Literature DB >> 24639688

Analysis of MLH3 C2531T polymorphism in Iranian women with unexplained infertility.

Hossein Pashaiefar1, Mohammad Hasan Sheikhha2, Seyyed Mehdi Kalantar2, Tahereh Jahaninejad1, Mohammad Ali Zaimy1, Nasrin Ghasemi2.   

Abstract

BACKGROUND: Meiotic genes are very important candidates for genes contributing to female and male infertility. Mammalian MutL homologues have dual roles in DNA mismatch repair (MMR) after replication errors and meiotic reciprocal recombination. The MutL homologs, MLH1 and MLH3, are crucial for meiotic reciprocal recombination and human fertility. In this study the functional polymorphisms of MLH3 C2531T was investigated in Iranian women with unexplained infertility.
OBJECTIVE: Investigating the association between a common SNP (single nucleotide polymorphism) C2531T in the MLH3 gene and female infertility.
MATERIALS AND METHODS: In total, 105 women with unexplained infertility as case group and 100 women with at least one child and no history of infertility or abortion as controls were recruited for this association study. The MLH3 C2531T polymorphism was tested by tetra-amplification refractory mutation system-PCR (4P-ARMS-PCR) method.
RESULTS: The MLH3 2531C and T alleles frequencies were 43.33% and 56.67% among infertile patients, and 61.5% and 38.5% among normal controls, respectively. In the patient and control subjects the CC (Pro 844 Pro) genotype frequency of MLH3 C2531T was 4.76% and 25%, the CT (Pro 844 Leu) genotype was 77.15% and 73%, and the TT (Leu 844 Leu) genotype was 19% and 2%, respectively (p=0.0001).
CONCLUSION: The presence of the polymorphic allele T leads to an increased risk of 2.09 times (OR=2.09, 95% CI=1.38-3.16; p=0.0001) for developing infertility in relation to the control group. Therefore, our data suggest that the MLH3 C2531T polymorphism can be associated with the risk of unexplained infertility in Iranian women.

Entities:  

