Vijayalakshmi Venkatesan1, Soundarya L Madhira1, Venkata M Malakapalli1, Maniprabha Chalasani1, Sarfaraz N Shaik1, Vasudevan Seshadri2, Venkaiah Kodavalla3, Ramesh R Bhonde4, Giridharan Nappanveettil5. 1. Department of Biochemistry/Stem Cell Research, National Institute of Nutrition, Indian Council of Medical Research, Jamai-Osmania (P.O), Hyderabad, Andhra Pradesh 500007, India. 2. Laboratory 12, National Center for Cell Sciences, NCCS Complex, Pune University Campus, Ganeshkhind, Pune, Maharashtra 411007, India. 3. Division of Community Studies, National Institute of Nutrition, Hyderabad, Andhra Pradesh 500007, India. 4. Manipal Institute of Regenerative Medicine, GKVK Post, Bellary Road, Allalasandra, Yelahanka, Bangalore, Karnataka 560065, India. 5. National Center for Laboratory Animal Sciences, National Institute of Nutrition, Hyderabad, Andhra Pradesh 500007, India.
Abstract
Alterations in pancreatic milieu to adapt to physiological shifts occurring in conditions of obesity and metabolic syndrome (MS) have been documented, though mechanisms leading to such a state have remained elusive so far. The data presented here tries to look at the gravity of metabolic insult during the early and prolonged phases of obesity/insulin resistance (IR) depicted in WNIN/Ob strain of rats-an obese euglycemic mutant rat model developed indigenously at our institute which is highly vulnerable for a variety of degenerative diseases. The present results in situ show the participation of several confounding factors in the pancreatic milieu that collectively coprecipitates for a state of profound inflammation in the pancreas (among Mutant compared to Lean/Control) which gets worsened with age. These include hypertrophy, macrophage infiltration (CD11b/TNFα/IL6), apoptosis, β-cell vacuolation, hyperinsulinemia (HI), and stress markers (RL-77/HSP104/TBARS) all of which correlated well with indices for obesity (2-3 fold), IR (1.5-3 fold), and HI (2-3 fold). Further, supportive data was also obtained from in vitro studies using islet cell cultures amongst phenotypes. Taken together, these results advocate that inflammation was the major precipitating factor to cause islet cell dysfunctions (in situ and in vitro) in these Mutant rats compared to their Lean littermates and parental Control.
Alterations in pancreatic milieu to adapt to physiological shifts occurring in conditions of obesity and metabolic syndrome (MS) have been documented, though mechanisms leading to such a state have remained elusive so far. The data presented here tries to look at the gravity of metabolic insult during the early and prolonged phases of obesity/insulin resistance (IR) depicted in WNIN/Ob strain of rats-an obese euglycemic mutant rat model developed indigenously at our institute which is highly vulnerable for a variety of degenerative diseases. The present results in situ show the participation of several confounding factors in the pancreatic milieu that collectively coprecipitates for a state of profound inflammation in the pancreas (among Mutant compared to Lean/Control) which gets worsened with age. These include hypertrophy, macrophage infiltration (CD11b/TNFα/IL6), apoptosis, β-cell vacuolation, hyperinsulinemia (HI), and stress markers (RL-77/HSP104/TBARS) all of which correlated well with indices for obesity (2-3 fold), IR (1.5-3 fold), and HI (2-3 fold). Further, supportive data was also obtained from in vitro studies using islet cell cultures amongst phenotypes. Taken together, these results advocate that inflammation was the major precipitating factor to cause islet cell dysfunctions (in situ and in vitro) in these Mutant rats compared to their Lean littermates and parental Control.
Obesity with insulin resistance (IR) forms a major part of metabolic syndrome (MS) and its co-precipitation with etiological factors has been shown to cause dysregulation of several dynamic processes, thereby predisposing the organism to long-term micro- and macro-vascular complications [1]. Interestingly, animal models (ob/ob and db/db mice and Zucker and Koletsky rats) have greatly helped our understanding of the pathophysiology associated with MS, although the mechanism(s) remain(s) obscure [2]. WNIN/Ob rat strain (Mutant) is a new entrant to the list of obese animal models and is derived indigenously from the Wistar rat strain of our institute (WNIN), maintained at our institute in an inbred status since 1920. WNIN/Ob, which arose spontaneously from WNIN in 1997, is euglycemic and portrays features of obesity/IR with distinct clinical and biochemical features like hyperinsulinemia (HI), hypertriglyceridemia, and hypercholesterolemia along with hyperphagia, polydipsia, polyuria, and proteinuria akin to other obese model systems [3]. Interestingly, this is the biggest obeserat strain (1.4 Kgs) so far recorded in literature, and is leptin resistant with unaltered leptin or its receptor coding sequences and the strain exhibits three distinct phenotypes: homozygous lean (+/+), heterozygous carrier (+/−), and homozygous obese (−/−), in a typical Mendelian ratio of 1 : 2 : 1. The mode of inheritance is autosomal incomplete dominance. Attempts to localize the mutation in this model system are in progress and a recent study from our institute has localized the observed unilocus mutation to exist in a 4.3 cM region with flanking markers D5Rat256 and D5Wox37 on chromosome 5 upstream of the leptin receptor [4]. These Mutants stand apart from other similar models, due to the presence of “kinky tail” in heterozygous carriers (+/−) and in homozygous obese (−/−) phenotypes. Apart from obesity, these Mutants show a variety of degenerative diseases, as they cross one year, like breast tumors and lipomas, cataract and retinal degenerations (in 20%), hypertension [5], osteoporosis, polycystic ovaries, kidney damage, impaired immunity, and accelerated aging with the life span of Mutants reduced to 1.5 years, while a normal rat lives up to 3–3.5 years [6].The impetus obtained from our published data using adipose tissue (AT) [7] and bone marrow derived mesenchymal stem cells (BM-MSCs) [8] from these animals supported an in situ inflammation with obesity as a predominant metabolic lesion. The metabolic interrelationships and cross-talks (cytokines) contributed from skeletal muscle (SM) and AT have been shown to be decisive for the maintenance of glucose homeostasis [9] and dysregulations have been shown to influence the β-cell functions and integrity [10]. It is to be noted here that β-cells of the pancreas have an inherent weak antioxidant system as compared to any organ [11] and with persistent IR [3], hyperglycemia, and obesity or HI could predispose the organism to long-term secondary complications [12, 13] vis-à-vis β-cell dysfunctions [12].We hypothesize that WNIN/Ob rats (Mutants) with their inherent phenotypic features would form an ideal model to assess the gravity of metabolic insult both at early and prolonged (chronic) phases seen with age (1, 6, and 12 months). In the present study we have compared homozygous obeserats (WNIN/Ob (−/−)) (Mutants) with their age matched homozygous lean (WNIN/Ob (+/+)) littermates (Leans) and parental (WNIN) controls (Controls) for all the parameters (islet cell architecture, inflammation, and islet cell functions) studied in in situ (tissue) and in vitro (primary islet cell cultures). This is primarily to understand the early and chronic phases of the metabolic insult which has been reported with these Mutants and is appreciable with age (1, 6, and 12 months).
