NVH 1230/88 (provided by Dr. Per Einar Granum) is known to contain the HBL genes and was used as positive control.

DNA isolation

A total of sixty three B. cereus isolates were cultured in nutrient agar and then extraction of genomic DNA were made according to the protocol adapted from Moreira . The concentration of the obtained DNA were determined using a spectrophotometer (Nanodrop 2000, Thermo Scientific, Wilmington-MA, USA) and dilutions were made, when necessary, to set the concentration at 100 μg/mL.

PCR amplification

A PCR mixture (25 μL) were prepared according to Aragon-Alegro and consisted of 100 ng of DNA template, 0.2 mM dNTP mix, 2.5 mM MgCl2, 500 nM of each primer, 0.75 U of Taq polymerase and Taq buffer (750 mM Tris-HCl [pH 8.8 at 25 °C], 200 mM (NH4)2SO4, and 0.1% Tween 20). All reagents were purchased from Fermentas (Burlington, Ontario, Canada). The primers and annealing temperatures used in this study, found in Table 1, were those from Guinebretière . Amplifications were carried out in a PCR Maxygene (Axygen, Union City-CA, USA) thermocycler with the following run: a starting cycle of 2 min at 94 °C, followed by 35 cycles of 1 min at 94 °C, 1 min at the annealing temperature, and 2 min at 72 °C, and a final extension of 5 min at 72 °C (Guinebretière ).

Table 1

Characteristics of primers used in this study.

Primer	Gene	Annealing temp (°C)	Product size (bp)	Sequence (5-3)
HA F	hblA	56	1.154	AAGCAATGGAATACAATGGG
HA R				AGAATCTAAATCATGCCACTGC
HC F	hblC	58	740	GATAC(T,C)AATGTGGCAACTGC
HC F				TTGAGACTGCTCG(T,C)TAGTTG
HD R	hblD	58	829	ACCGGTAACACTATTCATGC
HD F				GAGTCCATATGCTTAGATGC

Source: Guinebretière .

Toxin production analysis

HBL production was evaluated by the isolates carrying simultaneously hblACD genes using the BCET-RAPLA kit (Oxoid Ltd., Basingtoke, England) following the manufacturer’s instruction. Shortly, the isolates were cultured in brain heart infusion broth (Merck, Whitehouse Station-NJ, USA) at 37 °C for 24 h. Then 2 mL of each culture were centrifuged at 4 °C at 900 g for 20 min and applied to the test devices. A sample was considered positive when showed distinct agglutination pattern.

Results and Discussion

From the 63 isolates of B. cereus obtained (36 from pasteurized milk, 15 from powdered milk and 12 form UHT milk), for the HBL encoding genes, were found 23 [35.6%] isolates carrying simultaneously the hblACD genes, 37 [58.7%] isolates were positive for at least one of them and 26 [41.3%] isolates didn’t harbor any of the tested genes. Individually, hblA gene was detected in 26 [41.3%] isolates, 34 [54%] isolates were positive for hblC gene and the same result was observed for hblD gene (Figure 1).

Figure 1

1.5% agarose gel of duplex PCR amplification of hblC and hblD genes (M: 1500 bp marker; 1: amplified hblC fragment; 2: amplified hblD fragment).

Many studies have already been done to evaluate the prevalence of pathogenic genes of B. cereus, but very few of them are aimed in milk and/or dairy products. One of the most recent ones were developed by Rather in India addressing raw and pasteurized milk and the detection of HBL genes. In that study the percentages of detection for hblA, hblC and hblD were around 70% for the tested samples. Another study made in Thailand by Chitov using milk showed detection percentages of hblA, hblC and hblD genes around 60%. In Brazil, Aragon-Alegro analyzed different types of food, including dairy products, for the presence of hblA, hblC and hblD genes the genetic detection was lower than 40% for hblA and hblC and hblD was detected in 70.6% of the isolates tested. In all of the mentioned studies, including this present one, the gene with the higher detection rate was hblD, which could indicate that, in milk and dairy products, hblD is the most widely distributed HBL gene of B. cereus.

After the gene detection, the 23 isolates carrying the hblACD genes simultaneously (14 from pasteurized milk and 09 from powdered milk) were tested with the BCET-RAPLA kit (Oxoid) for the expression of HBL. From that total, 20 [86.9%] isolates were positive for the test, statistical analysis (Table 2) detected no difference between the PCR and the immunoassay positivity, showing a good correlation between the methods. Among the different dairy products 13 [92.9%] isolates from pasteurized milk were positive for the immunoassay and 08 [88.9%] of the powdered milk cultures were positive for the test. There was also no statistical difference between the positivity observed in the pasteurized milk and the powdered milk. None of the B. cereus cultures isolated form UHT milk showed the hblACD genes, this could show that there is a higher susceptibility of pathogenic B. cereus strains to UHT treatment. Though the immunoassay is able to detect a very small concentration of HBL (2 ng/mL) negative results could represent expression of the toxin at levels below the sensitivity of the kit (Svensson ) in the same way that eventual mutation on the pathogenic gene could interfere with the primer specificity (Granum, 2005; Didelot ; Oh ).

Table 2

Detection of hblACD complex and HBL expression.

Product	Presence of hblACD complex	Expression of HBL
Pasteurized milk	14/36a	13/36a
Powdered milk	9/15a	8/15a
UHT milk	0/12b	0/12b
Total	23/63	21/63

Several circumstances entails the presence of B. cereus in milk and dairy products. Since its natural habitat is the soil it is virtually impossible to eliminate the microorganism from the environment where the cows walk around in the dairy farms. However, hygiene procedures such as adequate equipment sanitization, sanitary milking, proper hygiene of the employees during the milking of the cows among other best practices showed to be very effective in the quality control of raw milk in the same way, the negligence of these steps reflects significantly in the increase of the microorganism (Te Giffel ; Magnusson ; Bartoszewicz ; Shaheen ).

Concerning the industry the same principles are equivalents since there is a considerable contamination rate of milk post pasteurization. The best practice procedures include a broad scope of critical points of control that goes to attention to the temperatures used in the pasteurization process until the right products used for the cleaning of the equipments, all of this steps work together to ensure the elimination of B. cereus (Reys ; Salustiano ).

In conclusion, the data described in this study shows a high expression of the diarrheal toxin HBL of Bacillus cereus isolated in pasteurized milk and powdered milk showing that the pathogenic strains of the microorganism are well adapted for toxins production on these products.