Keywords:  Female infertility; MLH3; Mismatch repair genes; Polymorphism

Year:  2013        PMID: 24639688      PMCID: PMC3941381     

Source DB:  PubMed          Journal:  Iran J Reprod Med        ISSN: 1680-6433


Introduction

Infertility is described as the inability of a sexually active couple, not using any birth control to get pregnant after one year of trying. It is estimated that about 15% of couples in the world suffer from infertility (1). The etiology of many cases of infertility remains poorly understood. It is obvious that infertility causes are heterogeneous because a number of factors contribute to reproductive success. About 30% of couples with reproductive problem are diagnosed with unexplained infertility (2). Current evidence suggests that genetic factors contribute to the etiology of female infertility in humans (3). Meiosis is the fundamental feature of sexually reproducing organisms. It is the cell division that produces haploid gametes from diploid cells. Its molecular regulation has been conserved throughout eukaryotic evolution. Meiotic genes are very important candidates for genes contributing to female infertility (4). The most important stage of meiosis is prophase I, in which homologous chromosomes pair and remains tethered until the first meiotic division, when they must segregate equally into daughter cells that then enter meiosis II. Mismatch repair (MMR) contributes to maintenance of genomic integrity and for correcting DNA mismatch after DNA replication in somatic cells while it participates in crossing over between homologous chromosomes in meiosis. A meiosis-specific mismatch protein, MSH4, heterodimerises with MSH5 appears at recombination sites at zygonema (5-7). At mid-pachynema, MSH4 interacts with MLH1 and MLH3 (8). The MLH1 and MLH3 proteins are associated with late recombination nodules that are known to correlate with crossover sites (8, 9). The understanding of the mechanisms of meiosis and fertility has mainly benefitted from knockout and transgenic mouse models that exclusively have reproduction failure. Both male and female Mlh1-/- and Mlh3-/- mice are infertile. Males of both genotypes arrest in the metaphase I. Mlh1-/- oocytes fail to complete the meiosis II after fertilization with normal sperms, whereas a few numbers of abnormal Mlh3-/- oocytes extrude both the first and second polar body (10-13). The human gene of MLH3 was first identified in 2000. The human MLH3 gene is located on the long arm of the chromosome 14 (14q24.3) with a coding length of 4.3 kb, and has 12 exons. Exon 1 of this gene is 3.3 kb, accounting for 75% of the coding region (14). A total of 22 variants have been identified in MLH3 gene. Overall 12 of the 22 variants were missense changes, including K231Q, F390I, P551S, V420I, R647C, Y720C, R797H, N826D, E828D, H823Y, P844L, and T942I (15). The majority of the missense variants occurred in a region of MLH3 that has no homology with other DNA mismatch repair genes. Four variants of R647C, E828D, P844L and T942I in MLH3 gene are predicted to affect function of protein by in silico analysis using the SIFT algorithm (16). MLH3 protein plays a central role in meiotic recombination and it is reasonable to hypothesize that mutations in the MLH3 gene may be associated with male and female infertility. Although there are no studies about mutations of the MLH3 gene in the female infertile cases, these mutations are likely to be causative for female infertility, because infertility phenotype is observed previously in female mice with an Mlh3 deficiency (11). The present study, evaluated, for the first time, the relationship of the C2531T polymorphism of the MLH3 gene with female infertility in a case-control study. To investigate this relationship, we studied the frequency of distribution of the common SNP C2531T in the MLH3 gene in 105 infertile patients and compared the results with 100 fertile controls in order to explore the possible association between gene variation and female infertility.

Materials and methods

Subjects A total of 105 Iranian women with unexplained infertility were enrolled in this study. Infertile patients of known cause, such as hormonal, structural, immunological, and coagulation abnormalities, were excluded. All of the patients were examined for detection of anatomic abnormalities of the genital tract. Thrombophilia screening was performed with the measurement of plasma levels of antithrombin and proteins C and S. Blood tests for hyperthyroidism, diabetes mellitus, and hyperprolactinemia were also performed. All patients and their partners have a normal karyotype. Blood samples were drawn at the clinic after appropriate informed consent was obtained. A total of 100 blood samples from Iranian women with at least one child and no history of infertility or miscarriage were used as controls. The study was approved by the Yazd Research and Clinical Centre for Infertility Ethical Committee, and informed consent was taken from each patient. This work was supported by Yazd Research and Clinical Center for Infertility. DNA extraction and genotyping of C2531T polymorphism Genomic DNA was isolated from peripheral blood samples using the standard salting-out procedure. MLH3 C2531T polymorphism was analyzed using the tetra-amplification refractory mutation system-PCR (4P-ARMS-PCR) method (12). The primers used in the 4P-ARMS-PCR of DNA fragments included one pair of outer primers and one pair of inner primers are showed in table I (13). The PCR reaction was carried out in a final volume of 25 μL, containing 1X buffer, 2.5 mM of MgCl2, 5 pmol of primers MLH3 F1 and MLH3 R1, 20 pmol of primers MLH3 F2 and MLH3 R2, 0.1 mM of each dNTP, 1U Taq Polymerase (Invitrogen), and 200 ng of DNA.
Table I

The primers used in the 4P-ARMS-PCR

Primers Sequence
MLH3 F1[5′ACCAATCTCAGTCTTCAAGTTGAACCTG3′]
MLH3 R1[5′ATCATCCCCATTGTTTGAGTTTCTCTTT3′]
MLH3 F2[5′GGATGAAGATTGTTTAGAACAACAGATTCC 3′]
MLH3 R2[5′GGGTCATAGGACTTTCTCTCAAACGAA 3′]
The touch-down amplification was performed with an initial melting step of 94oC for 5 min; followed by 20 cycles of 94oC for 30 s, annealing temperature starting at 65oC for 30 s (decreasing 0.5oC per cycle), and 72oC for 30s for extension. This step was followed by 10 cycles of 94oC for 30 s, 55oC for 30 s, 72oC for 30 s, and a final elongation step of 5 min at 72oC. The PCR product was visualized on 3.0% agarose gel containing ethidium bromide under UV light. The C allele generated a 178 bp band, and the T allele generated a 220 bp band, although they had a common 320 bp band amplified by outer primers (MLH3 F1 and MLH3 R1) (Figure 1).
Figure 1