2. Material and Methods
2.1. Animals
Experimental procedures were in compliance with the principles of laboratory animal care and approved by the Institutional Ethical Committee on Animal Experiments, Hyderabad, India. Male rats, six per strain, (Mutant, Lean, and Control) matched for age (1, 6, and 12 months) were obtained from an inbred colony of the National Centre for Laboratory Animal Sciences (NCLAS) facility at our institute. To understand the effect of accelerated aging on the pathophysiology of MS in the 12-month Mutant rats, we have made a comparison of 12-month Mutants with two-year-old (24-month) Control rats in few critical metabolic parameters. The animals were given normal rat chow with water ad libitum. They were maintained under optimal conditions of 12 hr light/dark cycles, with temperature (20 ± 2°C) with relative humidity (50 ± 10%) kept constant. Prior to the day of euthanization, animals were fasted overnight to normalize any differences in feeding patterns and to minimize experimental variations.
2.2. Physiological Parameters
Anthropometric measurements (body/pancreatic tissue weights), blood glucose [7], insulin (plasma/tissue) [11, 14] and IR indices—Homeostasis Model of Assessment for Insulin Resistance (HOMA-IR) and Quantitative Insulin Sensitivity Check Index (QUICKI) were measured as described previously [8]. Thiobarbituric acid reacting species (TBARS), a marker of global oxidative stress/lipid peroxidation, were measured in plasma/pancreatic tissue as per our earlier protocol [15].
2.3. Tissue Morphometry
Pancreatic tissues (formalin fixed and paraffin embedded) of 6–8 μm thickness were processed for hematoxylin and eosin (H&E), and immunofluorescence including TUNEL assay [7, 16, 17]. H&E stained sections were used for studying islet morphology (islet size, β-cell vacuolation, and AT/macrophage infiltration), and images were captured using an inverted microscope (TE2000S, Nikon, Japan) with ACT2U software (version 1.7, Nikon, Japan).
2.4. Immunofluoresence
Immunostaining of the pancreatic sections was performed as described previously [8, 16]. In brief, pancreatic sections were blocked with 4% horse serum and incubated overnight at 4°C using either 1 : 100 dilution of primary antibodies for mouse antihuman insulin (Sigma, USA), rabbit antihuman glucagon (Santa Cruz, USA), goat antihuman PDX-1 (Santa Cruz, USA), rabbit polyclonal antihuman HSP104 (gift), mouse polyclonal anti-RL-77 (gift, National Centre for Cell Sciences, Pune, India), or 1 : 400 dilution of rabbit polyclonal anti-IL-6 (Abcam, USA). After repeated washes, the sections were incubated with secondary antibodies (1 : 200 dilution) for anti-mouseFITC (Insulin/RL-77), anti-rabbitTexas Red (glucagon) (Santa Cruz, USA), anti-goatTexas Red (Pdx-1), anti-rabbitCy3 (HSP104) (Jackson's Laboratories, USA), and anti-rabbitAlexa 568 (IL-6). After several more washes the sections were mounted using DAPI (Vectashield, Vector Laboratories, USA). Antigen retrieval for the nuclear transcription factor Pdx-1 was performed by treating tissue sections with 2 N HCl for 1 hr at room temperature. Similarly, dual fluorescence for CD11b and TNFα was carried out using FITC conjugated mouse anti-ratCD11b (BD Biosciences, USA) and PE hamster anti-rat TNFα (BD Biosciences, USA) at 1 : 100 dilution. Immunostaining of pancreatic sections of 24-month-old WNIN rats was performed for insulin, glucagon, CD11b, TNFα, IL-6, and Pdx-1 as described above. The images were captured using 405 (DAPI), 488 (FITC), 514 (Cy3), 561 (PE/568), and 594 (Texas red) lasers using a confocal microscope (Leica SP5, Leica Microsystems, Germany) with Leica Advanced Fluorescence (LAF) software (Leica Microsystems, Germany). The fluorescence intensities were calculated as relative fluorescent units (RFU) (relative to isotype control) using the LAF software and represented as RFU per unit area. All images were captured using Leica Advanced Fluorescence software (Mannheim, Germany) in Leica Confocal Microscope SP5 series (Mannheim, Germany) at a magnification of 400x unless otherwise specified. An asterisk (*) indicates a significance of P < 0.05 by ANOVA compared to Control and ($) represents the statistical significance (P < 0.05 by ANOVA) compared to the phenotype at 1 month. Values have been represented as Mean ± SE (n = 6) from three independent experiments performed in duplicate.β-cell mass was calculated from the insulin stained sections, captured using LAF software as mentioned above [18] at a final magnification of 200x. Area of β-cells was determined by quantifying the cross-sectional area occupied by β-cells to the total cross-sectional area of the tissue (in all multiple fields per slide) and represented as a product of the cross-sectional area of β-cells/total tissue and the weight of the pancreatic tissue before fixation. Total tissue area was corrected for the unstained area inside the fat cells, by tracing the region occupied by fat cells in the H&E stained specimens (at a final magnification of 200x).
2.5. TUNEL Assay
Apoptosis was studied using DeadEnd Fluorometric TUNEL assay kit (Promega, USA) as per the manufacturer's protocol. Apoptotic cells were visualized with FITC positive nuclei and images were captured using 405 and 488 lasers under a confocal microscope using LAF software. TUNEL assay was also performed on 24-month-old Control pancreatic tissue sections. Apoptotic index (AI) was calculated as the ratio of number of TUNEL positive nuclei to the total number of nuclei per islet [19].
