Literature DB >> 24505419

Characterization of new polyol/H+ symporters in Debaryomyces hansenii.

Iliana Pereira1, Ana Madeira2, Catarina Prista1, Maria C Loureiro-Dias1, Maria José Leandro1.   

Abstract

Debaryomyces hansenii is a halotolerant yeast that produces and assimilates a wide variety of polyols. In this work we evaluate polyol transport in D. hansenii CBS 767, detecting the occurrence of polyol/H(+) (and sugar/H(+)) symporter activity, through the transient extracellular alkalinization of unbuffered starved cell suspensions. From the D. hansenii genome database, we selected nine ORFs encoding putative transporter proteins to clone in a centromeric plasmid with C-terminal GFP tagging and screened for polyol/H(+) symporters by heterologous expression in Saccharomyces cerevisiae. Five distinct D. hansenii polyol/H(+) symporters were identified and characterized, with different specificities and affinities for polyols, namely one glycerol-specific (DhStl1), one D-galactitol-specific (DhSgl1, Symporter galactitol/H(+) 1), one D-(+)-chiro-inositol-specific (DhSyi1, Symporter D-(+)-chiro-inositol/H(+) 1), one for D-sorbitol/D-mannitol/ribitol/D-arabitol/D-galactitol (DhSyl1, Symporter Polyols 1) and another for D-sorbitol/D-mannitol/ribitol/D-arabitol (DhSyl2, Symporter Polyols 2). This work contributed to the annotation of new yeast polyol transporters, including two specific for uncommon substrates as galactitol and D-(+)-chiro-inositol.

Entities:  

Mesh:

Substances:

Year:  2014        PMID: 24505419      PMCID: PMC3913770          DOI: 10.1371/journal.pone.0088180

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

In response to salt- and drought-stress, fungi, marine algae and vascular plants can synthesize and accumulate soluble compounds with low molecular weight. These compounds are designated as compatible solutes because they are compatible with cell metabolism, even when they accumulate at high intracellular concentrations. Compatible solutes include sugar alcohols, quaternary ammonia compounds, proline and tertiary sulfonic compounds. Sugar alcohols or polyols (such as glycerol, mannitol and sorbitol) correspond to the chemically reduced form of an aldose or a ketose. Being more reduced, polyols are higher energy storage molecules than their corresponding sugars (e.g. mannitol versus mannose). It has been suggested that polyols may mimic the structure of water and maintain an artificial sphere of hydration around macromolecules. They may also act as scavengers of reactive oxygen species, thereby preventing peroxidation of lipids that would cause cell damage [1]. Polyols have several applications in the food, pharmaceutical, medical and chemical industries, as food additives, texturizing agents, low-caloric sweeteners, pharmaceutical formulating agents, in the manufacture of intravenous fluids and precursors of many synthetic polymers and resins [2]–[7]. Industrial production of most polyols is performed by catalytic reduction of sugars with hydrogen gas and nickel at high temperature and pressure, what requires highly pure sugar substrates and costly chromatographic purification steps. Lately, processes using bacteria (specially lactic acid bacteria) and yeasts have demonstrated that biotechnological production may represent an efficient and cost-effective alternative to the chemical production of polyols [8]. The polyols most frequently found in plants are the derivatives of glucose (sorbitol) and mannose (mannitol). The first plant polyol transporter characterized at the molecular level was the mannitol/H+ symporter AgMaT1 from celery (that also seems to transport xylitol and sorbitol) [9]. Since then, several other polyol transporters have been characterized in plants, such as the broad-spectrum H+-symporter AtPlt5 (AtPmt5) from Arabidopsis thaliana (that besides linear polyols, as sorbitol, xylitol, erythritol and glycerol, also transports myo-inositol and different hexoses and pentoses, including ribose) [10], the HbPlt2 xylitol/H+ symporter (that also seems to transport the cyclic polyol quebrachitol) from rubber tree [11] and the specific xylitol/H+ symporter LjPlt4 from the model legume Lotus japonicus [12]. These polyol transporters are members of the Sugar Porter Family of the Major Facilitator Superfamily (MFS) [13], although they are not closely related to known sucrose and hexose transporters [14]. As most MFS proteins, polyol transporters are integral membrane proteins with 12 membrane-spanning domains and the consensus sequences of the Sugar Porter Family [15] are also generally conserved in polyol transporters [12], [14]. Biochemical characterization of polyol transport and metabolism in yeasts has been poorly studied so far. However, the ability of yeasts to use (or not to use) polyols as carbon source has been always used by taxonomists to characterize yeast species, showing that polyols are indeed important yeast substrates. Using taxonomical data [16], we analized the ability to assimilate polyols of 464 ascomycete and 216 basidiomycete yeast species. The main outcome of this analysis is that most yeasts assimilate at least one polyol. Ascomycete yeasts assimilate preferably glycerol, then sorbitol and mannitol, whereas in basidiomycete yeasts the order of preference is mannitol, sorbitol and glycerol (Table 1). It is remarkable that more than 10% of all the species under analysis can assimilate the four polyols arabitol, ribitol, sorbitol and xylitol.
Table 1

Prevalence of polyol assimilation by yeasts (based on [16]).

Polyols% Ascomycetes% Basidiomycetes
Glycerol73.654.8
D-Sorbitol66.177.4
D-Mannitol65.685.2
D-Xylitol39.333.6
Ribitol37.646.5
meso-Erythritol23.327.6
L-Arabitol19.421.6
D-Galactitol6.321.2
myo-Inositol6.038.7
The existence of polyol transporters was detected in several yeasts. In Rhodotorula glutinis a constitutive active transport system for pentitols and erythritol, and another carrier for ribitol and L-arabitol were reported [17], [18]. In Candida intermedia it was shown that sorbitol was transported by a high affinity (Km = 6 mM) polyol/H+ symporter, which accepted also xylitol, D-arabitol and D-mannitol, but not glucose. In this yeast, sorbitol was also transported by a glucose/H+ symporter. In this case the affinity for sorbitol was lower (Km = 200 mM) and the transport was inhibited by glucose and other hexoses [19]. myo-Inositol transport was also characterized in C. albicans as a proton transporter system [20]. So far, only glycerol and myo-inositol transporters have been characterized at the molecular level in yeasts. The Stl1 glycerol/H+ symporter was first characterized in Saccharomyces cerevisiae [21]. This transporter was also described in C. albicans [22] and detected in several yeasts as Debaryomyces hansenii and Zygosaccharomyces rouxii [23], [24]. Two myo-inositol transporters were described in S. cerevisiae, Itr1 (the major permease for myo-inositol) and Itr2 [25]. In Schizosaccharomyces pombe the genes involved in inositol transport (ITR1 and ITR2) are required for mating and sporulation [26]. D. hansenii is a halotolerant yeast usually found in salty environments, such as the sea and salted food. This yeast is capable of accumulating sodium without being intoxicated even when potassium is present at low concentration in the environment, and sodium improves D. hansenii growth [27] and protects this yeast in the presence of additional stress factors such as high temperature and extreme pH [28]. D. hansenii is also a polyol producing yeast that can have a potential use for increasing value of lignocellulosic hydrolysates by xylitol [29] and arabitol production [30]. The availability of the genome of D. hansenii CBS 767 by Génolevures consortium [31] opened the possibility of molecular studies of this yeast and the identification of proteins with interesting properties. In the phylogenetic analysis of protein members of the Sugar Porter family from eight sequenced yeasts, Palma et al reported the existence of twenty two D. hansenii proteins with undetermined substrate, besides eight putative glycerol transporters [32]. Taking into account that the yeasts from the genus Debaryomyces are among the ascomycete yeasts that assimilate a broader array of polyols [16] and that D. hansenii CBS 767 complete genome sequence is available, we studied polyol transport in more detail in this yeast. In this work, we analyzed polyol/H+ transport in D. hansenii, screening for putative polyol/H+ symporters by heterologous expression in S. cerevisiae of nine putative transporter proteins, five of which we characterized at the biochemical level as new D. hansenii polyol/H+ symporters.