The (4P-ARMS-PCR) analysis of MLH3 C2531T polymorphism.

Statistical analysis The allele and genotype frequency of the infertile patients and normal controls were calculated by counting. The chi-square test was used to compare allele and genotype frequencies between patient and normal groups and to estimate the Hardy-Weinberg equilibrium. Statistical tests of significance and χ2 analysis were performed using SPSS statistic software version16.0.The differences in allelic and genotypic frequencies of C2531T locus in the MLH3 gene between case and control groups were evaluated by χ2 test with odds ratio (OR).

Results

The genotype and allele frequencies of MLH3 C2531T polymorphism are showed in Table II. The MLH3 2531C and T alleles frequencies were 43.33% and 56.67% among infertile patients, and 61.5% and 38.5% among normal controls. Tests for Hardy-Weinberg equilibrium for the studied SNP was performed, and the null hypothesis of Hardy-Weinberg equilibrium was not rejected (p=0.0001). The genotype frequency of MLH3 C2531T polymorphisms in our study subjects were significantly different between the patients with unexplained infertility and normal controls (p=0.0001). In specific, in the patient and control subjects the CC (Pro 844 Pro) genotype frequency of MLH3 C2531T was 4.76% and25%, the CT (Pro 844 Leu) genotype was 77.15% and 73% and the TT (Leu 844 Leu) genotype was 19% and 2%, respectively. In the present study, there was a statistically significant difference between the groups of infertile women compared to the control group (p=0.0001) with regard to the MLH3 C2531T polymorphism, suggesting that this polymorphism might be related to women infertility. The presence of the polymorphic allele T leads to an increased risk of 2.09 times (OR=2.09, 95% CI=1.38-3.16) to develop infertility in relation to the control group.
Table II

Genotype and allele frequencies of the MLH3 C2531T (Pro844Leu) polymorphism in female with unexplained infertility and fertile controls

Genotypes and alleles Infertile patients (n=105) n (%) Controls (n=100) n (%) OR (95% CI)
CC5 (4.76)25 (25)
CT81 (77.15)73 (73)
TT19 (18.1)2 (2)
C91 (43.33)123 (61.5)
T119 (56.67)77 (38.5)2.09 (1.38-3.16)
The primers used in the 4P-ARMS-PCR Genotype and allele frequencies of the MLH3 C2531T (Pro844Leu) polymorphism in female with unexplained infertility and fertile controls The (4P-ARMS-PCR) analysis of MLH3 C2531T polymorphism.

