Literature DB >> 24599282

Dual mode of embryonic development is highlighted by expression and function of Nasonia pair-rule genes.

Miriam I Rosenberg1, Ava E Brent, Francois Payre, Claude Desplan.   

Abstract

Embryonic anterior-posterior patterning is well understood in Drosophila, which uses 'long germ' embryogenesis, in which all segments are patterned before cellularization. In contrast, most insects use 'short germ' embryogenesis, wherein only head and thorax are patterned in a syncytial environment while the remainder of the embryo is generated after cellularization. We use the wasp Nasonia (Nv) to address how the transition from short to long germ embryogenesis occurred. Maternal and gap gene expression in Nasonia suggest long germ embryogenesis. However, the Nasonia pair-rule genes even-skipped, odd-skipped, runt and hairy are all expressed as early blastoderm pair-rule stripes and late-forming posterior stripes. Knockdown of Nv eve, odd or h causes loss of alternate segments at the anterior and complete loss of abdominal segments. We propose that Nasonia uses a mixed mode of segmentation wherein pair-rule genes pattern the embryo in a manner resembling Drosophila at the anterior and ancestral Tribolium at the posterior. DOI: http://dx.doi.org/10.7554/eLife.01440.001.

Entities:  

Keywords:  Nasonia vitripennis; Tribolium; embryonic patterning; evolution; pair-rule genes; segmentation

Mesh:

Substances:

Year:  2014        PMID: 24599282      PMCID: PMC3941026          DOI: 10.7554/eLife.01440

Source DB:  PubMed          Journal:  Elife        ISSN: 2050-084X            Impact factor:   8.140


Introduction

Control of axial patterning and embryonic development is well understood in Drosophila (reviewed in Liu and Kaufman, 2005b; Peel et al., 2005; Rosenberg et al., 2009; Pankratz and Jaj, 1993). Extensive work has elucidated the genetic basis of establishment of the anterior–posterior (A–P) and dorsal–ventral (D–V) axes of the fly embryo. For the A–P axis, maternally loaded mRNAs generate localized signaling centers at each pole of the egg to establish morphogenetic gradients. These gradients instruct, in a concentration dependent manner, broad domains of expression of early zygotic genes, the ‘gap genes’ (Chen et al., 2012). This is made possible in part by the syncytial environment of the early blastoderm embryo where nuclei are not bounded by membranes, allowing diffusion of morphogen transcription factors through a shared cytoplasm without the need for cell–cell signaling. In this environment, broad activation by maternal factors coupled with repressive activities by the gap genes leads to the expression of the pair-rule genes in two-segment periodicity, as pair-rule stripes. The overlapping registers of different pair-rule genes ultimately establish segment polarity through activation of the segment polarity genes, each expressed in stripes with single segmental register. This mode of development is termed ‘long germ’ embryogenesis because the embryo occupies all of the blastoderm apart from a dorsal region representing the extraembryonic ammnioserosa. A striking feature of long germ embryogenesis is that virtually all of segment patterning is completed synchronously in the syncytial environment. However, forays into other insect models have revealed that the Drosophila paradigm is an evolutionarily derived state, and that insects generally undergo a very different type of embryogenesis and segmentation (reviewed in Liu and Kaufman, 2005b; Peel et al., 2005; Rosenberg et al., 2009). Unlike flies, most insect embryonic primordia occupy only a small portion of the blastoderm and only few anterior segments (head and thorax) are patterned in a syncytial environment. The remainder of the embryo is generated after cellularization via a ‘growth zone’, at the posterior region of the embryo. This mode is termed ‘short germ’ embryogenesis. Recently, the mechanisms governing posterior segment patterning and growth in the Tribolium embryo were characterized in elegant detail (Choe et al., 2006; Choe and Brown, 2009; El-Sherif et al., 2012; Sarrazin et al., 2012): Oscillations of the pair-rule gene Tc’odd-skipped (Tc’odd) in the growth zone are in turn linked to a circuit of two other pair-rule genes, Tc’runt and Tc’even-skipped (Tc’eve), such that each new pair of segments experiences a pulse of Tc’odd and requires both Tc’eve and Tc’runt expression in order to progress; the driver of these oscillations is still unknown. The waves of expression of Tc’odd-skipped pass through the growth zone rhythmically, generating segments and new stripes of stable expression with each periodic pulse (Sarrazin et al., 2012). RNAi of Tc’odd, Tc’runt, or Tc’eve results in asegmental embryos, underscoring their requirement in both growth zone-derived segments and earlier blastoderm anterior segments (Choe et al., 2006). In contrast, the pair-rule genes Tc’sloppy paired (Tc’slp) and Tc’paired (Tc’prd) appear in two-segment periodicity in head stripes and in stripes that emerge from the growth zone, and RNAi of those genes produce classical pair-rule phenotypes, in which alternating segments are lost (Choe and Brown, 2007). Live imaging revealed that formation of posterior segments results primarily from convergent extension and short-range cell movements and not strictly from cell division within the ‘growth zone’. This mechanism appears similar to both segmentation of vertebrate presomitic mesoderm (reviewed in [Dubrulle and Pourquie, 2004] and [Pourquie, 2011]) and to segment formation in more basal arthropods, including the centipede Strigamia maritima (Chipman et al., 2004; Chipman and Akam, 2008) and the spider Cupiennius salei (Stollewerk et al., 2003), suggesting it as an ancient mechanism inherited from the last common ancestor of all segmented animals (though this interpretation is still debated; reviewed in [Davis and Patel, 1999]). As Drosophila is only one example of a derived long germ strategy, one outstanding question is how transitions from short germ to long germ embryogenesis occurred, such that the same set of segmentation genes possesses different functions. The careful study of additional long germ insects should shed light on what aspects of Drosophila development are essential facets of long germ embryogenesis and which aspects are more evolutionarily labile. Other model species have been studied, including long germ beetles (e.g., Callosobruchus order: Coleoptera; (Patel et al., 1994)), and several members of the order Hymenoptera, including the honeybee, Apis mellifera (Dearden et al., 2006; Wilson et al., 2010; Wilson and Dearden, 2011, 2012) and the jewel wasp, Nasonia vitripennis (Nv) (Pultz et al., 1999; Werren et al., 2010). However, systematic characterization of their pair-rule genes and segmentation mechanisms is still incomplete. We use the wasp Nasonia vitripennis as a model for the study of A–P patterning, as a species that appears to have evolved, independently of Drosophila, a similar mode of long germ embryogenesis. We have previously characterized the early patterns of Nasonia segmentation genes and found that maternal and gap gene expression confirms a long germ mode of embryogenesis. This conclusion was based on the existence of two polar signaling centers, each utilizing localized maternal Nv orthodenticle (otd) mRNA that encodes a morphogen. Nv otd acts in combination with Nv hunchback (hb) and localized maternal Nv giant (gt) at the anterior, and with localized maternal Nv caudal (cad) at the posterior, to specify positional identity. The domains of zygotic expression of Nv hb, Nv gt, Nv cad, Nv Krüppel (Kr), Nv tailless (tll), and Nv knirps (kni) closely resemble their Drosophila counterparts, consistent with a similar mode of blastoderm allocation (Pultz et al., 2005; Lynch et al., 2006; Olesnicky et al., 2006; Brent et al., 2007). Although these data support Drosophila-like early regulatory interactions and a long germ mode of embryogenesis, little was known about later stages of Nasonia embryonic patterning. We analyzed the expression and function of the pair-rule genes Nv eve, Nv odd, Nv runt and Nv h during embryogenesis. We found that each gene is expressed in both a canonical long-germ pair-rule stripe pattern at the anterior, as well as late-forming posterior stripes, indicating a dual mode of regulation. Strikingly, Nv eve is ultimately expressed in a total of 16 segmental stripes, of which six are derived from a single posterior stripe in the cellularized blastoderm. We also observe waves of Nv odd expression that resemble the waves of Tribolium odd expression, suggesting the residual activity of a segmentation clock in Nasonia. As in Tribolium, we found that mitoses do not occur exclusively at the site of late forming segments, but mitotic figures are not randomly distributed throughout the embryo. Instead, coordinated mitoses resembling the later mitotic domains of Drosophila (Foe, 1989) appear and progress in waves from anterior to posterior, and are largely excluded from stripes of eve expression, suggesting a coordination of mitoses by segmentation genes. Using morpholinos to knock down gene function, we found that Nv eve, Nv odd and Nv h phenotypes do not affect alternating segments at the posterior, unlike what is observed in Drosophila. Instead, these ‘pair-rule’ genes are required for the formation of a continuous posterior region comprising abdominal segments A5–A10. Phenotypes in the anterior of the embryo are gene-specific; each gene exhibits a partial pair-rule phenotype in the allelic series. We suggest that Nasonia uses ‘pair-rule’ genes to pattern the embryo in a manner that resembles both Drosophila and Tribolium. We present a model for how this mixed mode of segmentation is achieved.

Results

Nasonia even-skipped exhibits character of both long and short germ patterning

The expression of eve has been studied in many insects, owing to a widely cross-reacting antibody. Its promoter has also been well studied in Drosophila and has become a classic example of modular gene control (Patel et al., 1992; Small et al., 1992, 1996). We used circular RACE from total embryo RNA (McGrath, 2011) to generate a fragment of approximately 1 kb corresponding to the coding region of Nv eve, including the highly conserved homeodomain (Genbank Accession# KC168090). Several minor transcript variants were captured and sequenced, but not studied further (see ‘Materials and methods’ for GenBank accession numbers). The homeodomain of Nv Eve shares 81.7% amino acid identity with its Drosophila counterpart. We used in situ hybridization to look at the expression pattern of Nv eve during Nasonia embryogenesis (Figure 1). Nv eve expression becomes detectable as a broad early domain in the blastoderm embryo at around 3 hr after egg laying (AEL) (Figure 1A). This domain broadens and its boundaries sharpen between 3 and 4 hr, by which time a faint posterior stripe (hereafter referred to as ‘stripe 6’, see below) becomes evident (Figure 1B,C). As embryogenesis progresses toward cellularization, the anterior domain splits into three distinct double-segment periodicity pair-rule stripes, stripes 1, 2 and 3 (Figure 1D–F). By cellularization, around 6 hr, a faint 4/5 stripe appears between the anterior stripes and stripe 6, which has become more intense (Figure 1F). Between 6 and 8 hr AEL, stripe 4/5 splits into distinct double-segment periodicity stripes 4 and 5, whereas stripes 1 and 2 split into single-segment periodicity segmental stripes (Figure 1G–I). In Drosophila, eve secondary stripes form de novo, between primary pair-rule stripes, in contrast to secondary paired stripes that later split from primary stripes, forming segmental stripes that affect all segments (Macdonald et al., 1986; Kilchherr et al., 1986). Splitting of Nasonia eve double-segment stripes into single-segment stripes may occur by a similar mechanism (see below). As gastrulation progresses between 8 and 10 hr AEL, double-segment pair-rule stripes 3–5 also split to give rise to two distinct single-segment stripes each (Figure 1J–L). This anterior to posterior progression of Nv eve stripes is consistent with the sequential appearance of the segment polarity genes Nv wg (Figure 1—figure supplement 1) and Nv en (Pultz et al., 1999), which are first detected around cellularization in a few anterior segments and then appear in stripes progressively, in an anterior to posterior manner.
Figure 1.

Summary of Nasonia eve mRNA expression.

Embryos are shown with anterior left and dorsal up. Nv eve is initially expressed in a broad domain (A and B), which sharpens as a posterior stripe becomes visible at around 4 hr after embryo laying (AEL) (C and D). The broad domain retracts anteriorly and gives rise to three apparently double-segment stripes (E and F). Between stripes 3 and posterior stripe 6, an additional double stripe precursor comes up at around 6 hr AEL (stripe 4/5; panels F and G) and this splits to form two double-segment stripes, ‘4’ and ‘5’ as double-segment stripes 1–3 split into two single-segment stripes each between 6 and 8 hr AEL (F–J). Stripes 4 and 5 also split to form single-segment stripes during early gastrulation, and stripe 6 broadens (K and L), giving rise to stripes that are visibly distinct during germ band extension in non-fluorescent staining by 10–12 hr AEL (M–R, arrowheads). There are a total of 16 single-segment stripes of Nv eve.

DOI: http://dx.doi.org/10.7554/eLife.01440.003

All embryos are shown with anterior to the left and dorsal up except as indicated. (A) Precellular blasoderm with no expression of Nv wg. (B) Cellular blastoderm embryo exhibiting head expression and one stripe of Nv wg. (C) Early gastrula embryo exhibiting Nv wg staining in three segmental stripes comprising thoracic segments. (D) Ventral view of early gastrula embryo with four segmental stripes, including one abdominal segment. (E) Germ band extension embryo with six segmental stripes of Nv wg expression. (F) Germ band extension embryo exhibiting eight segmental stripes, including three thoracic and five abdominal stripes, as well as additional head segmental stripes. (G) Ventral view of a fully extended germ band with the full complement of 16 segmental Nv wg stripes. (H) Lateral view of germ band retracting embryo with 16 segmental stripes, including three clear segmental stripes in the head. (I) Lateral view of dorsal closure embryo exhibiting fading segmental Nv wg staining in all segments.

DOI: http://dx.doi.org/10.7554/eLife.01440.004

Figure 1—figure supplement 1.

Nv wingless (Nv wg) mRNA expression in the embryo.

All embryos are shown with anterior to the left and dorsal up except as indicated. (A) Precellular blasoderm with no expression of Nv wg. (B) Cellular blastoderm embryo exhibiting head expression and one stripe of Nv wg. (C) Early gastrula embryo exhibiting Nv wg staining in three segmental stripes comprising thoracic segments. (D) Ventral view of early gastrula embryo with four segmental stripes, including one abdominal segment. (E) Germ band extension embryo with six segmental stripes of Nv wg expression. (F) Germ band extension embryo exhibiting eight segmental stripes, including three thoracic and five abdominal stripes, as well as additional head segmental stripes. (G) Ventral view of a fully extended germ band with the full complement of 16 segmental Nv wg stripes. (H) Lateral view of germ band retracting embryo with 16 segmental stripes, including three clear segmental stripes in the head. (I) Lateral view of dorsal closure embryo exhibiting fading segmental Nv wg staining in all segments.

DOI: http://dx.doi.org/10.7554/eLife.01440.004

Summary of Nasonia eve mRNA expression.

Embryos are shown with anterior left and dorsal up. Nv eve is initially expressed in a broad domain (A and B), which sharpens as a posterior stripe becomes visible at around 4 hr after embryo laying (AEL) (C and D). The broad domain retracts anteriorly and gives rise to three apparently double-segment stripes (E and F). Between stripes 3 and posterior stripe 6, an additional double stripe precursor comes up at around 6 hr AEL (stripe 4/5; panels F and G) and this splits to form two double-segment stripes, ‘4’ and ‘5’ as double-segment stripes 1–3 split into two single-segment stripes each between 6 and 8 hr AEL (F–J). Stripes 4 and 5 also split to form single-segment stripes during early gastrulation, and stripe 6 broadens (K and L), giving rise to stripes that are visibly distinct during germ band extension in non-fluorescent staining by 10–12 hr AEL (M–R, arrowheads). There are a total of 16 single-segment stripes of Nv eve. DOI: http://dx.doi.org/10.7554/eLife.01440.003

Nv wingless (Nv wg) mRNA expression in the embryo.