Materials and Methods

Strains and growth media

The yeast strains used or generated in this work are listed in Table 2. Yeast strains were grown on minimal YNB (yeast nitrogen base without amino acids containing the indicated carbon source and the required supplements) or in rich YPD (1% yeast extract, 2% peptone, 2% glucose) media. Cultures were incubated at 28°C with shaking. Sugar and polyol concentrations are given as percentages (w/v). Escherichia coli strain DH5α (Stratagene) was used as the host for plasmid amplification. E. coli transformants were grown on standard Luria–Bertani medium supplemented with ampicillin (100 µg ml−1).
Table 2

Strains used or generated in this work.

StrainDescriptionReference
D. hansenii CBS 767 (var. hansenii)Type strainCBS strain database
S. cerevisiae YSH 117210560-6B aqy1::kanMX4 aqy2::HIS3 MATα leu2::hisG trp1::hisG his3::hisG ura3-52 aqy1Δ::kanMX4 aqy2::HIS3 [53]
MLY10 YSH 1172+pUG35This work
MLY7 YSH 1172+pUG35-DEHA2C06380g This work
MLY8 YSH 1172+pUG35-DEHA2E01386g This work
MLY9 YSH 1172+pUG35-DEHA2C05896g This work
MLY12 YSH 1172+pUG35-DEHA2C05918g This work
MLY20 YSH 1172+pUG35-DEHA2F15444g This work
MLY22 YSH 1172+pUG35-DEHA2E24310g This work
MLY23 YSH 1172+pUG35-DEHA2G06490g This work
MLY25 YSH 1172+pUG35-DEHA2E00726g This work
MLY26 YSH 1172+pUG35-DEHA2B00528g This work

Plasmid and strain construction

D. hansenii genomic DNA for PCR amplification was isolated as described by Cryer et al. [33] after a previous treatment with lyticase (5 mg ml−1). The plasmid used for cloning was pUG35 (AF298787, NCBI nucleotide database). The complete DEHA2C06380g ORF was amplified with high-fidelity DNA polymerase Phusion F-530 (Finnzymes) using primers Dh6380FOR and Dh6380REV (Table 3). Both primers contain, respectively, XbaI and SalI restriction sites at the 5′ end. Plasmid pUG35 was digested with XbaI and SalI and ligated to the DEHA2C06380g ORF fragment, previously digested with the same restriction enzymes, resulting in plasmid pUG35-DEHA2C06380g. A similar procedure was also used to clone the DEHA2E01386g, DEHA2C05896g, DEHA2C05918g and DEHA2F15444g ORFs into plasmid pUG35 (see Table 3), behind MET25 promoter and in frame with GFP sequence and CYC1-T terminator. All constructed plasmids and control plasmid pUG35 were transformed into S. cerevisiae YSH 1172 using the LiAc method [34]. DEHA2E24310g ORF (amplified by PCR with primers Dh24310FOR and Dh24310REV) was inserted behind the MET25 promoter of pUG35 plasmid (previously digested with XbaI and SalI) by homologous recombination [35] directly into S. cerevisiae YSH 1172, resulting in strain MLY22. The same procedure was also used to clone the DEHA2G06490g, DEHA2E00726g and DEHA2B00528g ORFs (see Table 3).
Table 3

Primers used in this work (restriction sites in primers used to clone by restriction digestion and ligation are in bold; sequences homologous to the D. hansenii genes cloned by homologous recombination are underlined).

Gene to amplifyPrimer nameSequence (5′- 3′)Restriction enzymes used for cloningConstructed S. cerevisiae strain
DEHA2C06380 g Dh6380FOR CTCAGCTCTAGACGATTGAACATGAGTAATTCTAC XbaI and SalI MLY7
Dh6380REV ATCTATGTCGACTGCACTGTGATCGTCATTTTGAG
DEHA2E01386 g Dh1386FOR CACCTGTCTAGAAATAATATGTATAAAATATGGTC XbaI and SalI MLY8
Dh1386REV AATACTGTCGACAACTTCCGCAGGCTTAACTG
DEHA2C05896 g Dh5896FOR CTGGAATCTAGAGGAACTAAAATGTCTTCAAGTGC XbaI and SalI MLY9
Dh5896REV ACTACTGTCGACCTCAATATGAGCAGTTTCG
DEHA2C05918 g Dh5918FOR AGCAGTTCTAGAATTATGCCTTCAGAAACTAATCC XbaI and SalI MLY12
Dh5918REV CACTTAGTCGACCTCGATATGAGCAGTTTCG
DEHA2F15444 g Dh15444FOR GCACCAACTAGTTTCAACTCAATAATCAAAATGTATG SpeI and SalI MLY20
Dh15444REV TATTATGTCGACGTTCCTTTTAAAGAATCGCAAAGC
DEHA2E24310 g Dh24310FOR TAGATACAATTCTATTACCCCCATCCATACTCTAGAACTAGTATGAAAAACAACATAGATGGTACG MLY22
Dh24310REV ACCAGTGAATAATTCTTCACCTTTAGACATGTCGAGGTCGACCGATATACCTTCTTCGTGTAAAATTGTGG
DEHA2G06490 g Dh6490FOR TAGATACAATTCTATTACCCCCATCCATACTCTAGAACTAGTATGGCAACAGAAGACAAAGAACTCGGAGTCG MLY23
Dh6490REV ACCAGTGAATAATTCTTCACCTTTAGACATGTCGAGGTCGACAACAGTTTCTATATGCCCAACTTCAGG
DEHA2E00726 g Dh0726FOR TAGATACAATTCTATTACCCCCATCCATACTCTAGAACTAGTATGAAGATAGTGATAATAAGGGACATTATGG MLY25
Dh0726REV ACCAGTGAATAATTCTTCACCTTTAGACATGTCGAGGTCGACGTTTTTATCTACTTTCTCTTCAATGTGTTCAAC
DEHA2B00528 g Dh0528FOR TAGATACAATTCTATTACCCCCATCCATACTCTAGAACTAGTATGACCGAGAAAGTTGATATGATTGGTACG MLY26
Dh0528REV ACCAGTGAATAATTCTTCACCTTTAGACATGTCGAGGTCGACAATTTCCTCGACATGAAGAGTTTCATTAG