2.6. Gene Expression Analysis
The methodology for semiquantitative reverse transcription polymerase chain reaction (sq-RT-PCR) used was similar to the procedures reported earlier by us [8]. Total RNA (from ~100 mg of pancreatic tissue) was isolated using TriReagent (Sigma, USA) and cDNA was prepared from 2 μg of total RNA using enhanced avian myeloblastosis virus reverse transcriptase enzyme (Sigma, USA) and amplified with JumpStart AccuTaq LA DNA Polymerase (Sigma, USA). Primers were designed with the aid of PrimerQuest software (Integrated DNA technologies, Coralville, IA). PCR was carried out to analyze the expression of Insulin-1 (sense: caatcatagaccatcagcaagc; antisense: tttattcattgcagaggggtgg), Pdx-1 (sense: tacaaggacccgtgcgcatt; antisense: tcaagttgagcatcactgcc), and (sense: tgtgatggtgggaatgggtcag; antisense: tttgatgtcacgcacgatttcc). Amplicons were resolved electrophoretically (1.2% agarose gel), visualized in GelDoc (BioRad, Italy), and quantitated by densitometric analysis using QuantityOne software (BioRad, Italy). Results have been normalized against the house keeping gene .Quantitative real-time PCR was performed for each sample in triplicate using a CFX 96 Touch Real-Time PCR system (BioRad, Italy) in a 96-well PCR plate (BioRad, Italy). Each assay (20 μL total volume) contained nuclease-free water (11 μL-12 μL), cDNA template (conc—2 ng/μL), gene-specific primers (conc—4.5 pm/μL), and 5 μL SYBR green PCR Master Mix (KAPA Biosystems, South Africa). The cycling conditions were enzyme activation at 95°C for 30 s; 40 cycles of 95°C for 30 s (denaturation); and Pdx-1 at 60°C and Insulin-1 at 58°C for 30 s (annealing) with a single fluorescence measurement at 72°C for 30 s (dissociation curve). Specificity of the PCR products was confirmed by the melting curve program with temperatures in the range of 60 to 95°C with a heating rate of 0.5 to 0.05°C/s and a continuous fluorescence measurement. Relative differences in gene expression between groups (Mutant, Lean, and Control—aged 1, 6, and 12 months) are represented as fold change using 2∆∆CT method as per the protocol of Dussault and Pouliot [20].
2.7. In Vitro Assays
Islet Isolation, Primary Cell Cultures, Viability, and Functional Assays. Islets were isolated under sterile conditions from all the three phenotypes (Mutant, Lean, and Control) as per our published protocol [14]. Keeping in view the fact that Mutants have 47% fat in their body which interferes with the islet integrity and cell yield by forming a viscous jelly-like material when compared to their age matched parental Controls, we had optimized conditions for islet cell isolation with minimal viscous material and maximum islet yield and functional response (primary islet cell cultures) using differential collagenase digestion [14]. Briefly, pancreas were collected under sterile conditions, minced and subjected to collagenase digestion using either 0.5 mg/mL for Mutants or 1 mg/mL for Lean/Control. The digestion mixture also contained 2 mg/mL soy bean trypsin inhibitor (Sigma, USA) and 2% BSA fraction V (Sigma, USA). All steps were performed at optimal temperature (37 ± 1.5°C) and pH (7.0 or 7.7–7.9) [21] and digestion (turbidity appearance) was stopped with the addition of chilled RPMI-1640 containing 10% FCS (1 : 3 ratio) in order to prevent islet necrosis during isolation [22]. The digests were washed (3x), and islet-cell-enriched fractions were seeded in RPMI-1640 medium with 10% FBS with antibiotics (Invitrogen, USA). After a period of 24–48 hrs, the islets were harvested by handpicking for in vitro assays including viability by MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide) assay [23] and islet cell integrity by dithizone (DTZ) staining (Sigma, USA) [14], and images were captured with a Nikon inverted microscope using ACT-2U software. Insulin secretion assay was carried out from the primary islet cell cultures of Mutant, Lean, and Control phenotypes at basal (5.5 mmol/L) followed by high glucose (16.5 mmol/L) challenge as described earlier [8, 14]. Similarly, insulin secretion assay to assess islet cell function was also performed from islets (primary islet cell cultures) derived from 24-month-old Control rats [14].
2.8. Ultrastructural Analysis
For ultrastructural studies, the primary islet cell cultures of only 12-month-old animals (Mutant, Lean, and Control) presenting increased degenerative changes [3, 6, 24] were processed for both scanning electron microscopy (SEM) [25] (performed at 5 to 10 KV in S3400N, Hitachi, Japan) and transmission electron microscopy (TEM) [26] (performed at 75 KV in H-600, Hitachi, Japan), respectively.
2.9. Statistics
Descriptive statistics (Mean/SE) were calculated for all the samples using SPSS version 15.0 software and values have been represented as Mean ± SE (n = 6). To compare between the phenotypes, analysis of variance (ANOVA) followed by post hoc tests (LSD/Dunnett's C test) was carried out based on Levene's test for equality of error variances. Bivariate correlation analysis (2-tailed) for better understanding of the correlation between metabolic, anthropometric, and physiological parameters was performed using the same software (SPSS version 15.0) for a better understanding of the correlation between these parameters. P < 0.05 was considered statistically significant for all the measurements. Data have been computed from three independent experiments carried out in duplicate for tissue morphometry, immunofluoresence, PCR, and ultrastructural analyses and from six animals per group for all anthropometric/physiological analyses.
3. Results
3.1. Physiological Parameters
3.1.1. Body Weight/Pancreatic Weight
A significant increase in the body weight of Mutants, which increased with age (1, 6, and 12 months) to a tune of 4–7-fold (P < 0.05) compared to their Leans and Controls, was observed (Figure 1(a)). In similar lines, pancreatic weights were also increased in Mutants by 2-fold when compared to their Leans and Controls at all age groups (Figure 1(b)). However, both body weights and pancreatic weights were almost comparable between Leans and Controls with age (Figures 1(a) and 1(b)).
Figure 1
Physiological, biochemical and structural analysis. The figure shows anthropometric measurements such as (a) body weights and (b) pancreatic tissue weights; metabolic measurements such as (c) plasma insulin, (d) insulin resistance indices (HOMA-IR), (e) QUICKI, and (f) global oxidative stress levels by plasma TBARS. Histological studies of H&E stained pancreata revealed hypertrophied islets with irregular morphology (black arrows) and increased vascular supply (white arrow head) with widened intraislet connective tissue septa (black arrow head) seen more with Mutants and with age compared to their Lean, and Control phenotypes. Insight shows the intrapancreatic tissue fat infiltration with age (g). These islets among Mutant phenotypes also demonstrated β-cell vacuolation (black bold circles) in the islet region compared to that from Lean and Control (h). All images were captured using ACT2U software (Nikon, Japan) attached to Nikon TE2000S Microscope (Nikon, Japan) at magnification of 200x (g) and 400x (h). Islet size was quantified using ACT2U software (Nikon, Japan) and represented graphically as Mean ± SE (n = 6) among Mutant, Lean, and Control with age (i). Mutants showed an increase in islet size and correlated well with increased tissue insulin (j) and oxidative stress (k) compared to Lean and Control and with age. Figure 1 also depicts histological comparison between the pancreatic islets between 24-month-old Control rats and 12-month-old Mutant rats showing hypertrophied islets with irregular morphology, increased vascular supply with widened intraislet connective tissue septa, intrapancreatic tissue fat infiltration, and β-cell vacuolation. Parameters such as body weight, pancreatic weight, FBG, FPI, and islet size of 24-month-old Control rats have also been indicated (m). An asterisk (*) represents significance (P < 0.05 by ANOVA) compared to Control and ($) indicates significance (P < 0.05 by ANOVA) compared to the same phenotype at 1 month.