All embryos are shown with anterior to the left and dorsal up except as indicated. (A) Precellular blasoderm with no expression of Nv wg. (B) Cellular blastoderm embryo exhibiting head expression and one stripe of Nv wg. (C) Early gastrula embryo exhibiting Nv wg staining in three segmental stripes comprising thoracic segments. (D) Ventral view of early gastrula embryo with four segmental stripes, including one abdominal segment. (E) Germ band extension embryo with six segmental stripes of Nv wg expression. (F) Germ band extension embryo exhibiting eight segmental stripes, including three thoracic and five abdominal stripes, as well as additional head segmental stripes. (G) Ventral view of a fully extended germ band with the full complement of 16 segmental Nv wg stripes. (H) Lateral view of germ band retracting embryo with 16 segmental stripes, including three clear segmental stripes in the head. (I) Lateral view of dorsal closure embryo exhibiting fading segmental Nv wg staining in all segments. DOI: http://dx.doi.org/10.7554/eLife.01440.004 A remarkable feature of Nv eve expression is that the posterior stripe 6 broadens significantly at about 10 hr AEL (Figure 1L–N), before generating six additional stripes with single-segment periodicity, allowing the embryo to reach 16 individual segmental stripes by the time the germ band is fully extended. This division of stripe 6 initiates with an anterior band that will give rise to four stripes (segmental stripes 11–14; Figure 1P,Q, arrowheads; see below), and two later-appearing segmental stripes 15 and 16 (Figure 1Q, arrowheads). The last stripe, Nv eve 16, appears only at full germ band extension (Figure 1R) completing the 16 stripes observed at this stage. The Nasonia embryo has 16 segments, whereas Drosophila has only 14 (Figure 2A). In Drosophila, eve and other pair-rule genes are expressed with double-segment periodicity: seven transverse ‘pair-rule’ stripes are evident as a full complement in the blastoderm embryo at cellularization. If the Nasonia embryo were patterned using the same mechanisms as Drosophila, then eight pair-rule stripes would be predicted. However, only five truly pair-rule (double segment) stripes are apparent at cellularization, while stripe 6 gives rise later to four, then six single-segment stripes and six segments and is therefore not pair-rule (Figure 2E). This delayed sequential posterior segmentation is therefore more reminiscent of the segmentation described in short germ insects.
Figure 2.

Nv eve epistasis with maternal and gap genes.

(A) Schematic representation of the germ-band-extended embryo, showing 16 single-segment stripes of Nv eve expression, and their segment counterparts in the patterned larval cuticle. Colored boxes cover the segments of the larval cuticle that are lost or fused in each RNAi background. All embryos are shown anterior left, dorsal up (except where indicated). Nv eve mRNA expression is shown in each embryo (B–G). Wild-type (WT) embryos are shown as staged controls for RNAi embryos. (B) WT early blastoderm embryo. (C) WT cellular blastoderm embryo. (D) WT early gastrula extension embryo. (E) WT germ-band-retracted embryo. (F–H) gt RNAi embryos stained for Nv eve mRNA expression. (F) Cellular blastoderm embryo with reduced Nv gt exhibits loss of anterior Nv eve stripes (x). (G) Nv gt RNAi embryo in early germ-band-extension exhibits loss of anterior Nv eve stripes and improper splitting of Nv eve stripe 5, as well as aberrant dorsal anterior expression of Nv eve. (H) Nv gt RNAi embryo at dorsal closure exhibits a stripe of Nv eve at the anterior, as well as a reduced number of posterior segmental Nv eve stripes. (I–L) Nv hb mutant embryos stained for Nv eve mRNA expression. (I) Early blastoderm Nv hb mutant embryos have a reduced central Nv eve domain (bounded by black arrowheads), and an ectopic anterior Nv eve stripe (white arrowhead). (J) Nv hb mutant cellular blastoderm embryo with a single anterior domain of Nv eve that has failed to resolve, and a single stripe 4 which exhibits delayed splitting. (K) Nv Hb mutant germ-band extension embryo with fused anterior domain (line) and 6 segmental stripes, representing derivatives of Nv eve stripes 4 and 5 and two derivatives of stripe 6; additional stripe 6 derivatives are absent (x). (L) hb mutant dorsal closure embryo exhibiting fused anterior domain (line) and the same number of derivatives as in (M), with more posterior segments missing (x). (M–O) Nv cad RNAi embryos stained for Nv eve mRNA expression. (M) Nv cad RNAi early blastoderm with reduced central Nv eve domain that is also posteriorly shifted (anterior boundary indicated by black arrowhead). (N) Nv cad RNAi cellular blastoderm embryo with posteriorly shifted (arrowhead), reduced Nv eve central domain, whose splitting is delayed. (O) Nv cad RNAi early gastrula embryo with posterior shift in Nv eve expression (black arrowhead). Four double-segment periodicity stripes are split into single-segment stripes and stripe 5 remains intact. (P–S) Nv Kr RNAi embryos stained for Nv eve mRNA expression. (P) Nv Kr RNAi precellular blastoderm embryo with aberrant Nv eve central domain resolution, where stripes 2–3 appear posteriorly shifted. (Q) Dorsolateral view of a Nv Kr RNAi embryo where stripes 2 and 3 are less refined than WT and 3 is posteriorly shifted. No stripe 4/5 expression is detected (X). (R) Nv Kr RNAi early gastrula embryo with aberrant stripe 2 splitting and aberrant resolution of stripes 3–5. (S) Moderately affected Nv Kr RNAi germ-band retraction embryo with fused segments in the middle of the embryo (line). (T–V) Nv tll RNAi embryos stained for Nv eve mRNA expression. (T) Nv tll RNAi early blastoderm embryo with expanded Nv eve expression domains toward both poles (arrowheads). (U) Nv tll RNAi precellular blastoderm embryo showing delayed resolution of Nv eve stripes 1–3 and Nv eve stripe 6 shifted to the extreme posterior pole of the embryo (arrowhead). (V) Nv tll RNAi dorsal closure embryo showing abnormal posterior Nv eve stripe formation.

DOI: http://dx.doi.org/10.7554/eLife.01440.005

Lateral view of early Nasonia gastrula embryo double stained for Nv eve and Nv gt mRNA. (A) Nv eve mRNA. (B) Nv gt mRNA. (C) Merge of Nv eve and Nv gt channels. Note the position of the late posterior stripe of Nv gt relative to Nv eve stripe 6.

DOI: http://dx.doi.org/10.7554/eLife.01440.006

(A) Summary of maternal and gap gene loss of function phenotypes in Nasonia. On the vertical axis, genes affected by RNAi or genetic lesion are listed, and indicated as either maternal or zygotic phenotypes. Segments lost in each background are indicated as gray bars. Segments that remain in a given background are annotated alphanumerically.

DOI: http://dx.doi.org/10.7554/eLife.01440.007

Nv eve epistasis with maternal and gap genes.

(A) Schematic representation of the germ-band-extended embryo, showing 16 single-segment stripes of Nv eve expression, and their segment counterparts in the patterned larval cuticle. Colored boxes cover the segments of the larval cuticle that are lost or fused in each RNAi background. All embryos are shown anterior left, dorsal up (except where indicated). Nv eve mRNA expression is shown in each embryo (B–G). Wild-type (WT) embryos are shown as staged controls for RNAi embryos. (B) WT early blastoderm embryo. (C) WT cellular blastoderm embryo. (D) WT early gastrula extension embryo. (E) WT germ-band-retracted embryo. (F–H) gt RNAi embryos stained for Nv eve mRNA expression. (F) Cellular blastoderm embryo with reduced Nv gt exhibits loss of anterior Nv eve stripes (x). (G) Nv gt RNAi embryo in early germ-band-extension exhibits loss of anterior Nv eve stripes and improper splitting of Nv eve stripe 5, as well as aberrant dorsal anterior expression of Nv eve. (H) Nv gt RNAi embryo at dorsal closure exhibits a stripe of Nv eve at the anterior, as well as a reduced number of posterior segmental Nv eve stripes. (I–L) Nv hb mutant embryos stained for Nv eve mRNA expression. (I) Early blastoderm Nv hb mutant embryos have a reduced central Nv eve domain (bounded by black arrowheads), and an ectopic anterior Nv eve stripe (white arrowhead). (J) Nv hb mutant cellular blastoderm embryo with a single anterior domain of Nv eve that has failed to resolve, and a single stripe 4 which exhibits delayed splitting. (K) Nv Hb mutant germ-band extension embryo with fused anterior domain (line) and 6 segmental stripes, representing derivatives of Nv eve stripes 4 and 5 and two derivatives of stripe 6; additional stripe 6 derivatives are absent (x). (L) hb mutant dorsal closure embryo exhibiting fused anterior domain (line) and the same number of derivatives as in (M), with more posterior segments missing (x). (M–O) Nv cad RNAi embryos stained for Nv eve mRNA expression. (M) Nv cad RNAi early blastoderm with reduced central Nv eve domain that is also posteriorly shifted (anterior boundary indicated by black arrowhead). (N) Nv cad RNAi cellular blastoderm embryo with posteriorly shifted (arrowhead), reduced Nv eve central domain, whose splitting is delayed. (O) Nv cad RNAi early gastrula embryo with posterior shift in Nv eve expression (black arrowhead). Four double-segment periodicity stripes are split into single-segment stripes and stripe 5 remains intact. (P–S) Nv Kr RNAi embryos stained for Nv eve mRNA expression. (P) Nv Kr RNAi precellular blastoderm embryo with aberrant Nv eve central domain resolution, where stripes 2–3 appear posteriorly shifted. (Q) Dorsolateral view of a Nv Kr RNAi embryo where stripes 2 and 3 are less refined than WT and 3 is posteriorly shifted. No stripe 4/5 expression is detected (X). (R) Nv Kr RNAi early gastrula embryo with aberrant stripe 2 splitting and aberrant resolution of stripes 3–5. (S) Moderately affected Nv Kr RNAi germ-band retraction embryo with fused segments in the middle of the embryo (line). (T–V) Nv tll RNAi embryos stained for Nv eve mRNA expression. (T) Nv tll RNAi early blastoderm embryo with expanded Nv eve expression domains toward both poles (arrowheads). (U) Nv tll RNAi precellular blastoderm embryo showing delayed resolution of Nv eve stripes 1–3 and Nv eve stripe 6 shifted to the extreme posterior pole of the embryo (arrowhead). (V) Nv tll RNAi dorsal closure embryo showing abnormal posterior Nv eve stripe formation. DOI: http://dx.doi.org/10.7554/eLife.01440.005

Nv eve/Nv gt double FISH in the embryo.

Lateral view of early Nasonia gastrula embryo double stained for n class="Species">Nv eve and Nv gt mRNA. (A) Nv eve mRNA. (B) Nv gt mRNA. (C) Merge of Nv eve and Nv gt channels. Note the position of the late posterior stripe of Nv gt relative to Nv eve stripe 6. DOI: http://dx.doi.org/10.7554/eLife.01440.006 (A) Summary of maternal and gap gene loss of function phenotypes in Nasonia. On the vertical axis, genes affected by RNAi or genetic lesion are listed, and indicated as either maternal or zygotic phenotypes. Segments lost in each background are indicated as gray bars. Segments that remain in a given background are annotated alphanumerically. DOI: http://dx.doi.org/10.7554/eLife.01440.007

Control of Nv eve by gap genes

To explore this apparent combination of short and long germ characters, we determined how Nv eve expression is controlled by upstream genes in the known Nasonia A–P patterning network. Early embryonic expression of Drosophila eve is controlled by maternal and gap genes, including bicoid (bcd), hb, Kr, gt, kni and torso (MJaJ & H, 1993; Small et al., 1992, 1996; Schroeder et al., 2004; Small and Levine, 1991), whereas later maintenance is achieved via autoregulation (Jiang et al., 1991). Some Tribolium eve pair-rule stripes are also under the control of gap genes although some of the segments themselves are born much later than gap gene expression (Sulston and Anderson, 1996; Cerny et al., 2005). For example, in Tc’Kr mutant embryos, segments anterior to the normal Kr expression domain (T1–T3) appear wild type, but expression of both Tc’eve and Tc’en is lost in posterior segments and no segments are formed posterior to A4 (Cerny et al., 2005). Therefore, Tribolium gap genes can affect the specification of segments that are not yet formed, presumably because of interactions with the growth zone. In other short germ insects, like Oncopeltus fasciatus, eve acts as a gap gene, regulating expression of hunchback and Krüppel (Liu and Kaufman, 2005a). To determine how the known maternal and gap genes regulate Nv eve expression in the early embryo, we used parental RNAi injections in pupal Nasonia females to knockdown Nv gt, Nv Kr, Nv tll and Nv cad mRNA, as well as a null mutation in Nv hb (Pultz et al., 2000, 2005).

Nv gt

As we previously reported, Nv giant knockdown results in the loss of all segments anterior to A1 and fusion of segments A6 and A7 (Brent et al., 2007). Nv gt RNAi blastoderm embryos exhibit the loss of Nv eve double-segment stripes 1–3 (Figure 2F), as well as aberrant resolution of the first splitting events of stripe 6 (Figure 2G, arrowheads). Double in situ hybridization shows that, in the wild type, a late posterior stripe of Nv gt forms after Nv eve stripe 6 and appears to be within the Nv eve stripe 6 domain (Figure 2—figure supplement 1). These data suggest that a posterior Nv gt domain may partially affect stripe 6 splitting. Late Nv gt RNAi embryos exhibit strong anterior defects after dorsal closure, but the other posterior single-segment stripes of Nv eve appear unaffected (Figure 2H).
Figure 2—figure supplement 1.

Nv eve/Nv gt double FISH in the embryo.

Lateral view of early Nasonia gastrula embryo double stained for Nv eve and Nv gt mRNA. (A) Nv eve mRNA. (B) Nv gt mRNA. (C) Merge of Nv eve and Nv gt channels. Note the position of the late posterior stripe of Nv gt relative to Nv eve stripe 6.

DOI: http://dx.doi.org/10.7554/eLife.01440.006

Nv hb

In Nv hb mutant (headless) embryos, both head and thoracic fates and abdominal fates posterior to A6 are lost (Pultz et al., 2005). Consistent with this phenotype, Nv eve double-segment stripes 1–3 (that give rise to head and thoracic fates) form but never resolve (Figure 2K, black arrowheads). An ectopic stripe of eve can be seen in the anterior of some embryos (Figure 2I, white arrowhead), consistent with the ectopic stripe of Nv cad (an activator of eve) in the head of some Nv hb mutant embryos (Olesnicky et al., 2006). Gastrula and later germ band embryos exhibit normal Nv eve double-segment stripe formation and splitting of stripes 4 and 5, which give rise to segments A1–A4. However, only the two anteriormost segments are formed from Nv eve stripe 6 (6a and 6b) in Nv hb mutant embryos (Figure 2K,L).