Microscopy

For the visualization of GFP-tagged transporters, mid-exponential phase cells were observed with a Leitz Wetzlar Germany 513558 epifluorescence microscope equipped with a Leitz Wetzlar Germany Type 307-148002 514687 mercury bulb and a BP 340-380; BP 450–490 (for GFP visualizing); BP 515–560 filter set. Images were obtained with a digital camera Axiocam Zeiss.

Symport assays

The detection of H+ movements associated with initial sugar/polyol uptake was assessed by adding sugar/polyol pulses to unbuffered cell suspensions, as described in [36], [37]. If the added sugar/polyol is transported to the interior of the cells by a mechanism of symport with H+ an extracellular alkalinization occurs. If there is no alkalinization it means that the added sugar/polyol is not transported by a H+ symport mechanism. D. hansenii cultures (OD640 of 0.9–1.2) and S. cerevisiae cultures (OD640 of 0.7–0.9) were harvested by centrifugation (10 000 g, 5 min, 4°C), washed twice with ice-cold water, resuspended in water to a final concentration of about 25 mg (dw) ml−1 and kept on ice for at least one hour. Kinetic parameters of polyol transporters were determined testing polyol concentrations in the range 0.5 to 400 mM, calculating the slope of initial extracellular alkalinization for each assay and kinetic parameters were estimated using GraphPad Prism version 5.00 (Graphpad Software, www.graphpad.com) for Michaelis-Menten regression analysis. A stoichiometry of one H+ per polyol was assumed. In assays performed after starvation, the cells were washed once with cold sterile water and incubated in the same volume of YNB medium without carbon source for 3 hours or overnight. When indicated, KCl to a final concentration of 1 M was added to the aqueous cell suspension. For S. cerevisiae constructed strains, the detection of the maltose/H+ symporter was used as a positive control (cells grown on maltose). Twelve polyols (2,3-butanediol, D-arabitol, L-arabitol, i-erythritol, D-galactitol, glycerol, D-(+)-chiro-inositol, myo-inositol, D-mannitol, ribitol, D-sorbitol, D-xylitol) and seven sugars (L-arabinose, D-fructose, D-galactose, D-glucose, D-ribose, L-sorbose, D-xylose) were tested for extracellular alkalinization.

Sugar transport assays

Initial [U-14C] sorbitol (GE Healthcare formerly Amersham Biosciences) uptake rates and inhibition assays were performed as described in [38]. Cultures were harvested at OD640∼0.8. To test inhibition, 1.5 mM [U-14C] sorbitol uptake was performed in the presence of 20 mM mannitol. Accumulation ratios were calculated for [U-14C] sorbitol as described in [19]. The measurements were performed at 25°C in small test-tubes, with an initial concentration of 0.1 mM [U-14C] sorbitol. When indicated carbonyl cyanide m-chlorophenylhydrazone (CCCP) to a final concentration of 0.25 mM was added.

Miscellaneous

DNA manipulations were performed according to standard protocols [39]. Restriction enzymes and the ligase were purchased from Roche. Primers were obtained from STAB VIDA (Caparica, Portugal). Plasmid DNA from E. coli was isolated using a GenElute™ Plasmid Miniprep Kit (Sigma-Aldrich). Sequencing was performed at STAB VIDA (Caparica, Portugal).

Results

Detection of polyol/H+ symport activity in D. hansenii

Polyol and sugar transport in cells grown on different carbon sources was assessed in D. hansenii strain CBS 767. The presence of polyol (or sugar) H+ symport activity (detected by external alkalinization of an unbuffered cell suspension after the addition of the polyol/sugar to be tested) was only detected after submitting the cells to 3 h starvation (Figure 1). Addition of 1 M KCl to the cells, before pH adjustment to 5.0, made pH recording data more stable and, consequently, symport signals more evident.
Figure 1

Symport activity in D. hansenii CBS 767 with and without starvation.

Effect on extracellular pH elicited by addition of 10-xylitol to unbuffered cell suspensions (pH 5, 1 M KCl) of D. hansenii CBS 767, grown on YNB medium with 2% xylitol, without starvation (A) and after 3 h starvation (B). The arrows indicate the times of xylitol addition. Data are representative of at least two independent experiments.

Symport activity in D. hansenii CBS 767 with and without starvation.

Effect on extracellular pH elicited by addition of 10-xylitol to unbuffered cell suspensions (pH 5, 1 M KCl) of D. hansenii CBS 767, grown on YNB medium with 2% xylitol, without starvation (A) and after 3 h starvation (B). The arrows indicate the times of xylitol addition. Data are representative of at least two independent experiments. Sugar/H+ symport activity for glucose, xylose, galactose and fructose was detected, after 3 h carbon source starvation, when cells were grown on glucose but not when grown on xylitol, glycerol or mannitol. When cells grown on xylitol were submitted to overnight starvation, H+ symport activity for those four sugars became detectable (results not shown). D. hansenii cells displayed polyol/H+ symport activity (for xylitol, sorbitol and mannitol), after 3 h carbon starvation, when grown on xylose, glucose, xylitol, glycerol and mannitol media (Figures 1B and 2).
Figure 2

Symport activity in D. hansenii CBS 767 after 3 h starvation.

Effect on extracellular pH elicited by addition of 10-sorbitol (S, panel A) or D-mannitol (M, panel B) to unbuffered cell suspensions (pH 5, 1 M KCl) of D. hansenii CBS 767, grown on YNB with 2% xylitol, after 3 h starvation. The arrows indicate the times of polyol addition. Data are representative of at least two independent experiments.

Symport activity in D. hansenii CBS 767 after 3 h starvation.