Discussion

Our results regarding analyzes of 105 patients and 100 controls, showed that the MLH3 C2531T polymorphism was associated with increased risk for the female infertility. In other studies it was shown that both male and female of Mlh1-/- and Mlh3-/- mice are sterile. Males of both genotypes arrest in the metaphase of meiosis I. While Mlh1-/- oocytes fail to complete the meiosis II, whereas a small proportion of abnormal Mlh3-/- oocytes extrude both the first and second polar body (10, 11). Interestingly, men with missense mutation (C2531T) in MLH3 gene have an increased risk of infertility (13). Altogether, these data underline the importance of MLH3 for human fertility. Recent researches demonstrated that screenings of MLH3 in testicular tissue from 13 patients with spermatogenic arrest revealed 4 missense and 8 intronic MLH3 variants, including 2896T/C and 2531C/T. 2896T/C was found in 1 out of the 13 patients, 2531C/T was found in 3 out of 13 cases (17). Therefore, the MLH3 protein has a crucial role in human fertility. In the present study, we found an association between the SNP C2531T (P844L) in the MLH3 gene and female unexplained infertility in blood samples, suggesting that this mutation may be an important genetic risk factor for female infertility in Iran. The MMR (Mismatch repair) system plays a crucial role in all organisms because it maintains the genome integrity during repeated duplication. MMR system is composed of several highly-conserved proteins whose functions in repair of mismatched DNA after replication have been demonstrated. Multiple functions, in addition to mismatch repair during replication, have been identified for MMR proteins, such as promotion of meiotic crossover between homologous chromosomes (18-20). Meiotic homologous recombination begins when the double-strand breaks (DSBs) are formed in DNA by Spo11 protein. Holliday junction (formed during homologous recombination) resolvase is activated by MSH4-MSH5 and MLH1-MLH3 in the same pathway (21). Mammalian meiosis is different from meiosis in lower eukaryotes. The mechanism of participation of MMR proteins in mammalian meiotic recombination is unknown. Our findings in the present study are biologically plausible, based on the previously reported function of MMR components. Cytological studies in mice have shown that MLH3 is associated with recombination nodules at early pachytene. This study demonstrated that there was an association between a functional polymorphism and female infertility. This finding can be an indication of this fact that the MLH1MLH3 pathway plays an important role in making crossovers during mammalian meiosis and female fertility. Therefore, the MLH3 gene polymorphism may be a genetic risk factor for unexplained infertility in women. The further functional study will continue to provide new evidence of the role of the MLH3 in pathogenesis of female infertility and will help to further elucidate the mechanisms of meiotic recombination in mammal.
  21 in total

Review 1.  The multifaceted mismatch-repair system.

Authors:  Josef Jiricny
Journal:  Nat Rev Mol Cell Biol       Date:  2006-05       Impact factor: 94.444

Review 2.  DNA mismatch repair: functions and mechanisms.

Authors:  Ravi R Iyer; Anna Pluciennik; Vickers Burdett; Paul L Modrich
Journal:  Chem Rev       Date:  2006-02       Impact factor: 60.622

3.  An efficient procedure for genotyping single nucleotide polymorphisms.

Authors:  S Ye; S Dhillon; X Ke; A R Collins; I N Day
Journal:  Nucleic Acids Res       Date:  2001-09-01       Impact factor: 16.971

4.  Meiotic pachytene arrest in MLH1-deficient mice.

Authors:  W Edelmann; P E Cohen; M Kane; K Lau; B Morrow; S Bennett; A Umar; T Kunkel; G Cattoretti; R Chaganti; J W Pollard; R D Kolodner; R Kucherlapati
Journal:  Cell       Date:  1996-06-28       Impact factor: 41.582

5.  Diagnosis and treatment of unexplained infertility.

Authors:  Alexander Quaas; Anuja Dokras
Journal:  Rev Obstet Gynecol       Date:  2008

6.  Meiotic arrest and aneuploidy in MLH3-deficient mice.

Authors:  Steven M Lipkin; Peter B Moens; Victoria Wang; Michelle Lenzi; Dakshine Shanmugarajah; Abigail Gilgeous; James Thomas; Jun Cheng; Jeffrey W Touchman; Eric D Green; Pam Schwartzberg; Francis S Collins; Paula E Cohen
Journal:  Nat Genet       Date:  2002-07-01       Impact factor: 38.330

7.  MLH1p and MLH3p localize to precociously induced chiasmata of okadaic-acid-treated mouse spermatocytes.

Authors:  Edyta Marcon; Peter Moens
Journal:  Genetics       Date:  2003-12       Impact factor: 4.562

8.  The role of MSH5 C85T and MLH3 C2531T polymorphisms in the risk of male infertility with azoospermia or severe oligozoospermia.