Nv caudal

Nv caudal (cad) is expressed maternally as a mRNA gradient with a localized posterior source (Olesnicky et al., 2006). Nv cad RNAi results in loss of all segments posterior to A1. Moderately affected Nv cad RNAi embryos exhibit a reduced early broad domain of Nv eve that is slightly shifted posteriorly (Figure 2M). This domain resolves poorly, with only weak activation of anterior Nv eve stripes and no posterior abdominal expression of Nv eve (Figure 2N–O).

Nv Kr

As in Drosophila, Nv Krüppel (Kr) is expressed in a central domain, and Nv Kr is required for formation of segments T3 to A4 (Brent et al., 2007). In Nv Kr RNAi embryos, both anterior and posterior domains of Nv hb expression expand towards the center of the embryo (Brent et al., 2007). Consistent with expansion of Nv hb, we observed that Nv eve stripe 2 and 3 exhibit aberrant resolution and Nv eve stripes 4 and 5 fail to resolve in embryos with knocked-down Nv Kr (Figure 2P–S). Posterior segments are unaffected, as reflected by normal expression of Nv eve posterior to stripe 5 (segment A4; Figure 2R,S). This phenotype is dramatically different from Tc’Kr knockdown where all posterior segments are deleted, likely because Nv Kr is expressed anterior to the growth zone while Tc’Kr abuts it.

Nv tll

tailless mRNA is expressed in both an anterior and a posterior domain, though only posterior segments are affected by Nv tll RNAi (Lynch et al., 2006). The most severely affected embryos are missing the six posterior abdominal segments. These embryos also exhibit an apparent slight anterior shift of the broad early domain of Nv eve expression and of stripe 6 (Figure 2T,U). Stripe 6 does not appear to resolve, resulting in an enduring ring of Nv eve expression and no Nv eve single-segment stripes posterior to this ring are apparent (Figure 2V). Taken together, and consistent with previously described cuticular phenotypes for maternal and gap genes in Nasonia (Pultz et al., 2005; Lynch et al., 2006; Olesnicky et al., 2006; Brent et al., 2007; Figure 2—figure supplement 2), these data show that early Nv eve expression in blastoderm embryos involves regulatory interactions reminiscent of those underlying Drosophila long germ embryogenesis. However, since severe RNAi phenotypes of several genes, such as Nv cad and Nv tll results in total loss of posterior segments, these did not provide additional information for understanding the establishment of posterior Nv eve expression.
Figure 2—figure supplement 2.

(A) Summary of maternal and gap gene loss of function phenotypes in Nasonia. On the vertical axis, genes affected by RNAi or genetic lesion are listed, and indicated as either maternal or zygotic phenotypes. Segments lost in each background are indicated as gray bars. Segments that remain in a given background are annotated alphanumerically.

DOI: http://dx.doi.org/10.7554/eLife.01440.007

Nasonia embryos have mitotic domains but Nv eve posterior stripe resolution does not require localized cell division

To determine whether cell division plays a role in subdivision of the Nv eve posterior domain into single-segment stripes, we used in situ hybridization to visualize Nv eve mRNA in embryos where mitotic cells were labeled with antibodies against phosphorylated histone H3. We found that there is no cell division that is consistent with a role in pair-rule stripe splitting (Figure 3A–A″), or in stripe 6 resolution (Figure 3B–B″), suggesting that the dynamics of the Nv eve mRNA pattern mostly involves transcriptional regulation. Nevertheless, later mitoses occur in restricted spatial domains, reminiscent of later Drosophila mitotic domains within segments of the expanding germ band (Figure 3B–D″). A relationship between gap gene function and regulation of mitotic domains via regulation of string has been suggested in Drosophila (Edgar et al., 1994) but not demonstrated. Nasonia mitotic domains appear in an anterior to posterior progression, allowing for progressive expansion of segments along the A–P axis via concerted cell divisions within domains. Strikingly, mitotic figures appear to be largely excluded from Nv eve stripes in these early stages of embryogenesis (Figure 3B″,C″, Figure 3—figure supplement 1). Later embryos in which anterior Nv eve stripes are beginning to fade exhibit overlap of mitotic figures with weakened Nv eve stripe expression (Figure 3D″). Ultimately, embryos exhibit widespread mitotic figures that do not correspond to any apparent concerted domains or pattern, more like the pattern of mitoses described in several short germ insects (Handel et al., 2005; Liu and Kaufman, 2009).
Figure 3.

Nv eve expression and cell division appear to be coordinated.

Embryos co-stained for Nv eve mRNA using in situ hybridization and fluorescent detection, as well as for mitotic figures, using an antibody against phospho Histone H3. Embryos are shown with anterior left and dorsal up, except columns B and C, which are ventral views. (A–A″) An early gastrula embryo exhibiting 15 stripes of Nv eve, including five derivatives of stripe 6 (A), has no evident mitotic figures in the posterior domain of Nv eve stripe 6 differentiation (A′). (A″) Merge of panels A and A′. (B–D″) Timecourse series of wild-type embryos stained for Nv eve mRNA and phospho-Histone H3. (B–D). Top panels are Nv eve in situ alone, middle panels (B′–D′) are phospho-Histone H3 antibody staining, and bottom panels (B″–D″) are merge images of upper panels, showing localization of mitotic figures relative to Nv eve stripes.

DOI: http://dx.doi.org/10.7554/eLife.01440.008

Embryos stained for phosphorylated histone H3 (to label mitotic figures) and for Nv eve mRNA (as shown in Figure 3) were analyzed to quantify the number of mitotic cells occurring between stripes as compared to within eve stripes. Cell number counted is plotted on the Y axis as a function of position along the A–P axis of the embryo (as indicated by Nv eve stripe position), which is indicated on the X axis. Mitotic cells that fall partially on a stripe are counted as occurring in the stripe. Each unique color indicates one embryo quantified in this manner, and embryos corresponding to those shown in Figure 3 are also labeled according to their position in the figure.

DOI: http://dx.doi.org/10.7554/eLife.01440.009

Figure 3—figure supplement 1.

Quantification of PH3 positive cells relative to Nv eve stripes in the embryo.

Embryos stained for phosphorylated histone H3 (to label mitotic figures) and for Nv eve mRNA (as shown in Figure 3) were analyzed to quantify the number of mitotic cells occurring between stripes as compared to within eve stripes. Cell number counted is plotted on the Y axis as a function of position along the A–P axis of the embryo (as indicated by Nv eve stripe position), which is indicated on the X axis. Mitotic cells that fall partially on a stripe are counted as occurring in the stripe. Each unique color indicates one embryo quantified in this manner, and embryos corresponding to those shown in Figure 3 are also labeled according to their position in the figure.

DOI: http://dx.doi.org/10.7554/eLife.01440.009

Nv eve expression and cell division appear to be coordinated.

Embryos co-stained for Nv eve mRNA using in situ hybridization and fluorescent detection, as well as for mitotic figures, using an antibody against phospho Histone H3. Embryos are shown with anterior left and dorsal up, except columns B and C, which are ventral views. (A–A″) An early gastrula embryo exhibiting 15 stripes of Nv eve, including five derivatives of stripe 6 (A), has no evident mitotic figures in the posterior domain of Nv eve stripe 6 differentiation (A′). (A″) Merge of panels A and A′. (B–D″) Timecourse series of wild-type embryos stained for Nv eve mRNA and phospho-Histone H3. (B–D). Top panels are Nv eve in situ alone, middle panels (B′–D′) are phospho-Histone H3 antibody staining, and bottom panels (B″–D″) are merge images of upper panels, showing localization of mitotic figures relative to Nv eve stripes. DOI: http://dx.doi.org/10.7554/eLife.01440.008

Quantification of PH3 positive cells relative to Nv eve stripes in the embryo.

Embryos stained for phosphorylated histone H3 (to label mitotic figures) and for Nv eve mRNA (as shown in Figure 3) were analyzed to quantify the number of mitotic cells occurring between stripes as compared to within eve stripes. Cell number counted is plotted on the Y axis as a function of position along the A–P axis of the embryo (as indicated by Nv eve stripe position), which is indicated on the X axis. Mitotic cells that fall partially on a stripe are counted as occurring in the stripe. Each unique color indicates one embryo quantified in this manner, and embryos corresponding to those shown in Figure 3 are also labeled according to their position in the figure. DOI: http://dx.doi.org/10.7554/eLife.01440.009

Knockdown of Nv eve results in gap and segment polarity defects and posterior truncation

The expression of Nv eve suggests a combination of long germ and short germ character. To further explore this possibility, we knocked down Nv eve gene function. Although parental RNAi in Nasonia is effective for maternal and early zygotic genes (Lynch and Desplan, 2006; Lynch et al., 2006; Olesnicky et al., 2006; Brent et al., 2007), it often does not provide significant knockdown of later-acting genes. To overcome this limitation, we designed an Nv eve morpholino overlapping the translation start site, as well as one directed at the exon–intron junction in the homeobox. These two independent morpholinos are expected to disrupt Nv eve activity and indeed result in comparable phenotypes. The Nasonia larval cuticle has relatively few landmarks to allow for interpretation of segmentation phenotypes. Beyond the denticle belts present on each of the three thoracic segments and ten abdominal segments, large spiracles are found on segments T2, A1, A2 and A3 (Figure 4A, yellow arrowheads). In the head, two bright structures indicate the positions of antennal papillae. Morpholino block of Nv eve causes a range of phenotypes (Figure 4B–E), resulting in severe truncation of the embryo with loss of posterior-derived segments as well as a partial pair-rule phenotype for more anterior segments. The phenotypic series includes progressive truncation at the posterior, causing fusion of segments A9–10 in the least affected cuticles, and then A8–10 (Figure 4C) with segment A6 eventually lost, whereas A7 remains virtually intact. In the most severely affected embryos, the entire posterior of the embryo is truncated with A5–A10 missing. (The approximate percentage of embryos in each phenotypic class shown in Figure 4 is indicated in the ‘Materials and methods’.)
Figure 4.

Morpholino knockdown of Nv eve, Nv hairy, and Nv odd results in embryo patterning defects.

First instar larval cuticles are shown with anterior left and generally ventral denticle patterns are shown. (A, F, K) Wild-type larval cuticles. Yellow arrows indicate spiracles present on segments T2, A1, A2 and A3. Bright anterior labral appendages are apparent at the extreme anterior of the larva. (B–E) Unhatched larvae from Nv eve morpholino (MO)-injected embryos, in order of increasing phenotype severity. Red arrowheads indicate loss of midline cuticle. Blue dot indicates head open defect. Yellow arrowheads indicate position of spiracles. (G–J) Unhatched larvae from Nv odd morpholino (MO)-injected embryos, in order of increasing phenotype severity. Yellow arrows indicate position of spiracles, red arrows indicate A3/A4 fusion. X indicates naked cuticle from segment loss. Yellow line indicates multi-segment fusion. (L–O) Unhatched larvae from Nv hairy morpholino (MO)-injected embryos, in order of increasing phenotype severity. Yellow arrowheads indicate position of spiracles. Red or orange arrowheads indicate aberrantly positioned or missing spiracles. Yellow line indicates segment fusion.

DOI: http://dx.doi.org/10.7554/eLife.01440.010

Morpholino knockdown of Nv eve, Nv hairy, and Nv odd results in embryo patterning defects.

First instar larval cuticles are shown with anterior left and generally ventral denticle patterns are shown. (A, F, K) Wild-type larval cuticles. Yellow arrows indicate spiracles present on segments T2, A1, A2 and A3. Bright anterior labral appendages are apparent at the extreme anterior of the larva. (B–E) Unhatched larvae from Nv eve morpholino (MO)-injected embryos, in order of increasing phenotype severity. Red arrowheads indicate loss of midline cuticle. Blue dot indicates head open defect. Yellow arrowheads indicate position of spiracles. (G–J) Unhatched larvae from Nv odd morpholino (MO)-injected embryos, in order of increasing phenotype severity. Yellow arrows indicate position of spiracles, red arrows indicate A3/A4 fusion. X indicates naked cuticle from segment loss. Yellow line indicates multi-segment fusion. (L–O) Unhatched larvae from Nv hairy morpholino (MO)-injected embryos, in order of increasing phenotype severity. Yellow arrowheads indicate position of spiracles. Red or orange arrowheads indicate aberrantly positioned or missing spiracles. Yellow line indicates segment fusion. DOI: http://dx.doi.org/10.7554/eLife.01440.010 At the anterior, T1 is lost with fusion of T3 and A1 (Figure 4B). Segments A2 and A3 are also fused, and there is a continuous lawn of denticles from A4 to the truncated posterior. This is accompanied by a disruption of the remaining denticle belts, leaving naked cuticle along the midline (Figure 4, red arrows). In the most severely affected embryos, segments anterior to A1 are lost and are accompanied by head closure defects. This phenotype represents a partial pair-rule phenotype, accompanied by posterior truncation of the embryo. It also does not exhibit the lawn of denticles phenotype of strong eve alleles in flies (e.g., eve [Macdonald et al., 1986; Fujioka et al., 1999]), although severely affected Nasonia embryos also exhibit cuticle defects beyond a pair-rule phenotype. Hence, these results support a mixed mode of embryogenesis in Nasonia, with characteristic features resembling both long germ and short germ insects. To further examine this possibility, we then investigated the expression patterns in Nasonia of other genes acting as pair-rule in Drosophila, and undertook functional characterization of their activity during embryonic development.

Nasonia odd-skipped expression and function

In the long germ Drosophila embryo, odd is expressed with a double-segment periodicity complementary to that of eve, and its inactivation causes the absence of odd segments (Nusslein-Volhard and Wieschaus, 1980; Coulter et al., 1990). Its critical function as a mediator of the segmentation clock in the short germ beetle was recently elegantly described (Sarrazin et al., 2012). Tc’odd begins with blastoderm expression in double-segment periodicity stripes alternating with Tc’eve expression. Then, new double-segment stripes emanate from the growth zone to generate the entire complement of odd stripes. Secondary single-segment stripes arise later (Sarrazin et al., 2012). There are three odd paralogs in Nasonia, as in flies, where they are named odd, bowl, and sister of bowl (or sob; (Hart et al., 1996)). We used sequence alignment (Figure 5—figure supplement 2) and phylogenetic analysis (Figure 5—figure supplement 1) to identify the Nasonia paralog that is closest to Drosophila odd-skipped, and refer to it hereafter as Nv odd. An Nv odd cDNA fragment comprising the region encoding the conserved DNA binding domain was used as a probe for in situ hybridization (GenBank Accession # KC142194). As observed above for Nv eve, the embryonic expression of Nv odd begins as a broad early domain in syncytial blasoderm embryos (Figure 5A). As this broad domain strengthens and sharpens, a ventral head patch and a posterior cap appear (Figure 5B,C). The broad domain resolves into two clear apparent double-segment stripes (Stripes 1 and 2, Figure 5D). A third double-segment stripe arises from the second stripe, expanding posteriorly (Figure 5D–F). At the same time, a stronger posterior domain apparently advances anteriorly. Pair-rule stripe 4 (double-segment periodicity) arises at the anterior of the first advancing ‘wave’ at cellularization (Figure 5G–H) before the posterior domain recedes again (Figure 5I–J). The fifth double-segment stripe arises during a second ‘wave’ (Figure 5K–M) at the onset of gastrulation. A sixth stripe arises in an apparently similar manner, though it is much fainter and appears while more posterior stripes are already differentiated (Figure 5N, arrowhead); the posterior cap generates two thin pair-rule stripes (Figure 5O) during early germ band extension. At full germ band extension, a total of eight stripes are visible (Figure 5P) before these fade from anterior to posterior. This dynamic expression of Nv odd in the posterior of the embryo is reminiscent of the waves of growth zone expression of Tribolium odd, where blastoderm-derived stripes initially have double-segment periodicity and later single-segment periodicity (Choe et al., 2006; Sarrazin et al., 2012).
Figure 5—figure supplement 2.

odd-skipped protein sequence alignment.