Effect on extracellular pH elicited by addition of 10-sorbitol (S, panel A) or D-mannitol (M, panel B) to unbuffered cell suspensions (pH 5, 1 M KCl) of D. hansenii CBS 767, grown on YNB with 2% xylitol, after 3 h starvation. The arrows indicate the times of polyol addition. Data are representative of at least two independent experiments. D. hansenii cells grown on glucose, after 3 h carbon starvation, also displayed polyol/H+ symport signals for D-(+)-chiro-inositol, ribitol, D-arabitol and galactitol, but not myo-inositol or L-arabitol (results not shown).

Screening and cloning of putative polyol transporters from D. hansenii

To identify D. hansenii putative polyol/H+ transporters, protein sequences from already identified polyol transporters were obtained from available databases and used as query in a BLASTP search on D. hansenii CBS 767 genome (available at Génolevures Consortium Website, http://cbi.labri.fr/Genolevures/). Nine D. hansenii genes encoding proteins displaying the higher sequence homology to characterized polyol transporters were selected (previous name and Gene IDs are indicated): DEHA2C06380g (DEHA0C07161g; Gene ID: 2900852); DEHA2E01386g (DEHA0E01936g; Gene ID: 2902914); DEHA2C05896g (DEHA0C06655g; Gene ID: 8998320); DEHA2C05918g (DEHA0C06677g; Gene ID: 2900492); DEHA2F15444g (DEHA0F16720g; Gene ID: 2904159); DEHA2E24310g (DEHA0E25839g; Gene ID: 2903016); DEHA2G06490g (DEHA0G07139g; Gene ID: 2904708); DEHA2E00726g (DEHA0E00957g; Gene ID: 2901972); DEHA2B00528g (DEHA0B00517g; Gene ID: 2913088). Specific primers were designed to amplify the corresponding opening reading frames (ORFs) from D. hansenii genomic DNA and the amplified ORFs (without the STOP codons) were expressed in the centromeric plasmid pUG35 under the control of the methionine-repressible MET25 promoter, with C-terminal GFP tagging. Constructed plasmids were expressed in S. cerevisiae YSH 1172 that was previously shown to be unable to transport sorbitol [40]. Empty plasmid pUG35 was also cloned as a negative control (strain MLY10; Figure 3A). All the nine cloned genes encode proteins located at the plasma membrane, based on GFP fluorescence observation (Figure 3B–J), as would be expected for membrane transporters.
Figure 3

Localization of GFP-tagged D. hansenii putative transporters in S. cerevisiae plasma membrane.

Phase contrast (left panels) and epifluorescence (right panels) images of S. cerevisiae YSH 1172 transformed with constructed centromeric plasmids (driven by the MET25 promoter). Strains MLY10 (A, empty plasmid), MLY7 (B), MLY8 (C), MLY9 (D), MLY12 (E), MLY20 (F), MLY22 (G), MLY23 (H), MLY25 (I), MLY26 (J), grown on YNB medium with 2% maltose.

Localization of GFP-tagged D. hansenii putative transporters in S. cerevisiae plasma membrane.

Phase contrast (left panels) and epifluorescence (right panels) images of S. cerevisiae YSH 1172 transformed with constructed centromeric plasmids (driven by the MET25 promoter). Strains MLY10 (A, empty plasmid), MLY7 (B), MLY8 (C), MLY9 (D), MLY12 (E), MLY20 (F), MLY22 (G), MLY23 (H), MLY25 (I), MLY26 (J), grown on YNB medium with 2% maltose.

Characterization of S. cerevisiae strains harboring putative polyol transporters from D. hansenii

For the S. cerevisiae strains harboring D. hansenii putative polyol transporters, symport assays were performed. A list of seven sugars and twelve polyols were tested. The presence of maltose/H+ symport activity for the S. cerevisiae host strain when grown on maltose medium was used as a positive control for H+ symport activity in all assays. The results obtained are summarized in Table 4.
Table 4

Symport activity detected in the S. cerevisiae strains constructed in this work.

S. cerevisiae strainDescriptionSymport ActivityKm (mM)Vmax(mmol h−1 (gdw)−1)
YSH 1172 host strain-
MLY10 YSH 1172+pUG35-
MLY7 YSH 1172+pUG35- DEHA2C06380g-
MLY8 YSH 1172+pUG35-DEHA2E01386gGlycerolndnd
MLY9 YSH 1172+pUG35-DEHA2C05896gD-Sorbitol11.51±2.502.87±0.32
D-Mannitol0.30±0.090.47±0.02
Ribitol11.44±4.460.88±0.11
D-Arabitol0.96±0.320.44±0.03
D-Galactitol12.33±1.500.47±0.02
MLY12 YSH 1172+pUG35- DEHA2C05918gD-Sorbitol13.82±2.120.60±0.03
D-Mannitol0.93±0.160.88±0.03
Ribitol18.31±3.230.94±0.07
D-Arabitol0.46±0.210.92±0.06
MLY20 YSH 1172+pUG35- DEHA2F15444g-
MLY22 YSH 1172+pUG35- DEHA2E24310gD-Galactitol1.93±0.770.22±0.02
MLY23 YSH 1172+pUG35- DEHA2G06490gD-(+)-chiro-Inositol18.64±9.230.05±0.01
MLY25 YSH 1172+pUG35- DEHA2E00726g-
MLY26 YSH 1172+pUG35- DEHA2B00528g-

The kinetic transport parameters (Km and Vmax) for the different substrates are shown. No activity was detected for sugars (L-arabinose, D-fructose, D-galactose, D-glucose, D-ribose, L-sorbose, D-xylose).

nd – not determined.

The kinetic transport parameters (Km and Vmax) for the different substrates are shown. No activity was detected for sugars (L-arabinose, D-fructose, D-galactose, D-glucose, D-ribose, L-sorbose, D-xylose). nd – not determined. Strain MLY8 (YSH 1172+pUG35-DEHA2E01386g) displayed only glycerol symport signal (Figure 4A), indicating that the gene DEHA2E01386g encodes a D. hansenii glycerol/H+ symporter. It presents 68% protein homology to C. albicans and 64% to S. cerevisiae Stl1 glycerol symporters, so we named the corresponding protein as DhStl1.
Figure 4

Symport activity in S. cerevisiae strains expressing D. hansenii polyol transporters.

Effect on extracellular pH elicited by addition of 10(Gl), ribitol (R), D-mannitol (M), D-Galactitol (Ga) or D-(+)-chiro-inositol (In) to unbuffered cell suspensions (pH 5) of S. cerevisiae strains MLY8 (A), MLY9 (B), MLY12 (C), MLY22 (D) and MLY23 (E), grown on YNB medium with 2% maltose. The arrows indicate the times of polyol addition. Data are representative of at least two independent experiments.

Symport activity in S. cerevisiae strains expressing D. hansenii polyol transporters.