3.1.2. Glucose and Insulin (Plasma and Tissue Insulin)
The animals were euglycemic [6] in all age groups with fasting blood glucose (FBG) in the range of 3.9–6.1 mmoles/L. The plasma and tissue insulin levels were almost similar during the early age, that is, at 1 month, amongst phenotypes, but with age Mutants demonstrated a significant increase in both plasma (HI) and tissue insulin levels being appreciable at 6 months (compared to Leans (by 3.03- and 1.10-fold) and Controls (by 3.70- and 2.82-fold)) and 12 months (compared to Leans (by 5.51- and 1.71-fold) and Controls (by 3.77- and 1.39-fold)), respectively (Figures 1(c) and 1(j)). The plasma (2.13 ± 0.52) and tissue insulin (5.36 ± 0.75) levels measured in 24-month-old Control rats were, however, found to be lower than those observed in 12-month Controls.
TBARS signifying global oxidative stress indices were also upregulated significantly (P < 0.05) in Mutants at all ages which was reflected both in plasma (Figure 1(f)) and pancreatic tissue (Figure 1(k)) levels compared to their Leans and Controls.
3.1.4. Measurement of IR
We observed a significant increase in HOMA-IR (Figure 1(d)) supported by a significant decrease in QUICKI (Figure 1(e)) among Mutants at 6 and 12 months but not at 1 month suggesting an increase in IR with age. However Lean and Control rats remained insulin sensitive as reflected by IR Indices. Based on the HOMA-IR and QUICKI indices calculated 24-month-old Control rats also showed IR (1.21 and 0.32, resp.) as an age dependent effect similar to Mutant rats.
3.2. Morphometric Studies
H&E staining of Mutant pancreatic tissues at 6 and 12 months of age demonstrated a marked hypertrophy with large and irregular islets (Figure 1(g)), β-cell vacuolation (Figure 1(h)), and disruption in the outer collagenous layer as compared to the intact morphology of the islets noted with Leans and Controls (Figures 1(g) and 1(h)). Further, evidence for an increased vasculature, intraislet vacuolation, and fat infiltration into the exocrine region was also predominant in Mutant pancreas when compared to its Lean and Control (Figure 1(g)). However the morphology was more or less similar to the early age group of 1 month studied amongst the phenotypes (Figures 1(g)-1(h)).As shown in Figure 1(i), Mutant pancreas showed increase in islet size measured using ACT2U software (Nikon microscope), which was significant among Mutants by 1.25-, 1.54-, and 1.35-fold compared to Leans and by 1.40-, 1.38-, and 1.54-fold compared to their Controls at 1, 6, and 12 months (Figure 1(i)). However, the differences observed in islet size between Leans and Controls were not statistically significant. Islet size among 24-month Controls was found to be 320.45 ± 15.02 μm, in line with the trends expected with 12-month Mutants.
3.3. Immunofluoresence
Immunostaining of pancreatic tissues with insulin and glucagon amongst the phenotypes demonstrated a central core of insulin positive β-cells surrounded by a peripheral mantle of glucagon positive α-cells at all the ages studied (Figures 2(a)–2(d)). As depicted in Figure 2(f), insulin immunopositive cells expressed as RFU per unit (relative to isotype controls (Figure 2(e))) were significantly higher in Mutants at 1, 6, and 12 months compared to Leans (by 1.72-, 3.31-, and 1.27-fold) and Controls (by 2.74-, 3.03-, and 1.42-fold), respectively, substantiating HI/increased tissue insulin levels observed. However, similar levels of insulin positivity (RFU per unit area) were observed among Lean and Control with age (Figures 2(a)–2(d) and 2(f)). Among the 24-month Controls, RFU per unit area for insulin was found to be 30.75 ± 2.6.
Figure 2
Immunostaining for insulin and glucagon. Immunolocalization of islets for β-cell marker insulin (green) and α-cell marker glucagon (red), counterstained with 4′,6-diamidino-2-phenylindole (DAPI) (nuclear stain) (blue), showed increased insulin immunostaining among Mutants compared to Lean and Control and with age from 1 month (a) to 6 months (b) and 12 months (c) and showed a comparison with 24-month-old (2 yr) Controls (d). Isotype control is also represented (e). Quantitative fluorescence measurements as relative fluorescence units (RFU) for (f) insulin, (g) glucagon, (h) insulin to glucagon ratio, and (i) β-cell mass were calculated from insulin stained areas. An asterisk (*) represents significance (P < 0.05 by ANOVA) compared to Control and ($) indicates significance (P < 0.05 by ANOVA) compared to the same phenotype at 1 month.
Interestingly, glucagon positive cells (RFU per unit area relative to isotype controls (Figure 2(e))) were also increased in Mutant pancreas, both at an early phase, that is, 1 month, (RFU = 19.32) and midphase, that is, 6 months, (RFU = 16.04) unlike at 12 months (RFU = 14.68) which showed a decrease. Leans and Controls were almost comparable at all ages (Figures 2(a)–2(d) and 2(g)). However, the levels among 24-month Controls were found to be 10.37 ± 1.6, which was similar to the levels observed among 12-month Mutants.Further, insulin/glucagon ratio (per se indices) indicating the relative percentage of β-/α-cells was also significant (P < 0.05) at the higher age group (12 months) among Mutant compared to its Lean and Control, further denoting HI (Figure 2(h)).β-cell mass was also calculated [18] by quantifying the cross-sectional area occupied by β-cells to the total cross-sectional area of the tissue (in all multiple fields per slide) from the phenotypes. Mutants showed an increase in β-cell mass at 1 and 6 months compared to their Leans and Controls. However, at 12 months, β-cell mass of Mutant was decreased which is probably attributed to increased degenerative effects (hypertrophy and apoptosis). Comparison of β-cell mass between Leans and Controls (Figure 2(i)) does show a consistence in tune with the observed islet cell size.Immunostaining of the pancreatic tissue sections with insulin and PDX-1 demonstrated decreased PDX-1 intensities (RFU per unit area compared to isotype control (Figure 7(e))) (Figures 7(a)–7(f)).