Predicted odd-skipped protein sequences from Nasonia were aligned to odd-skipped related proteins sequences from Drosophila melanogaster, Anopheles gambiae, Apis mellifera, and Tribolium castaneum using ClustalW using standard parameters. Full-length sequences were used for alignment.

DOI: http://dx.doi.org/10.7554/eLife.01440.013

Figure 5—figure supplement 1.

Phylogenetic analysis of odd-skipped.

Phylogenetic analysis of odd-skipped protein was performed using Maximum likelihood analysis with 1000-fold bootstrap support, using RAxML via the CIPRES portal (Copf et al., 2003; Nagy et al., 1994). The best scoring maximum likelihood tree is shown with bootstrap support values indicated adjacent to branch.

DOI: http://dx.doi.org/10.7554/eLife.01440.012

Figure 5.

Summary of Nv odd-skipped mRNA expression.

Embryos are shown with anterior left and dorsal up, except where indicated. (A) Precellular blastoderm embryo showing early expression of Nv odd in a broad domain and a posterior cap with a slight clearing in between. (B) Precellular blastoderm embryo showing ventral head patch and darkened central broad domain and distinct posterior cap. (C) Precellular blastoderm embryo with sharpening pair-rule stripes and expanding posterior cap. (D) Precellular blastoderm embryo with dark ventral head patch and posterior cap, and expansion of expression between broad central domain and posterior domain. (E and F) Cellularizing blastoderm embryos with three double-segment periodicity stripes, and a continuous posterior domain of variable staining intensity. Arrowhead indicates boundary of faint expression, which prefigures position of double-segment stripe 4. (G) Ventral view of cellularizing embryo with three strong double-segment stripes, and a fourth stripe forming at the anterior boundary of a more uniformly staining posterior cap (arrowhead). (H) Cellularized blastoderm embryo with four distinct double-segment stripes and a receding posterior cap domain (arrowhead). (I) Ventral view of cellular blastoderm showing four strong double-segment stripes and receding posterior cap (arrowhead), whose anterior boundary prefigures the position of stripe 5. (J) Ventrolateral view of cellular blasoderm embryo showing early appearance of stripe 5 at the anterior boundary of receding posterior domain, whose staining intensity is now less uniform. (K) Cellular blastoderm embryo with five double-segment stripes of expression, a strong ventral head spot, and a reduced, uniform posterior cap. (L) Same as K, with five equivalently strong double-segment stripes. Arrowhead indicates slightly expanded posterior cap. (M) Early germ-band extension embryo with five double-segment periodicity stripes and two stripes becoming evident within the posterior cap. (N) Slightly later embryo than M, with 2 posterior cap stripes more clearly differentiated. (O) Slightly later embryo than N, with anterior stripes fading and posterior segments expanding. (P) Dorsal view, dorsal closure embryo exhibiting eight single-segment periodicity stripes.

DOI: http://dx.doi.org/10.7554/eLife.01440.011

Phylogenetic analysis of odd-skipped protein was performed using Maximum likelihood analysis with 1000-fold bootstrap support, using RAxML via the CIPRES portal (Copf et al., 2003; Nagy et al., 1994). The best scoring maximum likelihood tree is shown with bootstrap support values indicated adjacent to branch.

DOI: http://dx.doi.org/10.7554/eLife.01440.012

Predicted odd-skipped protein sequences from Nasonia were aligned to odd-skipped related proteins sequences from Drosophila melanogaster, Anopheles gambiae, Apis mellifera, and Tribolium castaneum using ClustalW using standard parameters. Full-length sequences were used for alignment.

DOI: http://dx.doi.org/10.7554/eLife.01440.013

Summary of Nv odd-skipped mRNA expression.

Embryos are shown with anterior left and dorsal up, except where indicated. (A) Precellular blastoderm embryo showing early expression of Nv odd in a broad domain and a posterior cap with a slight clearing in between. (B) Precellular blastoderm embryo showing ventral head patch and darkened central broad domain and distinct posterior cap. (C) Precellular blastoderm embryo with sharpening pair-rule stripes and expanding posterior cap. (D) Precellular blastoderm embryo with dark ventral head patch and posterior cap, and expansion of expression between broad central domain and posterior domain. (E and F) Cellularizing blastoderm embryos with three double-segment periodicity stripes, and a continuous posterior domain of variable staining intensity. Arrowhead indicates boundary of faint expression, which prefigures position of double-segment stripe 4. (G) Ventral view of cellularizing embryo with three strong double-segment stripes, and a fourth stripe forming at the anterior boundary of a more uniformly staining posterior cap (arrowhead). (H) Cellularized blastoderm embryo with four distinct double-segment stripes and a receding posterior cap domain (arrowhead). (I) Ventral view of cellular blastoderm showing four strong double-segment stripes and receding posterior cap (arrowhead), whose anterior boundary prefigures the position of stripe 5. (J) Ventrolateral view of cellular blasoderm embryo showing early appearance of stripe 5 at the anterior boundary of receding posterior domain, whose staining intensity is now less uniform. (K) Cellular blastoderm embryo with five double-segment stripes of expression, a strong ventral head spot, and a reduced, uniform posterior cap. (L) Same as K, with five equivalently strong double-segment stripes. Arrowhead indicates slightly expanded posterior cap. (M) Early germ-band extension embryo with five double-segment periodicity stripes and two stripes becoming evident within the posterior cap. (N) Slightly later embryo than M, with 2 posterior cap stripes more clearly differentiated. (O) Slightly later embryo than N, with anterior stripes fading and posterior segments expanding. (P) Dorsal view, dorsal closure embryo exhibiting eight single-segment periodicity stripes. DOI: http://dx.doi.org/10.7554/eLife.01440.011

Phylogenetic analysis of odd-skipped.

Phylogenetic analysis of odd-skipped protein was performed using Maximum likelihood analysis with 1000-fold bootstrap support, using RAxML via the CIPRES portal (Copf et al., 2003; Nagy et al., 1994). The best scoring maximum likelihood tree is shown with bootstrap support values indicated adjacent to branch. DOI: http://dx.doi.org/10.7554/eLife.01440.012

odd-skipped protein sequence alignment.

Predicted odd-skipped protein sequences from Nasonia were aligned to odd-skipped related proteins sequences from Drosophila melanogaster, Anopheles gambiae, Apis mellifera, and Tribolium castaneum using ClustalW using standard parameters. Full-length sequences were used for alignment. DOI: http://dx.doi.org/10.7554/eLife.01440.013 Using double fluorescent in situ hybridization, we confirmed that the pair-rule stripes of Nv odd and Nv eve are indeed complementary to each other, although their mode of appearance is totally different. Nv odd double-segment stripes are posterior to, and abut each posterior single-segment stripe (i.e., 1b, 2b) from each eve pair-rule doublet (Figure 6A–C), that is, the even-numbered segmental stripes. Late forming Nv eve stripe 15/16 intercalates between the two Nv odd stripes 7 and 8 that derive from the cap, with Nv odd stripe 8 remaining posterior to all Nv eve stripes (excepting the last stripe, eve 16, which is the last to appear), a relationship that may have ancestral origins (see ‘Discussion’).
Figure 6.

Phasing of Nasonia pair-rule genes in embryos using double fluorescent in situ hybridization.

(A) Lateral view of Nv eve expression in early gastrula embryo. (B) Nv odd expression alone in the same embryo. (C) Merge of Nv eve and Nv odd channels, illustrating their relative phasing. Nv eve mRNA is pseudo-colored pink, Nv odd is in green. Arrowheads indicate position of a posterior doublet of odd stripes. (D) Dorsolateral view of Nv eve in later gastrula embryo. (E) Nv odd expression alone in the same embryo. Arrowheads indicate position of posterior Nv odd stripes 6, 7 and 8. (F) Merge of Nv eve and Nv odd channels, illustrating their relative phasing. (G) Lateral view of Nv eve expression in blastoderm embryo. Arrowhead indicates position of Nv eve stripe 5. (H) Nv runt expression in the same blastoderm embryo. (I) Merge of Nv eve (green) and Nv runt (pink) channels, indicating relative phasing. (J) Lateral view of Nv eve expression in germ-band-extended embryo. Numbers indicate identity of Nv eve stripe. (K) Nv runt expression alone in the same embryo. Arrowheads indicate position of posterior primary Nv runt stripes. (L) Merge of Nv eve (green) and Nv runt (pink) channels, indicating relative phasing. Note that posterior Nv runt stripes, though faint, appear to be positioned posterior to odd-numbered Nv eve segmental stripes. (M) Lateral view of Nv eve expression in early gastrula embryo. Line indicates broadening stripe 6. (N) Nv hairy expression in the same gastrula embryo. Arrowheads indicate positions of three late forming posterior double-segment stripes. (O) Merge of Nv eve (pink) and Nv hairy (green) channels, indicating relative phasing. (P) Ventral view of gastrula embryo showing Nv eve expression alone. Arrowheads indicate positions of single-segment stripes derived from eve stripe 6. (Q) Nv hairy expression alone in the same gastrula embryo. Line indicates extended anterior domain continuous with stripe 1. (R) Merge of Nv eve (green) and Nv hairy (pink) channels, illustrating relative phasing.

DOI: http://dx.doi.org/10.7554/eLife.01440.014

Embryos are shown anterior left and ventral up unless indicated. (A) Early energid stage embryo with faint staining evident in posterior. (B) Early precellular blastoderm embryo exhibiting stronger, mostly ubiquitous Nv runt staining biased towards the posterior. (C) Precellular blastoderm embryo with strong stripe of Nv runt expression within larger, gap-type domain. Expression is absent from the rest of the embryo. (D) Precellular blastoderm embryo exhibiting three clear pair-rule stripes of Nv runt expression. (E) Cellular blastoderm embryo with four pair-rule stripes of Nv runt expression. (F) Early gastrula embryo exhibiting three pair-rule stripes, an expanding stripe 4/5 stripe domain and faint posterior stripe 6. (G) Early gastrula embryo exhibiting 6 pair-rule stripes of Nv runt expression. (H) Gastrula embryo exhibiting splitting of anterior stripes 1 and 2 (and possibly 3), and stronger expression of stripes 4 and 5, with expanded interstripe distance between stripes 5 and 6. (I) Dorsal view of gastrula embryo at approximately the same stage as in (H). (J) Dorsolateral view of germ-band extension embryo with fading anterior stripes, and an additional pair-rule stripe appearing between stripes 5 and 6 (arrowhead). (K) Germ-band extension embryo exhibiting seven pair-rule stripes of expression with segmental stripes appearing in posterior interstripes (arrowheads). (L) Ventral view of fully extended germ band exhibiting segmental expression in all segments, in addition to continuous expression in the ventral anterior of the embryo.

DOI: http://dx.doi.org/10.7554/eLife.01440.015

Phasing of Nasonia pair-rule genes in embryos using double fluorescent in situ hybridization.

(A) Lateral view of Nv eve expression in early gastrula embryo. (B) Nv odd expression alone in the same embryo. (C) Merge of Nv eve and Nv odd channels, illustrating their relative phasing. Nv eve mRNA is pseudo-colored pink, Nv odd is in green. Arrowheads indicate position of a posterior doublet of odd stripes. (D) Dorsolateral view of Nv eve in later gastrula embryo. (E) Nv odd expression alone in the same embryo. Arrowheads indicate position of posterior Nv odd stripes 6, 7 and 8. (F) Merge of Nv eve and Nv odd channels, illustrating their relative phasing. (G) Lateral view of Nv eve expression in blastoderm embryo. Arrowhead indicates position of Nv eve stripe 5. (H) Nv runt expression in the same blastoderm embryo. (I) Merge of Nv eve (green) and Nv runt (pink) channels, indicating relative phasing. (J) Lateral view of Nv eve expression in germ-band-extended embryo. Numbers indicate identity of Nv eve stripe. (K) Nv runt expression alone in the same embryo. Arrowheads indicate position of posterior primary Nv runt stripes. (L) Merge of Nv eve (green) and Nv runt (pink) channels, indicating relative phasing. Note that posterior Nv runt stripes, though faint, appear to be positioned posterior to odd-numbered Nv eve segmental stripes. (M) Lateral view of Nv eve expression in early gastrula embryo. Line indicates broadening stripe 6. (N) Nv hairy expression in the same gastrula embryo. Arrowheads indicate positions of three late forming posterior double-segment stripes. (O) Merge of Nv eve (pink) and Nv hairy (green) channels, indicating relative phasing. (P) Ventral view of gastrula embryo showing Nv eve expression alone. Arrowheads indicate positions of single-segment stripes derived from eve stripe 6. (Q) Nv hairy expression alone in the same gastrula embryo. Line indicates extended anterior domain continuous with stripe 1. (R) Merge of Nv eve (green) and Nv hairy (pink) channels, illustrating relative phasing. DOI: http://dx.doi.org/10.7554/eLife.01440.014

Summary of Nv runt mRNA expression.