Effect on extracellular pH elicited by addition of 10(Gl), ribitol (R), D-mannitol (M), D-Galactitol (Ga) or D-(+)-chiro-inositol (In) to unbuffered cell suspensions (pH 5) of S. cerevisiae strains MLY8 (A), MLY9 (B), MLY12 (C), MLY22 (D) and MLY23 (E), grown on YNB medium with 2% maltose. The arrows indicate the times of polyol addition. Data are representative of at least two independent experiments. Strain MLY9 (YSH 1172+pUG35-DEHA2C05896g) displayed D-sorbitol, D-mannitol, ribitol (Figure 4B), D-arabitol and D-galactitol symport signals, indicating that DEHA2C05896g encodes a D. hansenii sorbitol/mannitol/ribitol/arabitol/galactitol/H+ symporter, that was named DhSyl1 (Symporter Polyols 1). In this strain, the addition of mannitol reduced [U-14C] sorbitol uptake by 70% (results not shown). Strain MLY12 (YSH 1172+pUG35-DEHA2C05918g) also displayed D-sorbitol, D-mannitol (Figure 4C), ribitol and D-arabitol symport signals, indicating that DEHA2C05918g encodes another D. hansenii sorbitol/mannitol/ribitol/arabitol/H+ symporter, that was named DhSyl2 (Symporter Polyols 2). Sorbitol accumulation in strains MLY9 (Figure 5) and MLY12 (results not shown) was sensitive to the protonophore CCCP, as expected for a H+ dependent symport transport mechanism.
Figure 5

Effect of CCCP on sorbitol accumulation in S. cerevisiae MLY9.

Accumulation of [U-14C] sorbitol (0.1 mM) by S. cerevisiae MLY9 cells (▴) grown on maltose medium. The arrow indicates the addition of 0.25 mM CCCP (○).

Effect of CCCP on sorbitol accumulation in S. cerevisiae MLY9.

Accumulation of [U-14C] sorbitol (0.1 mM) by S. cerevisiae MLY9 cells (▴) grown on maltose medium. The arrow indicates the addition of 0.25 mM CCCP (○). Strain MLY22 (YSH 1172+pUG35-DEHA2E24310g) displayed D-galactitol symport signals (Figure 4D), indicating that DEHA2E24310g encodes a D. hansenii CBS 767 galactitol/H+ symporter, that was named DhSgl1 (Symporter galactitol/H+). Strain MLY23 (YSH 1172+pUG35-DEHA2G06490g) displayed D-(+)-chiro-inositol symport signals (Figure 4E), indicating that DEHA2G06490g encodes a D. hansenii CBS 767 D-(+)-chiro-inositol/H+ symporter, that was named DhSyi1 (Symporter D-(+)-chiro-inositol/H+). In strains MLY7, MLY20, MLY25 and MLY26 the addition of any of the tested seven sugars or twelve polyols did not trigger initial external alkalinization, indicating that a mechanism of symport with protons for those substrates was not active in these strains. Alignment of the five characterized polyol transporters (Figure S1) showed that the consensus sequences of the Sugar Porter Family [15] are present and that the glycerol symporter DhStl1 (549 amino acids) and the D-(+)-chiro-inositol symporter DhSyi1 (536 amino acids) are more dissimilar to the other three symporters, being almost 100 amino acids shorter. The galactitol/H+ symporter DhSgl1 (626 amino acids) has 65% homology to DhSyl1 (649 amino acids) and to DhSyl2 (649 amino acids). DhSyl1 and DhSyl2 have 90% protein homology to each other. DhStl1, DhSyi1, DhSyl1 and DhSyl2 probably contain 12 transmembrane hydrophobic domains, whereas DhSgl1 probably contains only 10 [as predicted by the HMMTOP Server v. 2.0 [41]]. Phylogenetically, the plants polyol transporters form a cluster separated from the yeast transporters (Figure 6). The polyol symporters DhSgl1, DhSyl1 and DhSyl2 are closer to myo-inositol transporters ScItr1/ScItr2 and to plant polyol transporters (e.g. LjPlt4) than to the glycerol symporters Stl1. The D-(+)-chiro-inositol symporter is phylogenetically apart from the other characterized D. hansenii polyol transporters.
Figure 6

Dendrogram based on primary protein sequence homology using the neighbor-joining method (applied to 1000 bootstrap data sets).

Dendrogram depicting the phylogenetic relationship between the characterized five new polyol transporters (green arrows), the four cloned putative transporters with unknown substrate (gray arrows) and other members of the Sugar Porter family. Represented proteins (and corresponding accession numbers) are: AgMat1- Apium graveolens mannitol transporter (AAG43998.1); AtINT2- Arabidopsis thaliana inositol transporter 2 (CAJ00304.1); AtPmt1- A. thaliana polyol/monosaccharide transporter 1 (AEC06467.1); AtPmt2- A. thaliana polyol/monosaccharide transporter 2 (AEC06468.1); AtPmt5- A. thaliana polyol transporter 5 (NP_188513.1); CaItr1- C. albicans myo-inositol transporter 1 (XP_714885.1); CaHgt19- C. albicans potential myo-inositol transporter (XP_717819.1); CaStl1- C. albicans glycerol permease CaO19.5753 (XP_718089.1); CiGxs1- C. intermedia glucose/xylose/H+ symporter 1 (CAI44932.1); CiPlf1- C. intermedia putative lactose facilitator 1 (CAO79524.1); DEHA0D02167p- D. hansenii DEHA2D01474p hexose transporter (XP_458532.1); DEHA2B00528p- D. hansenii putative transporter (CAG84972.1); DEHA2C06380p- D. hansenii putative transporter (CAG86022.1); DEHA2E00726p- D. hansenii putative transporter (CAG87550.2); DEHA2F15444p- D. hansenii putative transporter (CAG89402.1); DhSgl1- D. hansenii galactitol/H+ symporter 1 (DEHA2E24310p; CAG88649.2); DhStl1- D. hansenii glycerol/H+ symporter 1 (DEHA2E01386p; CAG87598.2); DhSyi1- D. hansenii D-(+)-chiro-inositol/H+ symporter 1 (DEHA2G06490p; CAG90290.2); DhSyl1- D. hansenii sorbitol/mannitol/ribitol/arabitol/galactitol/H+ symporter 1 (DEHA2C05896p; CAR65543.1); DhSyl2- D. hansenii sorbitol/mannitol/ribitol/arabitol/H+ symporter 2 (DEHA2C05918p; CAG86001.1); DhXylHP- D. hansenii DEHA2C11374p hexose/xylose transporter (XP_458169.1); HbPlt2- Hevea brasiliensis putative polyol transporter protein 2 (CAP58707.1); KlLac12- Kluyveromyces lactis lactose permease (XP_452193.1); LjPlt4- Lotus japonicus putative polyol transporter protein 4 (CAJ29291.1); MdSot3- Malus domestica sorbitol transporter (BAD42343.1); PmPlt1- Plantago major polyol transporter (CAD58709.1); ScItr1- S. cerevisiae myo-inositol transporter 1 (DAA12329.1); ScItr2- S. cerevisiae myo-inositol transporter 2 (DAA10681.1); ScHxt1- S. cerevisiae hexose transporter 1 (DAA06789.1); ScHxt2- S. cerevisiae hexose transporter 2 (AAA34701.1); ScHxt3- S. cerevisiae hexose transporter 3 (DAA12185.1); ScHxt4- S. cerevisiae hexose transporter 4 (DAA06788.2); ScHxt5- S. cerevisiae hexose transporter 5 (DAA06790.1); ScHxt7- S. cerevisiae hexose transporter 7 (DAA12183.1); ScHxt9- S. cerevisiae hexose transporter 9 (NP_012316.1); ScMal11- S. cerevisiae maltose (alpha-glucoside) transporter (DAA08377.1); ScMph2- S. cerevisiae alpha-glucoside permease 2 (DAA11620.1); ScMph3- S. cerevisiae alpha-glucoside permease 3 (DAA08944.1); ScStl1- S. cerevisiae glycerol/H+ symporter 1 (DAA12366.1); SpItr1- Schizosaccharomyces pombe myo-inositol transporter 1 (CAA67211.1); SpItr2- Schi. pombe myo-inositol transporter 2 (NP_593320.1); SpaFsy1-S. pastorianus fructose/H+ symporter (CAC08232.1); SsLac1- Scheffersomyces stipitis lactose permease (XP_001383110.1); SsXut1- Sche. stipitis sugar transporter 1 (XP_001385583.1); SsXut3- Sche. stipitis sugar transporter 3 (XP_001387138.1); TdMal11- Torulaspora delbrueckii general alpha-glucoside permease (AAQ75121.1); ZrFsy1- Z. rouxii fructose/H+ symporter (ZYRO0C00374p; CAR26745.1).