Figure 7
Immunolocalization of insulin and Pdx-1. Pdx-1 (red) shows increased nuclear localization in (a) 1-month Mutants followed by (b) 6-month Mutants and (c) 12-month Mutants compared with their Leans and Controls among insulin (green) positive β-cells. The localization was almost similar between 12-month Mutants and (d) older age (24-month) Controls. RFU has been represented (e) amongst phenotypes. Statistical significance (P < 0.05 by ANOVA) has been represented compared to Control by an asterisk (*) and compared to younger age by ($).
3.3.1. Inflammatory (CD11b, TNFα, and IL-6) and Stress Markers
As shown in Figure 3(a), HSP-104 localization (cytosolic region) in islets was significantly increased in Mutants at all ages (12 months > 6 months > 1 month) when compared to that in Leans and Controls. Although Leans tend to show an increase for HSP-104 (RFU per unit area with reference to isotype control (Figure 3(c))) compared to Controls, this was not statistically significant (Figures 3(a) and 3(d)). On similar lines, Mutant islets also demonstrated increased localization of endoplasmic reticulum (ER) stress protein RL-77 (RFU per unit area with reference to isotype control (Figure 3(e))) compared to Lean and Control (Figures 3(b) and 3(f)).
Figure 3
Cellular stress responses. Immunostaining of pancreatic sections for cellular stress protein, HSP-104 (yellow—pseudocolor for Cy3) (a) and endoplasmic reticulum stress protein RL-77 (green) (b) demonstrate an increased cellular stress (HSP104 and RL-77) among Mutants compared to Lean and Control and with age. Isotype controls for HSP-104 (c) and RL-77 (e) have also been depicted and with corresponding RFU for HSP-104 (d) and RL-77 (f). An asterisk (*) represents significance (P < 0.05 by ANOVA) compared to Control and ($) indicates significance (P < 0.05 by ANOVA) compared to the same phenotype at 1 month.
Figures 4(a)–4(e) depict dual immunofluoresence for CD11b/TNFα (RFU per unit area with reference to isotype control (Figure 4(c))), that is, relative percentage of macrophages/mast cells/inflammatory protein in situ which was significantly upregulated in Mutants with age. However, Leans and Controls showed few immunopositive cells for CD11b/TNFα in comparison to Mutants with age (Figures 4(a)–4(e)). In addition, increased IL-6 immunolocalization with increasing age was seen amongst Mutant pancreatic islets (Figures 4(f)–4(i)).
Figure 4
Inflammatory stress responses. Immunofluoresence staining of pancreatic sections for inflammatory markers shown by colocalization (yellow) with macrophage marker CD11b (green) and proinflammatory cytokine for TNFα (red) shows more CD11b/TNFα colocalization with Mutant pancreas (a) compared to Lean and Control and comparable with (b) 24 months older in age Control; (c) represents its isotype control. (d and e) represent RFU for CD11b and TNFα, respectively, amongst phenotypes. Mutant pancreas also showed an increase in (f) IL-6, compared to its Lean and Control, and was similar to (g) 24-month Control; (h) represents isotype control and (i) RFU for IL-6 amongst phenotypes. An asterisk (*) represents significance (P < 0.05 by ANOVA) compared to Control and ($) indicates significance (P < 0.05 by ANOVA) compared to the same phenotype at 1 month.
3.3.2. Apoptosis/TUNEL Assay
Age dependent increase in apoptosis was evident amongst the phenotypes, that is, Mutants, Leans, and Controls, but the quantitative increase in AI was more predominant in Mutants (Figure 5(a)) compared to that in Leans (by 1.20-, 2.84-, and 15.77-fold) and Controls (by 5.16-, 5.67-, and 9.98-fold) (Figure 5(d)), respectively. Interestingly, apoptotic rate was increased among 12-month Mutants by 3.70-fold compared to that of 24-month Controls (Figure 5(b)) as compared to its negative control (Figure 5(c)).
Figure 5
Apoptosis (TUNEL assay). Apoptosis detected by TUNEL assay shows red (pseudocolor) nuclei (counterstained with DAPI (blue). Mutants showed an increase in (a) apoptosis as compared to Lean and Control and apoptotic index (b) and it is comparable with 24-month-old Controls; (c) represent its negative control. Quantitatively, AI was significantly higher in (d) Mutants compared to Lean and Control and with age. Mean ± SE (n = 6). An asterisk (*) represents significance (P < 0.05 by ANOVA) compared to Control and ($) indicates significance (P < 0.05 by ANOVA) compared to the same phenotype at 1 month.
3.4. Gene Expression Analysis
mRNA for Insulin was significantly upregulated only at 6 months in Mutants against the data obtained from plasma and tissue insulin, which showed an increase in insulin levels at all the ages (12 months > 6 months > 1 month). The expression levels were, however, comparable in Leans and Controls as reflected by the densitometric analysis (Figure 6(a)).
Figure 6
Gene expression (semiquantitative and real-time PCR) mRNA levels for (a) Insulin-1 were increased in Mutants with age as compared to their phenotypes. However (b) Pdx-1 expression was downregulated with age (1 > 6 > 12 months). Gel images have been represented for (a) Insulin-1 and (b) Pdx-1. In line with semiquantitative data, mRNA transcripts were upregulated for (c) Insulin-1 in Mutants with age as compared to their phenotypes. In similar lines (d) Pdx-1 expression was downregulated with age (1 > 6 > 12 months). The values have been represented as 2∆∆CT against Control. Statistical significance (P < 0.05 by ANOVA) has been represented as compared to Control by an asterisk (*) and as compared to younger age by ($).
Pdx-1 homeobox transcription factor required for β-cell functions and regulation of insulin secretion was significantly downregulated in Mutants at both 6 and 12 months with a peak expression seen at 1 month (Figure 6(b)).Quantitative data generated from RT-PCR further substantiated increased expression of Insulin gene among Mutants, being more pronounced at 6–12 months of age compared with their Lean littermates (values have been normalized against their Controls) (Figure 6(c)). In line with our qRT-PCR data, Pdx-1 expression in Mutants showed downregulation with age (1 month > 6 months > 12 months) with a peak expression at 1 month. Interestingly, Pdx-1 expression was down regulated in 6–12-month-old Leans when compared with that of their Mutants (age matched/littermates) with a peak expression at 1 month as compared to its Mutant (values have been normalized against their Controls) (Figure 6(d)).