Embryos are shown anterior left and ventral up unless indicated. (A) Early energid stage embryo with faint staining evident in posterior. (B) Early precellular blastoderm embryo exhibiting stronger, mostly ubiquitous Nv runt staining biased towards the posterior. (C) Precellular blastoderm embryo with strong stripe of Nv runt expression within larger, gap-type domain. Expression is absent from the rest of the embryo. (D) Precellular blastoderm embryo exhibiting three clear pair-rule stripes of Nv runt expression. (E) Cellular blastoderm embryo with four pair-rule stripes of Nv runt expression. (F) Early gastrula embryo exhibiting three pair-rule stripes, an expanding stripe 4/5 stripe domain and faint posterior stripe 6. (G) Early gastrula embryo exhibiting 6 pair-rule stripes of Nv runt expression. (H) Gastrula embryo exhibiting splitting of anterior stripes 1 and 2 (and possibly 3), and stronger expression of stripes 4 and 5, with expanded interstripe distance between stripes 5 and 6. (I) Dorsal view of gastrula embryo at approximately the same stage as in (H). (J) Dorsolateral view of germ-band extension embryo with fading anterior stripes, and an additional pair-rule stripe appearing between stripes 5 and 6 (arrowhead). (K) Germ-band extension embryo exhibiting seven pair-rule stripes of expression with segmental stripes appearing in posterior interstripes (arrowheads). (L) Ventral view of fully extended germ band exhibiting segmental expression in all segments, in addition to continuous expression in the ventral anterior of the embryo. DOI: http://dx.doi.org/10.7554/eLife.01440.015 To examine the function of Nv odd in the embryo, we used one translation blocking and one splice blocking morpholino to knock down its expression in embryos. Inactivating Nv odd function leads to loss of the most posterior germ band-derived segments A5–A10 with additional anterior defects. The most sensitive phenotypes are the fusion of segments A3 and A4, and loss of segment A5 (Figure 4G, red arrowheads and x). More severely affected embryos exhibit loss of most segments posterior to A3/A4 and naked cuticle anterior to T2, though larval head structures are still present (Figure 4I–J). In many severely affected embryos, Nv odd knockdown causes additional loss/fusion of A1, and of T2. Thus, phenotypes comprise loss of segments T2, A1, A3 and A5 and resemble a pair-rule phenotype. A small percentage of embryos are nearly asegmental, with only small patches of denticle bands of unknown identity (not shown). Therefore, as also observed for Nv eve knockdown, the segmentation defects resulting from Nv odd inactivation only corresponds to a partial Drosophila-like pair-rule phenotype, and rather, in the most severe cases, resemble the phenotype of Tc’odd loss of function. It is of note that Nv odd stripes 4, 5 and 6 appear to emerge from waves of expression at the posterior of the embryo that likely specify segments A3–A5, which are most sensitive to loss of Nv odd function (Figure 5E–L, Figure 4G). In summary, Nv odd is expressed initially in three sequentially forming anterior double-segment periodicity stripes, which appear to have Drosophila-like pair-rule character. Three more posterior double-segment stripes (PR stripes 4–6) then form sequentially, apparently as ‘waves’ of Nv odd expression, resembling the clock-driven stripes of Tc’odd. Finally, two Nv odd stripes form from a posterior cap. Nv odd knockdown affects anterior thoracic segments with a partial pair-rule phenotype; it also leads to the loss of posterior segments A5–A10.

Nasonia runt expression

The complementarity between Nv eve and Nv odd is suggestive of cross interaction between the two genes but it is only partial and only affects half of the Nv eve segmental stripes since Nv odd does not have single-segment periodicity stripes. We sought to determine whether the remaining single segment stripes where odd is not interdigitated with Nv eve may alternate with stripes of Nv runt, as is observed in Drosophila. We studied the expression of Nv runt throughout embryogenesis (Figure 6—figure supplement 1) and then used double fluorescent in situ hybridization to visualize its register with Nv eve stripes at both early and late stages. Nv runt stripes appear cleanly in an anterior to posterior progression, with six double-segment periodicity stripes visible before cellularization; two additional double-segment stripes are added at the posterior during gastrulation. Single-segment periodicity stripes only appear much later at full germ band extension when the expression of the other pair-rule genes is already well established (Figure 6—figure supplement 1). In the early embryo, Nv runt double-segment stripes appear posterior to, and partly overlapping with, each Nv eve primary double-segment stripe (Figure 6G–I). Splitting of anterior Nv eve stripes moves the posterior of each doublet (i.e., even-numbered Nv eve single-segment stripes) more posteriorly beyond each Nv runt primary double-segment stripe (Figure 6G–I). The appearance of Nv eve stripe 5 between Nv runt double-segment stripes 4 and 5 as they split (Figure 6G–I, arrowhead; Figure 6—figure supplement 1F,G) suggests that eve may help to repress Nv runt, though this remains to be tested.
Figure 6—figure supplement 1.

Summary of Nv runt mRNA expression.

Embryos are shown anterior left and ventral up unless indicated. (A) Early energid stage embryo with faint staining evident in posterior. (B) Early precellular blastoderm embryo exhibiting stronger, mostly ubiquitous Nv runt staining biased towards the posterior. (C) Precellular blastoderm embryo with strong stripe of Nv runt expression within larger, gap-type domain. Expression is absent from the rest of the embryo. (D) Precellular blastoderm embryo exhibiting three clear pair-rule stripes of Nv runt expression. (E) Cellular blastoderm embryo with four pair-rule stripes of Nv runt expression. (F) Early gastrula embryo exhibiting three pair-rule stripes, an expanding stripe 4/5 stripe domain and faint posterior stripe 6. (G) Early gastrula embryo exhibiting 6 pair-rule stripes of Nv runt expression. (H) Gastrula embryo exhibiting splitting of anterior stripes 1 and 2 (and possibly 3), and stronger expression of stripes 4 and 5, with expanded interstripe distance between stripes 5 and 6. (I) Dorsal view of gastrula embryo at approximately the same stage as in (H). (J) Dorsolateral view of germ-band extension embryo with fading anterior stripes, and an additional pair-rule stripe appearing between stripes 5 and 6 (arrowhead). (K) Germ-band extension embryo exhibiting seven pair-rule stripes of expression with segmental stripes appearing in posterior interstripes (arrowheads). (L) Ventral view of fully extended germ band exhibiting segmental expression in all segments, in addition to continuous expression in the ventral anterior of the embryo.

DOI: http://dx.doi.org/10.7554/eLife.01440.015

Late expression of Nv runt in the extending germ band is considerably weaker than that of other genes, making its detection more challenging. Still, at the posterior of the embryo, Nv runt double-segment stripes appear between Nv eve single-segment stripes arising from splitting of double-segment stripes (Figure 6J–L). Altogether, our data support a model in which Nv eve single-segment periodicity stripes are established through the complementary action of Nv odd for odd numbered single-segment stripes and Nv runt for even-numbered stripes, as summarized in our model below. However, these interactions are still speculative since we have been technically unable to complete the epistasis experiments needed to test this model. A predicted role for Nv h is also described below.

Expression and function of Nasonia hairy

hairy is a primary pair-rule gene in Drosophila, but in Tribolium, its function is restricted to head segment differentiation (Carroll et al., 1988; Carroll and Vavra, 1989; Edgar et al., 1989; Choe et al., 2006). There are two hairy-like genes in Nasonia, and we identified the likely hairy (h) ortholog using phylogenetic analysis (Figure 7—figure supplements 1 and 2). We examined expression of Nv h using a probe directed against the full-length coding region (Genbank Accession # KC190514). Nv h expression begins as a single broad anterior double segment stripe 1 that incompletely spans the dorso–ventral axis. It is soon followed by a second broad double-segment stripe 2 just anterior to the middle of the embryo (Figure 7A). Double-segment stripes 3, 4 and 5 are then added sequentially before cellularization (Figure 7B–E); a faint stripe at the extreme posterior of the embryo is also visible. By gastrulation, an anterior cap becomes more visible with continuous low expression between the anterior pole and the strong stripe 1 (Figure 7H–J). As gastrulation progresses, this domain becomes stronger and more uniform, whereas double-segment stripes 6 and 7 appear sequentially (Figure 7H–K). Stripe 8 broadens, becoming a posterior cap whose intensity increases during germ band extension (Figure 7J–N). The anterior of the embryo exhibits diffuse staining that expands from the anterior ventral side posteriorly, until germ band retracted embryos are faintly but uniformly stained with dark segmental stripes on top (Figure 7O). Nv h double-segment stripes appear cleanly, and the timing and presentation of expression of posterior stripes suggest that they may respond to waves of Nv odd. Like Nv odd and early Nv runt, Nv h does not have stripes with single-segment periodicity.
Figure 7.

Summary of Nv hairy mRNA expression.

(A) Blastoderm embryo with two double-segment periodicity stripes of Nv hairy expression. Note that stripe 2 is broader and stronger than stripe 1. (B) Blastoderm embryo showing four double-segment periodicity stripes of expression plus an anterior accumulation of Nv hairy transcripts (arrowhead). (C) Dorsal view of embryo as in (B), illustrating the dorsal anterior expression (arrowhead) that is activated in the same pattern as the anterior domain of Nv tailless (Lynch et al., 2006). (D) Blastoderm embryo with strong anterior and dorsal anterior expression of Nv hairy and five pair-rule stripes. (E) Dorsal view of embryo as in (D) with increased dorsal anterior expression of Nv hairy, and the anterior spreading of expression from the anterior of double-segment pair-rule stripe 1. (F) Blastoderm embryo with expanding anterior domain (line), five double-segment ‘pair-rule’ stripes, and two additional stripes coming up. Note that the anterior domain between stripe 1 and the anterior pole is becoming more continuous in expression. (G) Dorsolateral view of embryo as in (F) highlighting the dorsal anterior expression. Stripe 2 is still wider than other stripes. Stripe 6 appears to be of single-segment periodicity. (H) Early gastrula embryo exhibiting a non-homogenous but largely continuous anterior cap of Nv hairy expression (that includes stripe 1). Four additional double-segment stripes and three single-segment stripes (two derived from stripe 6) are now evident. (I) Dorsal view of embryo slightly older than embryo in (H) showing the nearly continuous head domain, and the apparent splitting of stripe 1 within that domain. Double-segment stripes are thinning. (J) Dorsolateral view of extending germ-band embryo. Head domain is continuous (line). Stripes 1–7 have single-segment periodicity, are of non-uniform strength; stripe eight appears darker and broader. (K) Germ-band extending embryo with a continuous head domain (line) and eight discrete stripes. (L) Dorsolateral view of germ-band extending embryo. Stripe 8 is expanded into a wedge abutting the pole cells, and the anterior domain is expanding to include stripe 2. (M) Germ-band extension embryo with expanding anterior domain, that extends to include stripe 3 (arrowhead). Posterior domain is expanded. (N) Dorsolateral view of embryo as in (M) showing further expansion of posterior stripe 8 domain (line). (O) Germ-band-retracted embryo exhibiting ubiquitous staining with striated expression evident.

DOI: http://dx.doi.org/10.7554/eLife.01440.016

Phylogenetic analysis of hairy-related protein sequences was performed using Maximum likelihood analysis with 1000-fold bootstrap support, using RAxML via the CIPRES portal (Copf et al., 2003; Nagy et al., 1994). The best scoring maximum likelihood tree is shown with bootstrap support values indicated adjacent to branch.

DOI: http://dx.doi.org/10.7554/eLife.01440.017

Predicted hairy-like protein sequences from Nasonia were aligned to hairy-like proteins from Drosophila melanogaster, Anopheles gambiae, Apis mellifera, and Tribolium castaneum using ClustalW. Full-length sequences were used for the alignment.

DOI: http://dx.doi.org/10.7554/eLife.01440.018

Summary of Nv hairy mRNA expression.

(A) Blastoderm embryo with two double-segment periodicity stripes of Nv hairy expression. Note that stripe 2 is broader and stronger than stripe 1. (B) Blastoderm embryo showing four double-segment periodicity stripes of expression plus an anterior accumulation of Nv hairy transcripts (arrowhead). (C) Dorsal view of embryo as in (B), illustrating the dorsal anterior expression (arrowhead) that is activated in the same pattern as the anterior domain of Nv tailless (Lynch et al., 2006). (D) Blastoderm embryo with strong anterior and dorsal anterior expression of Nv hairy and five pair-rule stripes. (E) Dorsal view of embryo as in (D) with increased dorsal anterior expression of Nv hairy, and the anterior spreading of expression from the anterior of double-segment pair-rule stripe 1. (F) Blastoderm embryo with expanding anterior domain (line), five double-segment ‘pair-rule’ stripes, and two additional stripes coming up. Note that the anterior domain between stripe 1 and the anterior pole is becoming more continuous in expression. (G) Dorsolateral view of embryo as in (F) highlighting the dorsal anterior expression. Stripe 2 is still wider than other stripes. Stripe 6 appears to be of single-segment periodicity. (H) Early gastrula embryo exhibiting a non-homogenous but largely continuous anterior cap of Nv hairy expression (that includes stripe 1). Four additional double-segment stripes and three single-segment stripes (two derived from stripe 6) are now evident. (I) Dorsal view of embryo slightly older than embryo in (H) showing the nearly continuous head domain, and the apparent splitting of stripe 1 within that domain. Double-segment stripes are thinning. (J) Dorsolateral view of extending germ-band embryo. Head domain is continuous (line). Stripes 1–7 have single-segment periodicity, are of non-uniform strength; stripe eight appears darker and broader. (K) Germ-band extending embryo with a continuous head domain (line) and eight discrete stripes. (L) Dorsolateral view of germ-band extending embryo. Stripe 8 is expanded into a wedge abutting the pole cells, and the anterior domain is expanding to include stripe 2. (M) Germ-band extension embryo with expanding anterior domain, that extends to include stripe 3 (arrowhead). Posterior domain is expanded. (N) Dorsolateral view of embryo as in (M) showing further expansion of posterior stripe 8 domain (line). (O) Germ-band-retracted embryo exhibiting ubiquitous staining with striated expression evident. DOI: http://dx.doi.org/10.7554/eLife.01440.016

Phylogenetic analysis of hairy.

Phylogenetic analysis of hairy-related protein sequences was performed using Maximum likelihood analysis with 1000-fold bootstrap support, using RAxML via the CIPRES portal (Copf et al., 2003; Nagy et al., 1994). The best scoring maximum likelihood tree is shown with bootstrap support values indicated adjacent to branch. DOI: http://dx.doi.org/10.7554/eLife.01440.017

Hairy protein sequence alignment.

Predicted hairy-like protein sequences from Nasonia were aligned to hairy-like proteins from Drosophila melanogaster, Anopheles gambiae, Apis mellifera, and Tribolium castaneum using ClustalW. Full-length sequences were used for the alignment. DOI: http://dx.doi.org/10.7554/eLife.01440.018 Double fluorescent in situ hybridization with Nv eve reveals that early Nv h overlaps the anterior of Nv eve double-segment stripes (Figure 6M–O). Later, these stripes appear thinner, and they overlap the anterior Nv eve single-segment odd-numbered stripes in each double-segment doublet. Nv h double-segment stripe 6 anticipates the position of the most anterior derivative of the Nv eve stripe 6 quartet (segmental stripes 11–14). Nv h stripe 7 (double segment), which is thin, appears within the Nv eve early broad stripe 6 domain, coinciding with Nv eve single-segment stripe 13 (Figure 6P–R, Figure 8). A more posterior stripe, Nv h 8, anticipates, albeit more broadly, the site of Nv eve single-segment stripe 15 (Figure 6M–O,P–R, Figure 8). Thus, Nv h and Nv eve are co-expressed at the anterior of eve pair-rule stripes and in the first of each pair of eve (odd-numbered) single-segment stripes, similar to the relationship described for Drosophila eve and hairy as they initiate segment polarity (Warrior and Levine, 1990).
Figure 8.

Summary model of pair-rule gene expression in the Nasonia embryo.

(A) Model of register of pair-rule gene expression in the early embryo. Nv eve and Nv odd stripes are totally complementary, whereas Nv runt stripes partly overlap each of these genes at their interface. Nv hairy stripes overlap Nv eve stripes toward the anterior of each double-segment periodicity stripe. Towards the posterior of the embryo, an extended domain of low-level Nv odd expression exhibits dynamic behavior over several nuclear cycles, and stripes 4/5 of Nv eve, Nv odd, and Nv runt each differentiate during this interval. Even more posteriorly, Nv eve stripe 6 lay anterior to a continuous Nv odd cap that extends to the posterior pole of the embryo. This region is set aside for segment specification and differentiation during germ-band extension. (B) Model of register of pair-rule gene expression in the germ-band extension (late) embryo. Single-segment periodicity stripes in the germ-band-extended embryo exhibit a variation upon early gene expression patterns. Nv eve single-segment stripes are interrupted by Nv runt and then Nv odd such that Nv runt stripes follow odd-numbered Nv eve stripes, and Nv odd stripes follow even-numbered Nv eve stripes. Each of 8 Nv hairy stripes overlaps odd-numbered Nv eve stripes that derive from the anterior of Nv eve pair-rule stripes. Additional expression of several of these genes in the ventral and head domains, which appears to rely on different regulatory logic, is not shown.