Dendrogram based on primary protein sequence homology using the neighbor-joining method (applied to 1000 bootstrap data sets).

Dendrogram depicting the phylogenetic relationship between the characterized five new polyol transporters (green arrows), the four cloned putative transporters with unknown substrate (gray arrows) and other members of the Sugar Porter family. Represented proteins (and corresponding accession numbers) are: AgMat1- Apium graveolens mannitol transporter (AAG43998.1); AtINT2- Arabidopsis thaliana inositol transporter 2 (CAJ00304.1); AtPmt1- A. thaliana polyol/monosaccharide transporter 1 (AEC06467.1); AtPmt2- A. thaliana polyol/monosaccharide transporter 2 (AEC06468.1); AtPmt5- A. thaliana polyol transporter 5 (NP_188513.1); CaItr1- C. albicans myo-inositol transporter 1 (XP_714885.1); CaHgt19- C. albicans potential myo-inositol transporter (XP_717819.1); CaStl1- C. albicans glycerol permease CaO19.5753 (XP_718089.1); CiGxs1- C. intermedia glucose/xylose/H+ symporter 1 (CAI44932.1); CiPlf1- C. intermedia putative lactose facilitator 1 (CAO79524.1); DEHA0D02167p- D. hansenii DEHA2D01474p hexose transporter (XP_458532.1); DEHA2B00528p- D. hansenii putative transporter (CAG84972.1); DEHA2C06380p- D. hansenii putative transporter (CAG86022.1); DEHA2E00726p- D. hansenii putative transporter (CAG87550.2); DEHA2F15444p- D. hansenii putative transporter (CAG89402.1); DhSgl1- D. hansenii galactitol/H+ symporter 1 (DEHA2E24310p; CAG88649.2); DhStl1- D. hansenii glycerol/H+ symporter 1 (DEHA2E01386p; CAG87598.2); DhSyi1- D. hansenii D-(+)-chiro-inositol/H+ symporter 1 (DEHA2G06490p; CAG90290.2); DhSyl1- D. hansenii sorbitol/mannitol/ribitol/arabitol/galactitol/H+ symporter 1 (DEHA2C05896p; CAR65543.1); DhSyl2- D. hansenii sorbitol/mannitol/ribitol/arabitol/H+ symporter 2 (DEHA2C05918p; CAG86001.1); DhXylHP- D. hansenii DEHA2C11374p hexose/xylose transporter (XP_458169.1); HbPlt2- Hevea brasiliensis putative polyol transporter protein 2 (CAP58707.1); KlLac12- Kluyveromyces lactis lactose permease (XP_452193.1); LjPlt4- Lotus japonicus putative polyol transporter protein 4 (CAJ29291.1); MdSot3- Malus domestica sorbitol transporter (BAD42343.1); PmPlt1- Plantago major polyol transporter (CAD58709.1); ScItr1- S. cerevisiae myo-inositol transporter 1 (DAA12329.1); ScItr2- S. cerevisiae myo-inositol transporter 2 (DAA10681.1); ScHxt1- S. cerevisiae hexose transporter 1 (DAA06789.1); ScHxt2- S. cerevisiae hexose transporter 2 (AAA34701.1); ScHxt3- S. cerevisiae hexose transporter 3 (DAA12185.1); ScHxt4- S. cerevisiae hexose transporter 4 (DAA06788.2); ScHxt5- S. cerevisiae hexose transporter 5 (DAA06790.1); ScHxt7- S. cerevisiae hexose transporter 7 (DAA12183.1); ScHxt9- S. cerevisiae hexose transporter 9 (NP_012316.1); ScMal11- S. cerevisiae maltose (alpha-glucoside) transporter (DAA08377.1); ScMph2- S. cerevisiae alpha-glucoside permease 2 (DAA11620.1); ScMph3- S. cerevisiae alpha-glucoside permease 3 (DAA08944.1); ScStl1- S. cerevisiae glycerol/H+ symporter 1 (DAA12366.1); SpItr1- Schizosaccharomyces pombe myo-inositol transporter 1 (CAA67211.1); SpItr2- Schi. pombe myo-inositol transporter 2 (NP_593320.1); SpaFsy1-S. pastorianus fructose/H+ symporter (CAC08232.1); SsLac1- Scheffersomyces stipitis lactose permease (XP_001383110.1); SsXut1- Sche. stipitis sugar transporter 1 (XP_001385583.1); SsXut3- Sche. stipitis sugar transporter 3 (XP_001387138.1); TdMal11- Torulaspora delbrueckii general alpha-glucoside permease (AAQ75121.1); ZrFsy1- Z. rouxii fructose/H+ symporter (ZYRO0C00374p; CAR26745.1).