3.5. Primary Islet Cell Cultures
3.5.1. Viability
MTT assay demonstrated an increase in viability during the early phase, that is, 1 month, and declined with age, suggestive of age dependent effects—Mutants (86%, 75%, and 60%), Lean (85%, 80%, and 74%), and Control (98%, 95%, and 85%) corresponding to 1, 6, and 12 months. However, the islet cell integrity was not altered with age and showed >85% intactness, as assessed from the DTZ stained (deep crimson red) islet cell clusters (Figure 8(a) (insights)).
Figure 8
Insulin secretion assay and ultrastructural studies on primary islet cell cultures. (a) Bright field images of primary islet cultures isolated from Mutant, Lean, and Control at 1, 6, and 12 months. Insights show the DTZ stained islets (magnification of 100x). (b) shows the ultrastructural studies of 12-month Mutant phenotypes by scanning (SEM) and (c) transmission electron microscopy (TEM). As shown in the figures Mutants showed less integrity with a ruptured outer collagenous layer (black arrows) and perforations (white arrow heads) (SEM), degranulation of insulin crystals, large less electron dense secretory granules (arrow head), and vacuolation (v) (TEM) compared to their Lean and Control. Insulin secretion measured from 250 islets: (d) basal (5.5 mmol/L glucose), (e) stimulated (16.5 mmol/L glucose), and (f) basal to stimulated insulin secretion, shows impaired insulin secretion with challenge (16.5 mmol/L glucose) from Mutants with age as compared to their Leans and Controls. However, Mutants showed higher basal insulin levels with age.
3.5.2. Insulin Secretion Assay
As given in Figure 8(c), Mutants at all the age groups, that is, 1, 6, and 12 months, were hyperinsulinemic as evidenced by an increase in their basal insulin levels similar to our earlier observations of increased insulin levels in both plasma and tissue (Figures 1(c) and 1(j)). However, when Mutant islets were challenged with high glucose concentrations (16.5 mmol/L), insulin secretion was almost absent or was nonresponsive unlike Leans and Controls which elicited a better secretory response under the same conditions. The ratio of basal/challenge secretion, depicting the islet cell functions, was also high in Mutant islets, compared to its Lean and Control counterparts (Figure 8(c)). As a positive control to 12-month Mutants, we have also calculated the ratio of basal/challenge secretion, from the 24-month Control rats (ratio = 1.03), with higher basal insulin secretion levels (24.75 ± 2.86) than when challenged with high glucose (24.13 ± 3.12), and the islets were nonresponsive similar to the findings from 12-month-old Mutant rats (Figure 8(c)).
3.5.3. Ultrastructural Studies (SEM/TEM)
SEM data revealed spherical and globular pancreatic β-cells amongst the phenotypes, but fine perforations with ruffles on the islet surface were more prominent with Mutant islets, as Lean and Control islets demonstrated a smooth surface with no such perforations (Figure 8(b)).On similar lines, TEM photographs showed electron dense spherical secretory granules for insulin among Leans and Controls, while Mutants showed a comparatively less number of the secretory granules with distinct degranulation and vacuolation in the islet region (Figure 8(b)).
3.6. Correlation Analysis
Bivariate 2-tailed correlation analysis of metabolic health measures such as HOMA-IR and QUICKI with other physiological parameters revealed a significant correlation between IR indices-HOMA-IR and QUICKI, with body weight, pancreatic tissue weight, FPG, FPI, plasma and tissue TBARS, tissue insulin levels, islet size, and islet AI at P < 0.01. These results have been summarized in Table 1.
Table 1
Correlation matrix of anthropometric versus physiological parameters.
Body weights
Pancreas weights
HOMA-IR
QUICKI
FPG
FPI
Plasma TBARS
Tissue TBARS
Tissue insulin
Islet size
Apoptotic index
Body weights
Pearson correlation
1
Sig. (2-tailed)
.
Pancreas weights
Pearson correlation
0.700**
1
Sig. (2-tailed)
0.000
.
HOMA-IR
Pearson correlation
0.893**
0.501**
1
Sig. (2-tailed)
0.000
0.000
.
QUICKI
Pearson correlation
—
—
—
1
0.678**
0.372**
0.765**
Sig. (2-tailed)
0.000
0.006
0.000
.
FPG
Pearson correlation
0.339*
0.123
0.431**
—
1
0.397**
Sig. (2-tailed)
0.012
0.376
0.001
0.003
.
FPI
Pearson correlation
0.884**
0.494**
0.995**
—
0.408**
1
0.751**
Sig. (2-tailed)
0.000
0.000
0.000
0.000
0.002
.
Plasma TBARS
Pearson correlation
0.818**
0.837**
0.626**
—
0.294*
0.601**
1
0.519**
Sig. (2-tailed)
0.000
0.000
0.000
0.000
0.031
0.000
.
Tissue TBARS
Pearson correlation
0.917**
0.821**
0.669**
—
0.178
0.658**
0.874**
1
0.482**
Sig. (2-tailed)
0.000
0.000
0.000
0.000
0.199
0.000
0.000
.
Tissue insulin
Pearson correlation
0.812**
0.827**
0.710**
—
0.221
0.702**
0.778**
0.800**
1
0.572**
Sig. (2-tailed)
0.000
0.000
0.000
0.000
0.108
0.000
0.000
0.000
.
Islet size
Pearson correlation
0.765**
0.700**
0.749**
—
0.275*
0.725**
0.696**
0.699**
0.702**
1
0.549**
Sig. (2-tailed)
0.000
0.000
0.000
0.000
0.044
0.000
0.000
0.000
0.000
.
Apoptotic index
Pearson correlation
0.924**
0.554**
0.971**
—
0.367**
0.964**
0.657**
0.745**
0.733**
0.760**
1
0.736**
Sig. (2-tailed)
0.000
0.000
0.000
0.000
0.006
0.000
0.000
0.000
0.000
0.000
.
The table shows the correlation analysis between metabolic health parameters and physiological parameters and demonstrates a strong correlation of HOMA-IR and QUICKI with body weights, pancreas weights, plasma and tissue insulin levels, and plasma and tissue TBARS levels (n = 54). The table also shows the correlation analysis for other metabolic and physiological parameters (n = 54). FBG: fasting blood glucose, FPI: fasting plasma insulin, HOMA-IR: homeostasis model of assessment for insulin, QUICKI: quantitative insulin sensitivity check index, TBARS: thiobarbituric acid reacting species.