Authors:  Keqian Xu; Tingting Lu; Hui Zhou; Lihong Bai; Yaoyun Xiang
Journal:  Clin Chim Acta       Date:  2009-10-03       Impact factor: 3.786

9.  Mammalian MutS homologue 5 is required for chromosome pairing in meiosis.

Authors:  W Edelmann; P E Cohen; B Kneitz; N Winand; M Lia; J Heyer; R Kolodner; J W Pollard; R Kucherlapati
Journal:  Nat Genet       Date:  1999-01       Impact factor: 38.330

10.  The time course and chromosomal localization of recombination-related proteins at meiosis in the mouse are compatible with models that can resolve the early DNA-DNA interactions without reciprocal recombination.

Authors:  Peter B Moens; Nadine K Kolas; Madalena Tarsounas; Edyta Marcon; Paula E Cohen; Barbara Spyropoulos
Journal:  J Cell Sci       Date:  2002-04-15       Impact factor: 5.285

View more
  7 in total

1.  Single-nucleotide polymorphism rs 175080 in the MLH3 gene and its relation to male infertility.

Authors:  Ourania Markandona; Konstantinos Dafopoulos; George Anifandis; Christina I Messini; Marina Dimitraki; Aspasia Tsezou; Panagiotis Georgoulias; Ioannis E Messinis
Journal:  J Assist Reprod Genet       Date:  2015-10-31       Impact factor: 3.412

Review 2.  Impact of DNA mismatch repair system alterations on human fertility and related treatments.

Authors:  Min-hao Hu; Shu-yuan Liu; Ning Wang; Yan Wu; Fan Jin
Journal:  J Zhejiang Univ Sci B       Date:  2016-01       Impact factor: 3.066

3.  Frequency of TNFR1 36 A/G gene polymorphism in azoospermic infertile men: A case-control study.

Authors:  Hamid Reza Ashrafzadeh; Tahere Nazari; Masoud Dehghan Tezerjani; Maryam Khademi Bami; Saeed Ghasemi-Esmailabad; Nasrin Ghasemi
Journal:  Int J Reprod Biomed (Yazd)       Date:  2017-08

4.  mlh3 mutations in baker's yeast alter meiotic recombination outcomes by increasing noncrossover events genome-wide.

Authors:  Najla Al-Sweel; Vandana Raghavan; Abhishek Dutta; V P Ajith; Luigi Di Vietro; Nabila Khondakar; Carol M Manhart; Jennifer A Surtees; K T Nishant; Eric Alani
Journal:  PLoS Genet       Date:  2017-08-21       Impact factor: 5.917

5.  Embryological Results of Couples Undergoing ICSI-ET Treatments with Males Carrying the Single Nucleotide Polymorphism rs175080 of the MLH3 Gene.

Authors:  George Anifandis; Ourania Markandona; Konstantinos Dafopoulos; Christina Messini; Aspasia Tsezou; Marina Dimitraki; Panagiotis Georgoulias; Alexandros Daponte; Ioannis Messinis
Journal:  Int J Mol Sci       Date:  2017-02-02       Impact factor: 5.923

6.  Tumor Necrosis Factor Alpha -308 G/A Single Nucleotide Polymorphism and Risk of Sperm Abnormalities in Iranian Males.

Authors:  Maryam Khademi Bami; Masoud Dehghan Tezerjani; Fateme Montazeri; Hamid Reza Ashrafzadeh Mehrjardi; Saeed Ghasemi-Esmailabad; Mohammad Hasan Sheikhha; Seyed Mehdi Kalantar
Journal:  Int J Fertil Steril       Date:  2017-02-16

Review 7.  Meiosis interrupted: the genetics of female infertility via meiotic failure.

Authors:  Leelabati Biswas; Katarzyna Tyc; Warif El Yakoubi; Katie Morgan; Jinchuan Xing; Karen Schindler
Journal:  Reproduction       Date:  2021-02       Impact factor: 3.906

  7 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.