Discussion

While the transport of sugar compounds has been extensively studied (see [15] for a review), little information is available on transport of polyols by yeasts, although they are metabolized and/or produced by most yeast species. Detection of polyol/sugar symport activity in D. hansenii CBS 767 was only possible after starving the cells. The induction of hexose/H+ symporters by starvation or very low substrate concentration has been frequently reported in yeasts [36], [42], [43]. In this case, it has been assumed that in general when high concentrations of glucose are available, this sugar is transported by facilitated diffusion, and that only when glucose is scarce, the H+ gradient is used in high-affinity symporters [19], [42]. It is conceivable that in media with high concentrations of polyols D. hansenii will display facilitated diffusion systems for polyols. The presence of KCl in the symport assay made the detection of symport signal more evident. A salt-dependent behavior was already reported by Nobre et al. [43], for detection of sugar symport signals in D. hansenii INETI CL18, having been suggested that high affinity transporters could be affected by a salt-gradient (KCl or NaCl) across the plasma membrane, that influences the proton motive force, affecting the H+ symporter activity [43]. Also in the halotolerant yeast Pichia sorbitophila proton movements associated with polyols uptake was only detected in the presence of 1 M NaCl (Lages and Lucas, personal communication, 2000). The availability of D. hansenii var. hansenii CBS 767 complete genome sequence unlocked the possibility of characterization of a broad array of new proteins. The fact that this yeast has several putative membrane transporters unrelated at the protein level with previously characterized ones, as reported by Palma et al. [32], prompted us to look for putative polyol transporters in its genome. In this work we expressed nine putative membrane transporters from D. hansenii CBS 767 in S. cerevisiae YSH 1172. This yeast was previously shown to be unable to transport sorbitol [40] and we confirmed that it is also unable to transport any of the tested twelve polyols and seven sugars by a symport mechanism with protons, when grown on maltose medium. From the nine selected putative membrane transporters, we were able to characterize the function of five of them. The galactitol/H+ symporter DhSgl1 (DEHA2E24310p), the sorbitol/mannitol/ribitol/arabitol/galactitol/H+ symporter DhSyl1 (DEHA2C05896p) and the sorbitol/mannitol/ribitol/arabitol/H+ symporter DhSyl2 (DEHA2C05918p) are located on cluster 2.A.1.1.Z23 that contains 27 members, including three S. cerevisiae proteins (one of them involved in vacuolar protein sorting [44]) and a putative glucose/myo-inositol transporter from C. albicans (HGT19, orf19.5447) [32]. The myo-inositol transporters are phlylogenetically closely related to this cluster (Figure 6). Both DhSyl1 and DhSyl2 have high affinity for mannitol and arabitol and low affinity for sorbitol and ribitol (Table 4). DEHA2G06490g (DhSyi1; strain MLY23) encodes a D-(+)-chiro-inositol/H+ symporter, with very low transport capacity. D. hansenii is able to transport D-(+)-chiro-inositol by a H+ symporter mechanism but not myo-inositol (results not shown), that is interesting since myo-inositol is the form most used by yeast species as growth factor, being an important cellular component in several organisms. In A. thaliana, the inositol transporter AtINT2 mediates the symport of protons with several inositol epimers, including myo-inositol, D-(+)-chiro-inositol, scyllo-inositol and muco-inositol, with an intermediate affinity for myo-inositol [45]. In HepG2 liver cells the same protein also seems to transport both myo-inositol and D-(+)-chiro-inositol [46], contrary to the studies described so far in yeast cells, since S. cerevisiae transports only myo-inositol by proteins Itr1 and Itr2 [47] and myo-inositol transporters from C. albicans are also myo-inositol specific [20]. In plants, some of the already characterized polyol/H+ transporters also transport sugars, as the A. thaliana AtPmt1 and AtPmt2, that are designated as polyol/monosaccharide transporters and transport xylitol and fructose by a symport mechanism with protons [48]. The fructose/H+ symporter of Z. rouxii ZrFsy1 is also able to transport xylitol [36], but the glucose/xylose/H+ symporter CiGxs1 of C. intermedia [49] did not transport any of the polyols tested in this work (MJ Leandro, unpublished results). The five D. hansenii polyol symporters characterized in this work do not accept sugars as substrate, although they are phylogenetically close to the ZrFsy1 fructose/H+ symporter (Figure 6). The broad polyol spectrum D. hansenii carriers DhSyl1 and DhSyl2 also differ from plant polyol transporters as they do not transport xylitol, which is commonly transported together with sorbitol and mannitol by plant polyol transporters. Constructed S. cerevisiae transformants were grown on maltose providing a positive control for detection of H+ symporters and avoiding repression by glucose. For transformant MLY23 we confirmed that, even using the MET25 promoter that is irresponsive to glucose repression, D-(+)-chiro-inositol/H+ symporter activity was weaker in glucose-grown cells when compared with maltose-grown cells (results not shown), what suggests a post-transcriptional regulation by glucose. As for the other four cloned genes, although they are being correctly expressed in S. cerevisiae plasma membrane, no transient alkalinization was detected for any of the putative substrates tested. The possibility that polyols are being transported by other mechanism not involving proton movements cannot be discarded. In D. hansenii the CUG codon is mainly decoded as Serine but can also be decoded as Leucine (as in S. cerevisiae) [50], [51]. This could hamper the functionality of heterologous expression of D. hansenii proteins in a S. cerevisiae host strain, as Serine and Leucine are amino acids with very distinct properties. Analysis of the existence of CUG codons in the cloned D. hansenii genes (Table S1) using the software Codon Usage (Sequence Manipulation Suite, http://www.bioinformatics.org/sms2/codon_usage.html) [52], showed no relationship between the existence of CUG codons and no detection of symport activity, since DEHA2E24310g has two CUG codons and encodes a functional galactitol/H+ symporter, while DEHA2C06380g, DEHA2F15444g and DEHA2B00528g have no CUG codons and no symport activity was detected in the correspondent S. cerevisiae transformants. To our knowledge, this is the first report on molecular characterization of yeast polyol transporters other than glycerol or myo-inositol in yeasts. This work contributed to the annotation of five new polyol transporters, including an unique specific D-(+)-chiro-inositol/H+ symporter, contributing to further expand the knowledge of polyol transport in yeast. Representative alignment of characterized polyol transporters. Analysis was performed using MUSCLE web server [54] for multiple alignments. Conserved regions in the Sugar Porter family are indicated. Represented proteins (and corresponding accession numbers) are: DhSyi1- D-(+)-chiro-inositol/H+ symporter (DEHA2G06490p; CAG90290.2); DhSgl1- galactitol/H+ symporter (DEHA2E24310p; CAG88649.2); DhSyl1- sorbitol/mannitol/ribitol/arabitol/galactitol/H+ symporter (DEHA2C05896p; CAR65543.1); DhSyl2- sorbitol/mannitol/ribitol/arabitol/H+ symporter (DEHA2C05918p; CAG86001.1); DhStl1- glycerol/H+ symporter (DEHA2E01386p; CAG87598.2). (PDF) Click here for additional data file. Occurrence of CUG codons in cloned genes and predictive position of correspondent amino acid in protein topology. (PDF) Click here for additional data file.
  47 in total