DOI: http://dx.doi.org/10.7554/eLife.01440.019

Summary model of pair-rule gene expression in the Nasonia embryo.

(A) Model of register of pair-rule gene expression in the early embryo. Nv eve and Nv odd stripes are totally complementary, whereas Nv runt stripes partly overlap each of these genes at their interface. Nv hairy stripes overlap Nv eve stripes toward the anterior of each double-segment periodicity stripe. Towards the posterior of the embryo, an extended domain of low-level Nv odd expression exhibits dynamic behavior over several nuclear cycles, and stripes 4/5 of Nv eve, Nv odd, and Nv runt each differentiate during this interval. Even more posteriorly, Nv eve stripe 6 lay anterior to a continuous Nv odd cap that extends to the posterior pole of the embryo. This region is set aside for segment specification and differentiation during germ-band extension. (B) Model of register of pair-rule gene expression in the germ-band extension (late) embryo. Single-segment periodicity stripes in the germ-band-extended embryo exhibit a variation upon early gene expression patterns. Nv eve single-segment stripes are interrupted by Nv runt and then Nv odd such that Nv runt stripes follow odd-numbered Nv eve stripes, and Nv odd stripes follow even-numbered Nv eve stripes. Each of 8 Nv hairy stripes overlaps odd-numbered Nv eve stripes that derive from the anterior of Nv eve pair-rule stripes. Additional expression of several of these genes in the ventral and head domains, which appears to rely on different regulatory logic, is not shown. DOI: http://dx.doi.org/10.7554/eLife.01440.019 We knocked down Nv hairy function using two independent morpholinos directed at two different splice junctions. Both resulted in a range of cuticle defects that indicate that Nv h is required for the formation of all posterior-derived segments and blastoderm-derived segments in the thorax and anterior abdomen (Figure 4L–O). At the posterior, mildly affected cuticles exhibit fusion of segments A9–10 (Figure 4L,N), along with partial loss of alternating abdominal segments posterior to A4. In more affected cuticles, alternating segments posterior to A2 are fused (Figure 4L–N), resembling a pair-rule phenotype. In severely affected embryos, all segments from A4–A10 are fused with a continuous lawn of denticles that covers the posterior of a severely reduced cuticle (Figure 4O, yellow line). These phenotypes suggest a requirement for Nv hairy in specification of posterior segments. The late Nv h stripes 6–8 are positioned to affect the late forming segments as supported by double in situs (Figure 6). In spite of Nv hairy expression in the head and extreme anterior of the embryo, labral structures in Nv hairy morpholino cuticles appear to be unaffected. The expression pattern of Nv hairy is thus strikingly similar to Tc’hairy (Sommer and Tautz, 1993; Aranda et al., 2008), though functionally quite different, since Tc’h seems to act exclusively in patterning head segments (Choe et al., 2006; Aranda et al., 2008). At the anterior, A2 is also nearly always affected, exhibiting loss of denticles and displacement or loss of the associated spiracle (Figure 4L, orange arrowhead). Segment T1 appears to be lost and fused to T2. Finally, more affected embryos show a loss of T3 (Figure 4M–O). Therefore, segments T1, T3, and A2 are missing, which resembles an anterior pair-rule phenotype. In summary, Nv h expression is highly dynamic and proceeds in an anterior to posterior progression. It is distinct from Nv eve and does not exhibit single-segment periodicity stripes. At the end of embryogenesis, its expression becomes nearly ubiquitous (Figure 7O). Taken together, these data support a model wherein ‘pair-rule’ genes have weak fly-type ‘pair-rule’ phenotypes in the anterior, and are required for the formation of a suite of posterior segments. Their interdigitated expression suggests extensive interactions during patterning of the posterior region after cellularization, although this has not yet been tested due to current experimental limitations. Our summary model of the phasing of ‘pair-rule’ stripes in the embryo is given in Figure 8.

Discussion

Decades of study of a variety of insects have yielded a deep understanding of the genes controlling anterior–posterior patterning of the embryo. The best-characterized model species are the extreme long germ Drosophila embryo and the short-germ Tribolium embryo. Additional insects, such as Gryllus bimaculatus (Mito et al., 2007), Bombyx mori (Xu et al., 1997), Oncopeltus fasciatus (Liu and Kaufman, 2004a, 2004b, 2005a), Schistocerca americana (Patel et al., 1992) and others, represent informative intermediates, but many of these species are on the short end of this wide spectrum, consistent with ancestral insects being short germ band. Hymenoptera, including Apis and Nasonia, have evolved a long germ embryogenesis independently from flies and therefore provide an excellent context for addressing the question of how the transition from short to long germ occurred. Other well-characterized arthropod species, such as Cupiennius salei (Damen et al., 2000; Stollewerk et al., 2003) and Strigamia maritima (Chipman et al., 2004; Chipman and Akam, 2008), provide additional models of interest for understanding more ancient evolutionary history. Nasonia has been characterized as long germ because of the presence of two morphogenetic centers and the expression patterns and RNAi phenotypes of the gap genes (Ingham et al., 1985; Pultz et al., 2005; Lynch et al., 2006; Olesnicky et al., 2006; Brent et al., 2007). In this study, we describe the expression and loss of function phenotypes of Nasonia eve, hairy and odd, three genes that act as pair-rule genes in Drosophila. While the expression of Nv eve is controlled by maternal and gap gene factors that are largely similar to their Drosophila counterparts, we find critical deviations from the Drosophila long germ paradigm. Nv ‘pair-rule’ genes display similarity to both Drosophila and Tribolium, suggesting that Nasonia has features of both short and long germ band development. Unlike the long germ embryo of the honeybee, Apis, Nasonia pair-rule genes do not seem to be maternally expressed, and so far, regulation of Nv gap genes by pair-rule genes (as reported for Apis [Wilson and Dearden, 2012]) has yet to be studied systematically.

Expression and knockdown of Nasonia eve, hairy and odd

In contrast to Drosophila, whose pair-rule genes are expressed in the blastoderm in seven double-segment periodicity stripes to determine the formation of 14 segments, their orthologs in Nasonia are expressed in diverse and more intricate patterns. In no case do we observe simply eight precellularization double-segment stripes, confirming that pair ‘rule’ does not represent the regulatory dynamics of these genes across insects. We observe wave-like behavior of Nv odd stripe 4–6, which underscores that cycling control may remain from the ancestral segmentation clock. Nv runt and, to a large degree, Nv h, also exhibit a sequential progression of sharp stripe appearance that may be responsive to the waves of Nv odd (Figure 7, Figure 6—figure supplement 1). It is clear that Nv eve, Nv odd, and Nv h exhibit multiple modes of regulation during embryogenesis. In each case, their anterior stripes formed in the syncytial blastoderm have double-segment periodicity and arise in a manner that could be explained by the type of enhancer logic exemplified by Drosophila eve (Small and Levine, 1991; Small et al., 1992, 1996; Schroeder et al., 2004; Schroeder et al., 2011). Anterior double-segment ‘pair-rule’ stripes of Nv eve appear to be regulated by maternal and gap genes as in Drosophila, and embryos knocked down for Nv eve, Nv odd and Nv h exhibit a pair-rule phenotype in the blastoderm-derived segments, although this phenotype is most often limited. It is worth noting that the severe Nv eve anterior defects are more regional, as observed for Oncopeltus eve that behaves as a gap gene, and is attributed to the broad early domain of expression (Liu and Kaufman, 2005a). Perhaps, as in Oncopeltus, Nv eve is required in combination with Nv hb or Nv gt for activation of their targets, which are in turn required for the proper formation of head and thoracic segments. Another mode must control the formation of stripes of Nv eve, Nv odd, and Nv h that arise later, in a cellular environment, from a posterior domain (whether at the posterior pole of the embryo, as in the case of Nv odd and Nv hairy, or from a broad posterior stripe, as in the case of Nv eve). Knockdown of each of the three genes produces a severe posterior truncation of the embryo, deleting all six posterior segments, indicating that each gene is required for the formation of posterior-derived segments. This phenotype is unlike flies, and resembles more the short germ pair-rule gene circuit of Tribolium (Choe et al., 2006; Choe and Brown, 2009; Sarrazin et al., 2012). Together with co-expression data, their phenotypes suggest that each of these genes is required for refinement or maintenance of each other’s activity or expression (Figure 6, Figure 6—figure supplement 1). We propose a model in which interactions among ‘pair-rule’ genes dominate in patterning the long germ Nasonia embryo. Unlike flies, posterior stripes of ‘pair-rule’ genes like Nv hairy and Nv runt appear sequentially. Indeed, the gene circuit involving interactions among Tc’odd, Tc’eve and Tc’runt in each round of posterior segment formation underscores the likely ancestral nature of this network, which might have been brought under the control of the gap and maternal genes in flies, and in the anterior segments of Nasonia. The ‘waves’ of Nv odd pair-rule stripe expression that give rise to blastoderm stripes 4, 5, and 6 suggest residual activity of a segmentation clock. The presumptive domain of six posterior segments indicated by early posterior expression of Nv eve and Nv odd may be similar to the ‘growth zone’ of short germ insects. Waves of Nv odd 4, 5, and 6, and the sequential formation of Nv runt stripes both interrupt and likely pattern the continuous Nv eve stripe 6 domain (Figure 6A–L; Figure 8). Nv h expression anticipates the final position of several late forming Nv eve stripes, and in combination with the phenotype of Nv h knockdown and co-expression data, suggests that it is required for the formation of the posterior Nv eve stripes. Thus, Nasonia represents a variation on embryo allocation and patterning, but the contribution of ‘pair-rule’ gene function is enduring. The use of a clock-like mechanism is not incompatible with long germ embryogenesis, and rather, retaining this character might allow for sampling transitional states between the short- and long germ strategies, which likely occurred multiple times within holometabola. Further, it may be that the absence of significant posterior elongation is the transition state that tips the balance toward elaboration of anterior segmentation control mechanisms and loss of late forming segments. Our characterization of the Nasonia pair-rule genes illustrates one way that these two strategies can co-exist. It is also of note that although hairy-related genes are the oscillating components of vertebrate segmentation clocks (Palmeirim et al., 1997), it is generally odd-skipped-related genes that oscillate in arthropods (Chipman et al., 2004; Chipman and Akam, 2008; El-Sherif et al., 2012; Sarrazin et al., 2012). Notch-signaling has been described for its involvement in regulating hairy-related oscillations in the vertebrate clock (e.g., Jouve et al., 2000), and it may also be involved in the context of the arthropod segmentation clock (Stollewerk et al., 2003; Eriksson et al., 2013; Kainz et al., 2011); in all cases, the driver of the clock is yet to be elucidated (reviewed in Pourquie, 2003).

An ancestral role for eve in specifying posterior identity may be linked to growth zone behavior in short germ insects

eve has been suggested to have its most ancestral function as a specifier of posteriorness (Ahringer, 1996; Brown et al., 1997). Indeed, the two mammalian eve genes are located at the most ‘posterior’ end of two of the Hox clusters (Bastian et al., 1992), although eve is not a part of the Hox cluster in Nasonia or Tribolium or any other insects that have been studied (Shippy et al., 2008; Werren et al., 2010; Munoz-Torres, 2009; Suen et al., 2011). Yet, even in Drosophila, where there is no apparent sequential segmentation, a delayed pair-rule stripe (stripe 8) appears early in gastrulation (Macdonald et al., 1986; Frasch et al., 1987; Kim et al., 2000). In Schistocerca, eve is expressed in a posterior mesodermal domain and no pair-rule stripes arise from this region, indicating that eve plays a role in posteriorness and not segmentation in basal insects (Patel et al., 1992). Nasonia eve sets aside stripe 6 relatively early, at about the same time as Nv odd that is expressed even more posteriorly. This feature of Nv eve in posterior segmentation is not shared by the other pair-rule genes we studied, therefore supporting the notion of an ancestral role for eve in posteriorness in Nasonia. That its expression is complementary to that of odd in both Tribolium and Nasonia in a late-differentiating posterior region may hint at how this role in posteriorness evolved into a role in posterior growth. In non-insect arthropods, there is evidence for a role for eve in both posterior identity and segmentation. The centipede Lithobius atkinsoni expresses eve in a posterior domain and between segments (Hughes and Kaufman, 2002), and the crustacean Artemia franciscana exhibits growth zone eve expression that precedes expression in stripes in emerging segments (Copf et al., 2003). In other basal arthropods, like spiders (Damen et al., 2000) and the centipede Strigamia maritima (Chipman and Akam, 2008), eve expression in stripes suggests that its ancestral role is segmental.

Mitotic domains are coordinated with pair-rule gene expression

The broad stripe 6 domain of eve appears to be subdivided by transcription control, likely through interactions with Nv odd and Nv runt (Figure 6, Figure 6—figure supplement 1). Although we observed apparent mitotic domains in the early gastrula that proceed from anterior to posterior, they do not match the pattern of initial differentiation of germ band-derived segments or the splitting of anterior pair-rule stripes. Cell division patterns in mitotic domains have not been described in most insects, apart from Drosophila and the precellular blastoderm of Bombyx (order: Lepidoptera; Nagy et al., 1994). In the short germ Tribolium and Oncopeltus embryos, cell divisions during gastrulation and elongation occur throughout the germ band, with no evidence for mitotic domains (Brown et al., 1994; Liu and Kaufman, 2009). The relationship between n class="Species">Nv eve and cell division suggests coordination of cell divisions by segmentation genes, a phenomenon that has been suggested for Drosophila (Foe, 1989; Edgar and O’Farrell, 1989; Bianchi-Frias et al., 2004). Use of coordinated mitotic domains is a strategy that seems to have evolved multiple times (e.g., in flies and wasps). We propose that the apparent coordination of mitotic domains and segmentation gene expression of both Nasonia and Drosophila development may constitute a step in the transition to long germ embryogenesis.

Conclusion

In summary, despite obvious differences in their expression patterns, Nasonia eve, odd, and hairy function in both blastoderm- and germ band-derived segment formation. While Nasonia exhibits fly-type expression of maternal and gap genes in the precellular blastoderm, dynamic expression patterns and extensive interactions among ‘pair-rule’ genes appear to pattern a suite of late forming posterior segments. Indeed, their relative expression patterns suggest that the regulation of posterior segments may be through the type of mutual regulation described for the pair-rule gene circuit of Tribolium. This is unlike the long germ embryo of Drosophila, whose segmentation utilizes pair-rule interactions only during the late blastoderm stage. We propose that late-forming segments are set aside using remnants of ancestral control of posteriorness and the segmentation clock. Thus, Nasonia relies on a dynamic, dual mode of segmentation that has characteristics of both ancestral short germ and derived long germ embryogenesis.