**Correlation is significant at the 0.01 level (2-tailed).
*Correlation is significant at the 0.05 level (2-tailed).
4. Discussion
The present study demonstrates for the first time an age dependent (1–12 months) increase in hypertrophy, inflammation, and β-cell dysfunctions with significant degranulation of the insulin secreting cells in the pancreas from Mutants (obesity/IR/HI) which otherwise show distinct features of obesity and IR [7]. These observations are noteworthy in view of the recent reports defining obesity and IR as a state of profound inflammation and oxidative stress [24]. Interestingly, the present evidence for an early onset of degenerative-like changes was very much appreciable in Mutants which show features of “kinky tail,” a rare trait [3], overweight (Figures 1(a)-1(b)), tissue hypertrophy/hyperplasia (Figures 1(g)–1(i)), inflammation (Figure 4), and apoptosis (Figure 5). These changes very much complement the chronic inflammatory conditions and related metabolic disorders [1] well illustrated in this animal model (Table 1). Several etiological factors such as environmental, genetic, and epigenetic factors [1] in addition to IR have been shown to alter the functions of adipose and muscle tissues eventually causing altered glucose homeostasis [9] and thereby impairing islet cell functions and integrity, a phenomenon well noted in T2D [10].Using cellular, molecular, and morphological approaches, we have been able to demonstrate the coprecipitation of several confounding factors in Mutant pancreas noted by extensive vascularization (Figures 1(g) and 1(h)), interlobular septa with fat accumulation (Figures 1(g) and 1(h)), increased macrophage infiltration (CD11b) (Figures 4(a)–4(e)), and proinflammatory cytokines (TNFα and IL-6) (Figures 4(a)–4(i)) when compared to its Lean and Control. Inflammation as an intrinsic mechanism to facilitate towards islet dysfunction has been well correlated with frank diabetes and hyperglycemia in T1D [27], obese T2D [28], and T2D with IR [28], unlike our present model system demonstrating euglycemia with obesity/IR [3, 6] suggestive of the preclinical scenario in human subjects [29]. Earlier studies from our institute have shown an altered immune status in the WNIN Mutant rats (WNIN/Ob and WNIN/GR-Ob) in terms of percentages of splenic CD8+ T cytotoxic cells in males and splenic CD3+ T lymphocytes and CD4+ T helper cells in females, respectively, and in response to vaccination [30, 31]. CD11b studied here is a macrophage marker that is highly expressed as a surface marker of activation on resting monocytes along with others such as CD11c and HLADR [32] which correlates with the increased macrophage and T-cell activation among Mutants and with age. This is further confirmed from the observed increased expression of inflammatory cytokines, IL-6 and TNFα, released by activated macrophages. TNFα has been implicated as a key molecule to facilitate insulin-mediated glucose uptake at peripheral tissues [33] and the increased expression of TNF-α (Figures 4(a)–4(e)) could however be partly responsible for the marked increase in macrophage infiltration (Figures 4(a)–4(e)) and IL-6 expression that we have observed from the Mutant pancreas (Figures 4(f)–4(i)). Indeed, TNFα has been reported to upregulate IL-6 in murinepancreatic islets [34] and IL-6 has been shown to be infiltrated in islets both before and during immune infiltration in NOD mice suggesting its pathogenic role, closely correlating to target β-cells [35]. Further, overexpression studies in NOD mice have also demonstrated the interplay of IL-6 with proinflammatory cytokines (e.g., TNFα) leading to β-cell dysfunction [35]. Increased localization of CD11b with a concomitant upregulated expression of downstream inflammatory markers IL-6 and TNFα observed here in the Mutant pancreatic islets unequivocally demonstrates an activated macrophage phenotype in the pancreatic islets/tissue and is probably responsible for the localized pancreatic tissue inflammation among Mutants which gets worsened with the severity of disease (obesity) and with age. These observations are in line with the observations on human subjects [36, 37] and other animal models such as ob/ob and db/db mice, fa/fa rats, and obese diabetic Wistar fatty rats [31].The inciting events that cause systemic inflammation and IR, the two cardinal features of the MS, remain unknown. According to one school of thought, factors secreted by hypertrophied mature adipocytes (within white adipose tissue (WAT))/the intraexocrine fat [35] (Figure 1(g)) could be one such causative agent or it could be due to chemokines secreted by fat cells (monocyte chemoattractant protein- 1, leptin, etc.,) normally overexpressed in obesity [38, 39]. In addition, leptin is known to have pleiotropic effects on immune cell activity by (a) promoting macrophage phagocytosis; (b) increasing secretion of proinflammatory cytokines such as TNF-α (early), IL-6 (late), and IL-1 by macrophages; (c) increasing expression of surface markers of activation HLADR, CD11b, and CD11c on monocytes; (d) stimulating monocyte, proliferation and upregulating the expression of CD38, CD69, CD25 (IL-2 receptor a-chain), and CD71 (transferrin receptor) (activation markers); (e) stimulating chemotaxis of polymorphonuclear cells by producing ROS; and (f) playing a role in NK cell development, differentiation, proliferation, activation, and cytotoxicity [39-41]. Although the mechanism(s) are obscure, we have shown an increased infiltration of macrophages within the pancreas [35] with prolonged obesity (12 > 6 > 1 months) and this was correlating with indices for obesity (2-3-fold)/IR (1.5–3-fold)/HI (2-3-fold) for Mutants [42] as compared to their Leans and Controls (Figure 1). The fact that inflammation is the central mechanism operating in both obesity and IR [43] has been demonstrated from our earlier findings (6 months old) in AT [7] and BM-MSCs [8] from the same animal model. In similar lines transcriptional profiling analysis from obesemice also correlated with adiposity and infiltration of macrophages [44]. With advancing age, the pancreas in such genetic models could undergo alterations such as hypertrophy, fibrotic-like changes, and fatty infiltration because of oxidative damage (Figures 1(f) and 1(k)). However, the pancreas in Leans and Controls showed mild (a) hypertrophy (Figures 1(g) and 1(h)), (b) fibrotic-like changes (Figures 1(g) and 1(h)), and (c) intermittent scanty macrophages (Figures 4(a)–4(e)) which could be related to the aging process [3, 45]. The sequel of events reported here, for example, (a) increased insulin immunolocalization (Figures 2(a)–2(f)), (b) increased insulin to glucagon ratio (Figure 2(h)), (c) mRNA levels of Insulin (Figures 6(a) and 