1.  Identification of a mannitol transporter, AgMaT1, in celery phloem.

Authors:  N Noiraud; L Maurousset; R Lemoine
Journal:  Plant Cell       Date:  2001-03       Impact factor: 11.277

2.  The sequence manipulation suite: JavaScript programs for analyzing and formatting protein and DNA sequences.

Authors:  P Stothard
Journal:  Biotechniques       Date:  2000-06       Impact factor: 1.993

3.  The HMMTOP transmembrane topology prediction server.

Authors:  G E Tusnády; I Simon
Journal:  Bioinformatics       Date:  2001-09       Impact factor: 6.937

4.  Water channels are important for osmotic adjustments of yeast cells at low temperature.

Authors:  Graça Soveral; Alexandra Veiga; Maria C Loureiro-Dias; An Tanghe; Patrick Van Dijck; Teresa F Moura
Journal:  Microbiology       Date:  2006-05       Impact factor: 2.777

Review 5.  The genetic code of the fungal CTG clade.

Authors:  Manuel A S Santos; Ana C Gomes; Maria C Santos; Laura C Carreto; Gabriela R Moura
Journal:  C R Biol       Date:  2011-07-02       Impact factor: 1.583

6.  Genomic exploration of the hemiascomycetous yeasts: 14. Debaryomyces hansenii var. hansenii.

Authors:  A Lépingle; S Casaregola; C Neuvéglise; E Bon; H Nguyen; F Artiguenave; P Wincker; C Gaillardin
Journal:  FEBS Lett       Date:  2000-12-22       Impact factor: 4.124

7.  Effects of salts on Debaryomyces hansenii and Saccharomyces cerevisiae under stress conditions.

Authors:  A Almagro; C Prista; S Castro; C Quintas; A Madeira-Lopes; J Ramos; M C Loureiro-Dias
Journal:  Int J Food Microbiol       Date:  2000-06-01       Impact factor: 5.277

8.  Production of arabitol from glycerol: strain screening and study of factors affecting production yield.

Authors:  Srujana Koganti; Tsung Min Kuo; Cletus P Kurtzman; Nathan Smith; Lu-Kwang Ju
Journal:  Appl Microbiol Biotechnol       Date:  2010-12-03       Impact factor: 4.813

9.  Genomic screen for vacuolar protein sorting genes in Saccharomyces cerevisiae.

Authors:  Cecilia J Bonangelino; Edna M Chavez; Juan S Bonifacino
Journal:  Mol Biol Cell       Date:  2002-07       Impact factor: 4.138

10.  Transformation of yeast by lithium acetate/single-stranded carrier DNA/polyethylene glycol method.

Authors:  R Daniel Gietz; Robin A Woods
Journal:  Methods Enzymol       Date:  2002       Impact factor: 1.600

View more
  8 in total

1.  Heterogeneity in the expression and subcellular localization of POLYOL/MONOSACCHARIDE TRANSPORTER genes in Lotus japonicus.

Authors:  Lu Tian; Leru Liu; Yehu Yin; Mingchao Huang; Yanbo Chen; Xinlan Xu; Pingzhi Wu; Meiru Li; Guojiang Wu; Huawu Jiang; Yaping Chen
Journal:  PLoS One       Date:  2017-09-20       Impact factor: 3.240

2.  Production of galactitol from galactose by the oleaginous yeast Rhodosporidium toruloides IFO0880.

Authors:  Sujit Sadashiv Jagtap; Ashwini Ashok Bedekar; Jing-Jing Liu; Yong-Su Jin; Christopher V Rao
Journal:  Biotechnol Biofuels       Date:  2019-10-18       Impact factor: 6.040

3.  Pretreatment of the Antagonistic Yeast, Debaryomyces hansenii, With Mannitol and Sorbitol Improves Stress Tolerance and Biocontrol Efficacy.

Authors:  Xiaobing Ming; Yong Wang; Yuan Sui
Journal:  Front Microbiol       Date:  2020-04-15       Impact factor: 5.640

4.  Dynamic changes in metabolic and lipidomic profiles of tea plants during drought stress and re-watering.

Authors:  Jiazhi Shen; Shuangshuang Wang; Litao Sun; Yu Wang; Kai Fan; Chen Li; Hui Wang; Caihong Bi; Fen Zhang; Zhaotang Ding
Journal:  Front Plant Sci       Date:  2022-09-02       Impact factor: 6.627

5.  Hxt13, Hxt15, Hxt16 and Hxt17 from Saccharomyces cerevisiae represent a novel type of polyol transporters.

Authors:  Paulina Jordan; Jun-Yong Choe; Eckhard Boles; Mislav Oreb
Journal:  Sci Rep       Date:  2016-03-21       Impact factor: 4.379

6.  In vitro resynthesis of lichenization reveals the genetic background of symbiosis-specific fungal-algal interaction in Usnea hakonensis.

Authors:  Mieko Kono; Yoshiaki Kon; Yoshihito Ohmura; Yoko Satta; Yohey Terai
Journal:  BMC Genomics       Date:  2020-09-29       Impact factor: 3.969

7.  A fructose/H+ symporter controlled by a LacI-type regulator promotes survival of pandemic Vibrio cholerae in seawater.

Authors:  Yutao Liu; Bin Liu; Tingting Xu; Qian Wang; Wendi Li; Jialin Wu; Xiaoyu Zheng; Bin Liu; Ruiying Liu; Xingmei Liu; Xi Guo; Lu Feng; Lei Wang
Journal:  Nat Commun       Date:  2021-07-30       Impact factor: 14.919

8.  Predicted Input of Uncultured Fungal Symbionts to a Lichen Symbiosis from Metagenome-Assembled Genomes.

Authors:  Gulnara Tagirdzhanova; Paul Saary; Jeffrey P Tingley; David Díaz-Escandón; D Wade Abbott; Robert D Finn; Toby Spribille
Journal:  Genome Biol Evol       Date:  2021-04-05       Impact factor: 3.416

  8 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.