Materials and methods

Embryo collection, non-fluorescent in situ hybridization, two-color FISH, and immunohisochemistry

Nasonia embryos were collected and fixed in 5% n class="Chemical">formaldehyde/1X PBS/Heptane for 28 min, affixed to double-sided tape, and hand peeled under 1X PBS +0.1% tween, as described previously (Pultz et al., 2005), except that the embryos were collected from host-fed, mated females. The embryos were stored under methanol at −20°C between fixation and hybridization. In situ hybridizations were carried out as described previously (Pultz et al., 2005). Briefly, the embryos stored under methanol were gradually brought up to 1X PBT and washed three times in 1x PBS +0.1% tween-20 (PBT) before a 30-min post-fix step in 5% formaldehyde/1XPBT. The embryos were then washed three times and subjected to proteinase K treatment (final concentration of 4 μg/ml) before three PBT washes. The embryos were blocked for 1 hr in hybridization buffer before probe preparation and addition for overnight incubation at 65°C. The next day, the embryos were washed in formamide wash buffer and then 1X MABT buffer before blocking in 2% Blocking Reagent (BBR; Roche Applied Science, Germany) in 1X MABT for 1 hr, then in 10% horse serum/2% BBR/1XMABT for 2 hr. The embryos were incubated overnight with primary antibody in the second blocking solution at 4°C. Anti-DIG-AP Fab fragments (Roche Diagnostics) were used at 1:2000 for non-fluorescent in situs. On the third day, the embryos were washed in 1X MABT for ten, 20 min washes before equilibrating the embryos in AP staining buffer and developing in AP buffer with NBT/BCIP solution (Roche Diagnostics). After staining, the embryos were washed in 1× PBT three times for 5 min each before a single 25 min post-fix step in 5% formaldehyde/1XPBT. The embryos were then washed briefly and allowed to sink in 50% and then 70% glycerol/1XPBS, which were subsequently used for mounting. For fluorescent in situs, DIG probes were detected using anti-DIG-POD Fab fragments (Roche Diagnostics) at 1:50 dilution, followed by FastRed HNPP detection system (Roche Diagnostics), according to manufacturer’s instructions. Fluorescein probes were detected using anti-Fluorescein-AP Fab fragments (Roche Diagnostics) at 1:500 dilution. For antibody staining of mitotic cells, we used a rabbit anti-phosphorylated histone H3 serine 10 antibody (Millipore, Billerica, Massachusetts) at 1:200, and then a donkey anti-rabbit secondary conjugated to Alexa-647 (Invitrogen, Carlsbad, California) at 1:200. In combination with FastRed in situ detection using anti-DIG-AP Fab fragments (Roche Diagnostics) at 1:500, primary antibodies were added to blocking buffer together and incubated according to the in situ protocol, and secondary antibody detection was carried out after the FastRed staining was completed and following three 1X PBT washes.

Cloning of Nasonia pair-rule gene cDNA fragments

Nasonia pair-rule gene cDNAs were cloned from embryo cDNA pools generated from reverse transcription of total embryo RNA from mixed age embryos using Superscript First Strand Synthesis kit (with Superscript II; Invitrogen) according to manufacturer’s specifications. For cases in which long cDNA sequences could not be amplified with oligos designed according to automated genome annotation and prediction models, we used circular RACE to simultaneously amplify sequences 5′ and 3′ to smaller cloned cDNA fragments, as previously described (McGrath, 2011).

Phylogenetic analysis of Nasonia pair-rule gene paralogs

Nasonia paralogs of fly pair-rule genes were identified by TBLASTN and aligned against predicted or experimentally validated (virtually translated) protein sequences of the same proteins from Tribolium castaneum (Tcas), Anopheles gambiae (Agam), Apis mellifera (Amel). Protein sequences were aligned using CLUSTALW (Larkin et al., 2007) and rendered using Dendroscope (Huson et al., 2007). Evolutionary relationships were inferred using a maximum likelihood analysis with 1000-fold bootstrap support, via RaXML hosted online at CIPRES science gateway (http://www.phylo.org/index.php/portal/) (Stamatakis et al., 2008; Stamatakis, 2006; Miller et al., 2010).

Morpholino injection and larval cuticle preparations

Antisense morpholinos targeting splice junctions or transcription initiation sites were designed and ordered from GeneTools, LLC (www.gene-tools.com, Philomath, Oregon). Lyophilized morpholinos were resuspended in sterile nuclease-free water to a final concentration of 5 mM. For Nv odd splice block morpholino, which yielded a high percentage of dead embryos with no cuticle, injections were also carried out at 1 mM, 0.5 mM, and 0.05 mM dilutions. Nasonia embryos were collected for 35 min at 28°C and dehydrated for 30 min before injection with morpholinos (approximate volume injected = 0.001 μl per embryo). The embryos were allowed to develop on the injection membrane at 28°C on a 1X PBS/1% agarose plate for approximately 30 hr, to ensure complete development. Unhatched larvae were peeled and transferred to a slide for cuticle preparations in Lacto–Hoyer’s media. Morpholino sequences used are as follows: Eve translation block 5′ CAAAGCTCCTCTGGAATCCTTGCAT 3′ Eve E2I2 splice block: 5′ AAACGATAGTTACCTTGATGGTCGA 3′ Hairy E2I2 splice block: 5′ CTGAATCTGTCAAGATACTTACGTC 3′ Hairy E1I1 splice block: 5′ GAGCAAGTCGAGATACTAACCCGTC Odd splice block: 5′ AGAGAGTGTACTAAC TTGTGGTCCC 3′ Odd translation block: 5′ GCTCCATCGCAAGCTGGGTAAACGT 3′

cDNA sequence accession numbers

Nv n class="Gene">odd cDNA GenBank Accession # KC142194 Nv n class="Gene">eve cDNA, isoform 1 GenBank Accession# KC168090 Nv n class="Gene">eve cDNA, isoform 2 GenBank Accession# KC168091 Nv n class="Gene">eve cDNA, isoform 3 GenBank Accession# KC168092 Nv n class="Gene">hairy cDNA GenBank Accession # KC190514 Accession numbers for sequences used in sequence alignments and trees: NvitH1: NP_001267498 XP_001601817 (n class="Species">Nvit Hairy) NvitH2: Uniprot K7J0X7_NASVI (n class="Gene">hairy-like/Nvit Dpn) NvitH3: XP_001601600.2 GI:345484850 (n class="Gene">hairy-like/HES like?) DmelH: NP_523977.2 GI:24661088 (Dmel hairy) DmelDpn: NP_476923.1 GI:17136808 (n class="Chemical">Dmel deadpan) AmelH1: XP_001120814.2 GI:328784100 (hypothetical protein) AmelH2: XP_393948.3 GI:110762302 (n class="Gene">hairy-like) AgambH1: XP_316733.3 GI:158296333 (corrected seq; n class="Species">Agam hairy) AgambH2: XP_320206.4 GI:158300226 TcasH1: NP_001107765.1 GI:166796106 (Tcas Hairy) TcasH2: XP_967694.1 GI:91092620 (Tcas similar to GA21268-PA) TcasH3: XP_975187.1 GI:91083981 (Tcas HES1) DmelOddsk: NP_722922.1 GI:24581484 (Dmel n class="Gene">Odd skipped) DmelSobow: NP_476882.1 GI:17136746 (Dmel Sister of odd and bowl) DmelBowl: NP_476883.1 GI:17136748 (Dmel Brother of odd with entrails limited) Nvitn class="Gene">OddbowlA: XP_001603713.1 GI:156545195 (predicted protein) Nvitn class="Gene">OddbowlB: XP_001603827.2 GI:345481739(Nv bowel-like) Nvitn class="Gene">OddbowlC: XP_001603660.1 GI:156545193(Nv odd-skipped like) Ameln class="Gene">OddbowlA: XP_001120949.1 GI:110762343(Amel odd-skipped like) Ameln class="Gene">OddbowlB: XP_393879.3 GI:110762378(Amel bowel-like) Ameln class="Gene">OddbowlC: XP_001120905.1 GI:110762341 TcasBowl: XP_972138.2 GI:189240088(Tcas bowl-like) TcasOdd: XP_972086.2 GI:189240086 (Tcas n class="Gene">odd-skipped) TcasSob: XP_972035.1 GI:91088523(Tcas: predicted sister of odd and bowl) Agam7972_PA: XP_306979.3 GI:118776890 Agam7973_PA: XP_317495.3 GI:118789549 Agam8222: XP_555242.1 GI:57914799 For Figure 4, the phenotypic classes are approximately as follows: Eve: B 20.4% C 24% D 30.1% E 25%. Odd: G 27.7% H 22.3% I 29.2% J 20.8%. Hairy: L 13.4% M 25.0% N 36.6% O 25.0%. eLife posts the editorial decision letter and author response on a selection of the published articles (subject to the approval of the authors). An edited version of the letter sent to the authors after peer review is shown, indicating the substantive concerns or comments; minor concerns are not usually shown. Reviewers have the opportunity to discuss the decision before the letter is sent (see review process). Similarly, the author response typically shows only responses to the major concerns raised by the reviewers. Thank you for sending your work entitled “Dual mode of embryonic development is highlighted by expression and function of Nasonia pair-rule genes” for consideration at eLife. Your article has been favorably evaluated by a Senior editor and 2 reviewers, one of whom, Duojia Pan, is a member of our Board of Reviewing Editors. The Reviewing editor and the other reviewer discussed their comments before we reached this decision, and the Reviewing editor has assembled the following comments to help you prepare a revised submission. Rosenberg et al. describe the expression patterns and phenotypes that result from knocking down several pair-rule genes in the wasp Nasonia. Previous studies, focused mostly on maternal and gap genes, had suggested that Nasonia uses a long-germ mode of embryogenesis, which evolved independently of long-germ development in flies. The results presented here lead the authors to re-evaluate that premise: pair-rule expression and phenotypes in Nasonia suggest both a 'long-germ' mode of action in anterior segments (patterning by subdivision in a syncytial blastoderm) and a 'short-germ' mode in posterior segments (sequential patterning in a cellularized environment, coupled with posterior elongation). The data are of excellent quality and largely support this interesting conclusion. The reviewers suggested several major points for improvement: 1) The paper contains a number of imprecise statements that should be corrected by careful editing of the manuscript. On several occasions the authors refer to cross-regulatory interactions among the pair-rule genes, based entirely on expression patterns (e.g., several points in the Discussion section). I think that is a weak basis for proposing such interactions. I recommend testing these hypotheses by combining morpholino treatments with the relevant in situs. Alternatively, the authors should make it clear that the proposed interactions are hypothetical. The remaining suggestions are highlighted in the minor comments below. 2) The reviewers recommend separating, where possible, the description of data from the interpretations and the discussion that derives from it. Currently, much of the discussion is scattered within the Results section; in the Discussion the authors reiterate many of the same points. Minor comments: 1) Introduction, 2nd paragraph: I am not aware of evidence suggesting that odd controls the oscillations, rather than being a read-out? 2) Introduction, 2nd paragraph: Whether the common ancestors of bilaterians was segmented is still controversial. 3) When describing the cuticular phenotypes induced by morpholinos (Figure 4 and Results section), it is not always clear how the authors identify which of the segments are missing or affected? Are there distinctive cuticular features that identify each segment? These should be described. 4) Section entitled ‘Nasonia n class="Gene">runt expression’: “Altogether, our data support a model in which Nv eve segmental stripes are established through the complementary action of Nv odd for odd numbered segmental stripes and Nv runt for even-numbered segmental stripes, as summarized in Figure 8.” It is not clear how the data presented justify this statement. The authors could combine morpholino treatments with eve stainings to test that hypothesis. 5) Section entitled ‘Expression and knockdown of Nasonia eve, hairy and odd’, last paragraph: It is difficult to understand what these sentences mean. How is a clock-like mechanism compatible with long-germ embryogenesis? 6) Section entitled ‘An ancestral role for eve in specifying posterior identity may be linked to growth zone behavior in short germ insects’: “In Schistocerca, eve is expressed in a posterior mesodermal domain and pair-rule stripes arise from this region, indicating that eve plays a role in posteriorness and not segmentation in basal insects.” Eve is expressed in segmental patterns in spiders, myriapods and crustaceans, suggesting that the data from n class="Species">Schistocerca are not representative of the ancestral state. 7) 'Segmental' and 'pair-rule' stripes could be renamed stripes with single- and double-segment periodicity, for clarity, especially since pair-rule genes are sometimes expressed in stripes that have single-segment periodicity. 8) The authors point out the lack of 'segmental' stripes of odd (meaning stripes with single-segment periodicity). Have they checked whether one of the other paralogues of odd is expressed in the 'missing' stripes? 9) It would be useful if the authors could indicate the frequency of each phenotypic class in Figures 2 and 4. 10) It would be useful to know the identity of sequences (conventional gene names and, ideally, accession numbers) in the Figures showing sequence alignments and trees. For example, do the hairy-related genes included in the analysis include E(spl) orthologues? 11) Are the phylogenetic trees based on the entire aligned sequence, or on specific sequence blocks (domains) that could be aligned reliably? 12) Given the interest in comparing the arthropod and vertebrate segmentation clocks, the authors could comment on the absence of hairy oscillations in the Discussion. Have they looked at the expression of E(spl) orthologues? 13) First paragraph of Discussion: The authors reiterate the view that Nasonia develops using a long-germ mode, when in fact their paper argues that this is not the case (next paragraph). It would be interesting if the authors could step back and discuss in more general terms what their data suggests in terms of short- and long-germ mechanisms (see reviews by Davis and Patel, Ann Rev Entomol 2002, and Peel and Akam, Curr Biol 2003). 14) Section entitled ‘An ancestral role for eve in specifying posterior identity may be linked to growth zone behavior in short germ insects’: The concept of “posteriorness” is vague and should be explained. 15) The formation of posterior segments seems to be accompanied by a mild elongation the posterior part of embryo. This is another hallmark of short-germ development, which the authors could discuss. 16) Wilson and Dearden described the expression patterns and phenotypes for some of the same pair-rule genes in another hymenopteran, the n class="Species">honeybee. In the Discussion, it would be useful if the authors briefly compared the results from the honeybee with those from Nasonia. 1) The paper contains a number of imprecise statements that should be corrected by careful editing of the manuscript. On several occasions the authors refer to cross-regulatory interactions among the pair-rule genes, based entirely on expression patterns (e.g., several points in the Discussion section). I think that is a weak basis for proposing such interactions. I recommend testing these hypotheses by combining morpholino treatments with the relevant in situs. Alternatively, the authors should make it clear that the proposed interactions are hypothetical. The remaining suggestions are highlighted in the minor comments below. We agree that the best experiments would be morpholino knockdown of each gene followed by in situ for each of the others, to really delineate the cross interactions that we propose. However, these experiments faced insurmountable technical limitations, and it was not possible to perform these studies. We have now made it more clear in the text that the proposed interactions represent a model that is hypothetical and based only on the suggestive expression patterns that we describe. 2) The reviewers recommend separating, where possible, the description of data from the interpretations and the discussion that derives from it. Currently, much of the discussion is scattered within the Results section; in the Discussion the authors reiterate many of the same points. We have removed discussion from the Results section where possible (although in several places, we found it more appropriate to comment briefly on a result that will not be part of a general discussion), and have tried to ensure that there is no redundancy between the Results and Discussion. The Discussion is now shorter and smoother. Minor comments: 1) Introduction, 2nd paragraph: I am not aware of evidence suggesting that odd controls the oscillations, rather than being a read-out? We agree that the wording of our description of odd-skipped oscillations in Tribolium was not clear. This has been corrected and we now indicate that the expression of odd is indeed oscillating, but that the control of these oscillations is still not understood. 2) Introduction, 2nd paragraph: Whether the common ancestors of bilaterians was segmented is still controversial. We are now more cautious and have added a reference to an excellent review discussing the competing models about the origin of segmentation, since it is difficult to concisely present these models in this context of the manuscript. 3) When describing the cuticular phenotypes induced by morpholinos ( and Results section), it is not always clear how the authors identify which of the segments are missing or affected? Are there distinctive cuticular features that identify each segment? These should be described. There are significant landmarks on the Nasonia cuticle that give clear indications of anterior segment identity. Spiracles are easy to detect on T2, A1, A2 and A3 and their position and order on critical segments allow most of the time their identification. Our interpretation of the phenotypes is based on the phenotypic series that we obtain through morpholino knockdown; we can often observe the reduction of structures or segments stepwise in this fashion. However, there are sometimes ambiguities. We now describe these landmarks in the text. 4) Section entitled ‘Nasonia n class="Gene">runt expression’: “Altogether, our data support a model in which Nv eve segmental stripes are established through the complementary action of Nv odd for odd numbered segmental stripes and Nv runt for even-numbered segmental stripes, as summarized in .” It is not clear how the data presented justify this statement. The authors could combine morpholino treatments with eve stainings to test that hypothesis. We are unable to carry out this experiment with the very small number of injected embryos that are both non-uniformly developmentally delayed by the injection and also cannot be reliably recovered for subsequent staining without losing their structure. We have added a qualifying statement to indicate that this model is still theoretical. 5) Section entitled ‘Expression and knockdown of Nasonia eve, hairy and odd’, last paragraph: It is difficult to understand what these sentences mean. How is a clock-like mechanism compatible with long-germ embryogenesis? It is difficult to imagine a clock-like mechanism as co-existing with an extreme long-germ insect, like Drosophila, where there is very little (or no) material that remains to be patterned/segmented after gastrulation. However, only Drosophila fits with a very restrictive definition of long germ. Insect embryogenesis comprises a spectrum of short-germ to long-germ, and, although insects like Nasonia and Apis can be called long germ, they are less completely so than Drosophila, indicating that these two mechanisms do appear to co-exist, which is the major conclusion of our paper. It seems reasonable to imagine that evolution sampled more derived, long-germ embryogenesis types (with more of the germ segmented before cellularization) multiple times, while still relying on the ancestral mechanisms of segment patterning to deal with the remaining late-forming segments, even as the number of remaining segments varied. These two mechanisms would have had to co-exist at some point in the transition from the most extreme short germ embryo to the most extreme long-germ embryo. Our interpretation is that embryos like Nasonia represent a snapshot of that transition. 6) Section entitled ‘An ancestral role for eve in specifying posterior identity may be linked to growth zone behavior in short germ insects’: “In Schistocerca, eve is expressed in a posterior mesodermal domain and pair-rule stripes arise from this region, indicating that eve plays a role in posteriorness and not segmentation in basal insects.” Eve is expressed in segmental patterns in spiders, myriapods and crustaceans, suggesting that the data from n class="Species">Schistocerca are not representative of the ancestral state. A discussion of this point has been added to the text. While it is certainly true that several other arthropods express eve in segmental stripes, it is also true that other organisms, including vertebrates, have a posterior domain of eve expression like Nasonia. We discuss both of these points now in the text and leave open any conclusion about which is the ancestral state. 7) 'Segmental' and 'pair-rule' stripes could be renamed stripes with single- and double-segment periodicity, for clarity, especially since pair-rule genes are sometimes expressed in stripes that have single-segment periodicity. We had struggled with this and clearly the reviewers also noted this. We have changed the name of the stripes to double-segment and single-segment throughout the descriptions of each gene. 8) The authors point out the lack of 'segmental' stripes of odd (meaning stripes with single-segment periodicity). Have they checked whether one of the other paralogues of odd is expressed in the 'missing' stripes? We attempted to amplify and clone each of the three odd paralogs from Nasonia cDNA to look at this, using cDNA from staged animals (embryo, larva, adult). We were able to clone only the one described in the paper from embryo cDNA and one other (“oddbowl A” in the tree) from adult cDNA. The third was either expressed at levels too low to efficiently amplified, or may not be expressed. The expression of oddbowl A was not tested systematically in embryos, though a small-scale experiment revealed no embryonic expression. 9) It would be useful if the authors could indicate the frequency of each phenotypic class in . Figure 2 does not show phenotypic classes but representative stainings of embryos at different stages of development. The pRNAi experiments with gap genes have been extensively described in several previous publications (Pultz et al., 1999, 2005; Olesnicky et al., 2006, Brent et al., 2007). We now describe the frequency of the different phenotypic classes presented in Figure 4 obtained with morpholinos, which are approximately as follows: These values also now appear in the Materials and methods section of the paper. 10) It would be useful to know the identity of sequences (conventional gene names and, ideally, accession numbers) in the Figures showing sequence alignments and trees. For example, do the hairy-related genes included in the analysis include E(spl) orthologues? The hairy-related genes include one possible E(spl) ortholog. The accession numbers for the sequences used in the alignments and trees are now given in the Materials and methods. Sequences in the hairy group have been updated, including longer sequences that have been released, in the database since the original submission, and their accession numbers are provided. The resulting alignment and tree now replace the original figures – the assignment of Nvit H1 as the true Nasonia hairy is unaffected. 11) Are the phylogenetic trees based on the entire aligned sequence, or on specific sequence blocks (domains) that could be aligned reliably? The phylogenetic trees were based on the entire aligned sequence; this is now mentioned in the figure legend. 12) Given the interest in comparing the arthropod and vertebrate segmentation clocks, the authors could comment on the absence of hairy oscillations in the Discussion. Have they looked at the expression of E(spl) orthologues? We have not looked at the expression of E(spl) orthologues in Nasonia. We have added a brief comparison of arthropod and vertebrate clocks in the Discussion. 13) First paragraph of Discussion: The authors reiterate the view that Nasonia develops using a long-germ mode, when in fact their paper argues that this is not the case (next paragraph). It would be interesting if the authors could step back and discuss in more general terms what their data suggests in terms of short- and long-germ mechanisms (see reviews by Davis and Patel, Ann Rev Entomol 2002, and Peel and Akam, Curr Biol 2003). As discussed above, insects like Nasonia and Apis whose embryogenesis comprises a spectrum of short-germ to long-germ can be called long germ, though they are less completely so than Drosophila (which appears to be the only species that fulfill the strict definition of long germ). We agree with the reviewers that our work demonstrates that, unlike what we previously believed, Nasonia is not a strict long germ, indicating that these two mechanisms do appear to co-exist, which is the major conclusion of our paper. It seems reasonable to imagine that evolution sampled more derived, long-germ embryogenesis types (with more of the germ segmented before cellularization) multiple times, while still relying on the ancestral mechanisms of segment patterning to deal with the remaining late-forming segments, even as the number of remaining segments varied. These two mechanisms would have had to co-exist at some point in the transition from the most extreme short germ embryo to the most extreme long-germ embryo. Our interpretation is that embryos like Nasonia represent a snapshot of that transition. 14) Section entitled ‘An ancestral role for eve in specifying posterior identity may be linked to growth zone behavior in short germ insects’: The concept of “posteriorness” is vague and should be explained. This concept, though vague, has been raised previously in the literature (see e.g., Ahringer J, Genes Dev 1996; Brown SJ et al., Mech Dev 1997). The significance of the posterior expression domains of eve in Nasonia and other arthropods is still not entirely clear, but it remains a possibility that it is in some way distinct from its expression in stripes and function in segmentation. The fact that its expression delineates a posterior growth zone in animals whose posterior segmentation occurs post-embryonically (e.g., Platynereis-de Rosa et al., Evolution and Development 2005) suggests that its ability to delineate a region of growth or patterning can be achieved independently of its striped expression and function (and that it may be an ancient feature). We wanted only to highlight that feature and with it, the possibility that it provides some additional, more general identity/information in the embryo posterior, though this explanation and characterization are still vague. 15) The formation of posterior segments seems to be accompanied by a mild elongation the posterior part of embryo. This is another hallmark of short-germ development, which the authors could discuss. We didn’t emphasize the mild elongation of the posterior part of the embryo, since compared to the significant posterior growth in more short-germ insects, this elongation is modest in Nasonia. It is also difficult to distinguish what may be modest elongation in a short-germ sense vs simply the elongated appearance of a germband elongated (and retracted) embryo. We don’t feel that the data are sufficient to support further discussion. 16) Wilson and Dearden described the expression patterns and phenotypes for some of the same pair-rule genes in another hymenopteran, the n class="Species">honeybee. In the Discussion, it would be useful if the authors briefly compared the results from the honeybee with those from Nasonia. An additional comparison of Nasonia pair rule genes to those of Apis has been added in the second paragraph of the Discussion.
Eve:B 20.4%C 24%D 30.1%E 25%
Odd:G 27.7%H 22.3%I 29.2%J 20.8%
Hairy:L 13.4%M 25.0%N 36.6%O 25.0%
  83 in total