6(c)), (d) downregulation of Pdx-1 expression (Figures 6(b) and 6(d)), (e) HI (Figure 1(c)), and (f) increase in β-cell size/β-cell volume (Figure 2(i)) [46], advocates for in situ inflammation with Mutants, which probably accounts for β-cell dysfunction. Studies have demonstrated a decreased expression and/or DNA binding activities of MafA and PDX-1 in diabetes and chronic hyperglycemia which present a gradual deterioration of pancreatic β-cell function [47]. Pdx-1 is known to control the expression of two key genes-Insulin and Glut-2 which are required for the integrity and function of islet cells. Pdx-1 is a common transcription factor required for β-cell development, differentiation, function, and pancreatic regeneration. The vulnerability of PDX-1 to the oxidative stress (suppression) has been well demonstrated both in vitro in HIT cells 36 and in vivo in the partially pancreatectomized rats exposed to chronic hyperglycemia [11, 48].Pancreatic β-cells are constantly exposed to a great demand for insulin production, and ER has been reported to play a critical role towards preserving β-cell functions and differentiation [49, 50]. It is of utmost importance to note that β-cells have weak inherent antioxidant systems compared to other organs in the body making them highly vulnerable to the deleterious effects of oxidative stress [11]. Addressing these issues, we have demonstrated with age an increase in RL-77 (ER stress) (Figures 3(b), 3(e), and 3(f)), TBARS (Figures 1(f) and 1(k)), and HSP-104 (Figures 3(a), 3(c), and 3(d)) in these Mutants (compared to their Leans and Controls) with a concomitant increase in expression of stress proteins including ER [51] and HSPs [15, 50, 52]. In similar lines in vitro experiments, using insulinoma cells [53] and primary islet cells [53] also demonstrates pancreatic β-cell dysregulation or death [54] with upregulation of UPR genes. As shown in Figure 5, age dependent degenerative changes and apoptosis (TUNEL assay) seem to have played an important role in increased β-cell vacuolation (12 months > 6 months > 1 month) in Mutants (Figures 1(g) and 1(h)). Interestingly, the accelerated aging process has been a well-documented phenomenon in these Mutants with their average life span shortened to 1.5 yrs compared to 2.5–3 years seen in Controls and Leans [3] and the phenomenal increase in episodes of cataract [6, 55], cancers [6], infertility [56], and immune dysfunction [30] playing a critical role to shorten their lifespan as given in Figure 9.
Figure 9
Comparison between 12-month Mutants and 24-month Control rats (metabolic and physiological). Data shows comparison of metabolic and physiological parameters as compared to 24-month old Control rats. Panel (a) depicts fold change for body and pancreatic tissue weights, fasting plasma glucose (FPG), fasting plasma insulin (FPI), homeostasis model assessment for insulin resistance (HOMA-IR), quantitative insulin sensitivity check index (QUICKI), tissue insulin, plasma and tissue thiobarbituric acid reacting species (TBARS), and islet size. Panel (b) depicts the fold change for insulin to glucagon ratio, inflammatory marker (CD11b, TNFα, and IL-6) fluorescent intensities, PDX-1 expression, apoptotic index, and ratio of basal to stimulated insulin secretory levels.
To obtain further insights underlying altered pancreatic milieu, we next examined functional responses (with age) and ultrastructural changes (only 12 months) using primary islet cell cultures isolated from these phenotypes. Mutant islets depicted inflammatory milieu evidenced by their nonresponsiveness to high glucose challenge (16.5 mmol/L) >6 and 12 months (Figure 8(c)) [57]. The perturbations noted with functional responses of islets to glucose challenge could be a multifactorial effect and can be attributed to a reduced threshold of the β-cells under chronic conditions [58] and islet hypertrophy [59] or can be due to the functional loss of insulin receptor [60], hypertriglyceridemia [61], inflammation [6], hyperleptinemia [62], oxidative stress [63], and IR [29]. Higher basal insulin levels (5.5 mmol/L glucose) observed with Mutant islets at all ages (1/6/12 months) (Figure 8(c)) could probably be noted as a compensatory response initiated by β-cells resulting in HI [45] or by insulin hypersecretion under substimulatory conditions [61, 62].Ultrastructural analysis of the primary islet cells (12 months) revealed significant inflammatory/apoptotic responses in Mutants evidenced by a disrupted outer collagenous layer (SEM) and this data was complemented with TEM findings for increased islet cell degranulation evidenced in Mutant islets (Figure 8(b)). Interestingly, data generated from model systems such as Zucker fatty rats [64] and sand rats [65] have advocated for an increased macrophage accumulation [66] and IL-6 expression [66] in β-cells themselves [38], contributing to islet cell impairments suggestive of a prediabetic state [51]. Systemic elevation of IL-6 cytokine in obesity has been identified as the risk/predictive factor for development of T2D [35] akin to our present observations. Further, in vitro studies [35] show that increased expression of IL-6 renders inhibition of glucose-stimulated insulin secretion [35], albeit that results have not been consistent.Interestingly we have attempted here to integrate and correlate metabolic health measures of HOMA-IR and QUICKI amongst the phenotypes (Table 1) with other measures such as body weight, fasting plasma glucose, fasting plasma insulin, pancreatic tissue TBARS, islet size, and islet apoptotic index. to arrive at a significant correlation of metabolic insult to be associated with the Mutant trait, as compared with its Lean and Control.
5. Conclusions
Our findings in situ and in vitro authenticate the use of WNIN/Ob Mutant model as an optimal system for studying MS (obesity/IR/T2D) and its complications which are increasing worldwide at an alarming rate. These findings pave the way to explore the efficacy and feasibility of using these mutant rats as a valuable resource (model systems) in the management of obesity and metabolic syndrome.
Authors: Yoshifumi Saisho; Alexandra E Butler; Erica Manesso; David Elashoff; Robert A Rizza; Peter C Butler Journal: Diabetes Care Date: 2012-08-08 Impact factor: 19.112
Authors: Claudinéia C S Franco; Kelly V Prates; Carina Previate; Ana M P Moraes; Camila C I Matiusso; Rosiane A Miranda; Júlio C de Oliveira; Laize P Tófolo; Isabela P Martins; Luiz F Barella; Tatiane A Ribeiro; Ananda Malta; Audrei Pavanello; Flávio A Francisco; Rodrigo M Gomes; Vander S Alves; Veridiana M Moreira; Késia P Rigo; Douglas L Almeida; Juliane R de Sant Anna; Marialba A A C Prado; Paulo C F Mathias Journal: Endocrine Date: 2017-02-23 Impact factor: 3.633