Review 1.  The origin and evolution of segmentation.

Authors:  G K Davis; N H Patel
Journal:  Trends Cell Biol       Date:  1999-12       Impact factor: 20.808

Review 2.  Coupling segmentation to axis formation.

Authors:  Julien Dubrulle; Olivier Pourquié
Journal:  Development       Date:  2004-12       Impact factor: 6.868

3.  The murine even-skipped-like gene Evx-2 is closely linked to the Hox-4 complex, but is transcribed in the opposite direction.

Authors:  H Bastian; P Gruss; D Duboule; J C Izpisúa-Belmonte
Journal:  Mamm Genome       Date:  1992       Impact factor: 2.957

4.  RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models.

Authors:  Alexandros Stamatakis
Journal:  Bioinformatics       Date:  2006-08-23       Impact factor: 6.937

Review 5.  The initiation of pair-rule stripes in the Drosophila blastoderm.

Authors:  S Small; M Levine
Journal:  Curr Opin Genet Dev       Date:  1991-08       Impact factor: 5.578

6.  even-skipped has gap-like, pair-rule-like, and segmental functions in the cricket Gryllus bimaculatus, a basal, intermediate germ insect (Orthoptera).

Authors:  Taro Mito; Chiharu Kobayashi; Isao Sarashina; Hongjie Zhang; Wakako Shinahara; Katsuyuki Miyawaki; Yohei Shinmyo; Hideyo Ohuchi; Sumihare Noji
Journal:  Dev Biol       Date:  2006-11-10       Impact factor: 3.582

Review 7.  Arthropod segmentation: beyond the Drosophila paradigm.

Authors:  Andrew D Peel; Ariel D Chipman; Michael Akam
Journal:  Nat Rev Genet       Date:  2005-12       Impact factor: 53.242

8.  Kruppel is a gap gene in the intermediate germband insect Oncopeltus fasciatus and is required for development of both blastoderm and germband-derived segments.

Authors:  Paul Z Liu; Thomas C Kaufman
Journal:  Development       Date:  2004-09       Impact factor: 6.868

9.  The role of the segmentation gene hairy in Tribolium.

Authors:  Manuel Aranda; Henrique Marques-Souza; Till Bayer; Diethard Tautz
Journal:  Dev Genes Evol       Date:  2008-08-05       Impact factor: 0.900

10.  Analysis of the Tribolium homeotic complex: insights into mechanisms constraining insect Hox clusters.

Authors:  Teresa D Shippy; Matthew Ronshaugen; Jessica Cande; Jianping He; Richard W Beeman; Michael Levine; Susan J Brown; Robin E Denell
Journal:  Dev Genes Evol       Date:  2008-04-08       Impact factor: 0.900

View more
  27 in total

1.  Conservation and variation in pair-rule gene expression and function in the intermediate-germ beetle Dermestes maculatus.

Authors:  Jie Xiang; Katie Reding; Alison Heffer; Leslie Pick
Journal:  Development       Date:  2017-10-30       Impact factor: 6.868

2.  Rearing and Double-stranded RNA-mediated Gene Knockdown in the Hide Beetle, Dermestes maculatus.

Authors:  Jie Xiang; Katie Reding; Leslie Pick
Journal:  J Vis Exp       Date:  2016-12-28       Impact factor: 1.355

3.  The mlpt/Ubr3/Svb module comprises an ancient developmental switch for embryonic patterning.

Authors:  Suparna Ray; Miriam I Rosenberg; Hélène Chanut-Delalande; Amélie Decaras; Barbara Schwertner; William Toubiana; Tzach Auman; Irene Schnellhammer; Matthias Teuscher; Philippe Valenti; Abderrahman Khila; Martin Klingler; François Payre
Journal:  Elife       Date:  2019-03-21       Impact factor: 8.140

4.  Shifting roles of Drosophila pair-rule gene orthologs: segmental expression and function in the milkweed bug Oncopeltus fasciatus.

Authors:  Katie Reding; Mengyao Chen; Yong Lu; Alys M Cheatle Jarvela; Leslie Pick
Journal:  Development       Date:  2019-09-10       Impact factor: 6.868

5.  Odd-paired controls frequency doubling in Drosophila segmentation by altering the pair-rule gene regulatory network.

Authors:  Erik Clark; Michael Akam
Journal:  Elife       Date:  2016-08-15       Impact factor: 8.140

Review 6.  The expanding genetic toolbox of the wasp Nasonia vitripennis and its relatives.

Authors:  Jeremy A Lynch
Journal:  Genetics       Date:  2015-04       Impact factor: 4.562

7.  Speed regulation of genetic cascades allows for evolvability in the body plan specification of insects.

Authors:  Xin Zhu; Heike Rudolf; Lucas Healey; Paul François; Susan J Brown; Martin Klingler; Ezzat El-Sherif
Journal:  Proc Natl Acad Sci U S A       Date:  2017-09-25       Impact factor: 11.205

8.  Dissection of the complex genetic basis of craniofacial anomalies using haploid genetics and interspecies hybrids in Nasonia wasps.

Authors:  John H Werren; Lorna B Cohen; Juergen Gadau; Rita Ponce; Emmanuelle Baudry; Jeremy A Lynch
Journal:  Dev Biol       Date:  2015-12-23       Impact factor: 3.582

9.  Anterior-posterior patterning of segments in Anopheles stephensi offers insights into the transition from sequential to simultaneous segmentation in holometabolous insects.

Authors:  Alys M Cheatle Jarvela; Catherine S Trelstad; Leslie Pick
Journal:  J Exp Zool B Mol Dev Evol       Date:  2021-11-03       Impact factor: 2.368

10.  smiFISH and embryo segmentation for single-cell multi-gene RNA quantification in arthropods.

Authors:  Llilians Calvo; Tom Pettini; Matthew Ronshaugen
Journal:  Commun Biol       Date:  2021-03-19
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.