Literature DB >> 24453554

Testing the performance of a fragment of the COI gene to identify western Palaearctic stag beetle species (Coleoptera, Lucanidae).

Karen Cox1, Arno Thomaes1, Gloria Antonini2, Michele Zilioli3, Koen De Gelas4, Deborah Harvey5, Emanuela Solano2, Paolo Audisio2, Niall McKeown6, Paul Shaw6, Robert Minetti7, Luca Bartolozzi8, Joachim Mergeay1.   

Abstract

THE TAXONOMY OF STAG BEETLES (COLEOPTERA: Lucanidae) remains challenging, mainly due to the sexual dimorphism and the strong allometry in males. Such conjecture confounds taxonomic based conservation efforts that are urgently needed due to numerous threats to stag beetle biodiversity. Molecular tools could help solve the problem of identification of the different recognized taxa in the "Lucanus cervus complex" and in some related Palaearctic species. We investigated the potential use of a 670 bp region at the 3' end of the mitochondrial cytochrome c oxidase subunit I gene (COI) for barcoding purposes (different from the standard COI barcoding region). Well resolved species and subspecies were L. tetraodon, L. cervusakbesianus, L. c. laticornis, as well as the two eastern Asian outgroup taxa L. formosanus and L. hermani. Conversely, certain taxa could not be distinguished from each other based on K2P-distances and tree topologies: L. c. fabiani / L. (P.) barbarossa, L. c. judaicus / an unknown Lucanus species, L. c. cervus / L. c. turcicus / L. c. pentaphyllus / L. (P.) macrophyllus / L. ibericus. The relative roles of phenotypic plasticity, recurrent hybridisation and incomplete lineage sorting underlying taxonomic and phylogenetic discordances are discussed.

Entities:  

Keywords:  COI; DNA barcoding; Lucanus spp.; Stag beetle; Western Palaearctic

Year:  2013        PMID: 24453554      PMCID: PMC3890674          DOI: 10.3897/zookeys.365.5526

Source DB:  PubMed          Journal:  Zookeys        ISSN: 1313-2970            Impact factor:   1.546


Introduction

Lucanidae Latreille, 1804 is a family of Coleoptera showing in most species pronounced sexual dimorphism and strong external morphological allometry in males. The species of the Holarctic and Oriental distributed genus Scopoli, 1763 are renowned for the striking appearance of the males. With their large body size and prominent mandibles, the male stag beetles are very popular among amateur entomologists and as terrarium pets, mainly in Japan. Currently, there are more than 90 species described, however, validity of these designations is considered questionable in many cases. Sexual dimorphism and size variation complicate the taxonomy (Didier and Séguy 1953, Clark 1977, Harvey and Gange 2006), as does the lack of informative phenotypic characters among larvae. Consequently, their classification has changed over time and is still under discussion. In this study we focus on taxa of the species in the western Palaearctic. The genus is subdivided into the subgenera sensu stricto and Hope & Westwood, 1845. Members of the latter have a peculiar stout body and substantial analogy of morphology that makes it quite easy to distinguish them from members of the subgenus (Planet 1899). The male mandibles of are sickle shaped, their internal edge has a single denticle in most species ( has small denticles and one large denticle) and the apex is usually simple ( is mostly bifid) (Planet 1899, Baraud 1993). Furthermore, the integument of is relatively smooth with scattered and superficial punctuation whereas it is more stippled in . Also, the sides of the pronotum of are strongly sinuate before the posterior angles (Baraud 1993). Previous studies (Didier and Séguy 1953, Benesh 1960, Krajcik 2001, Bartolozzi and Sprecher-Uebersax 2006, Hallan 2008, Fujita 2010) describe between four and seven species of in western Palaearctic: i.e. (Linnaeus, 1758), Motschulsky, 1845, Kraatz, 1860, Thunberg, 1806, Fabricius, 1801, Planet, 1909 and Kraatz, 1860. The distribution of many of these taxa remains poorly resolved, however, we can consider some of them as endangered. The practice of removing old trees and dead wood in past and current forest management, has had detrimental effects on this group of saproxylic beetles (Jansson and Coskun 2008, Nieto and Alexander 2010). ConPageBreaksequently, the loss of habitat might have reduced the range of some taxa, especially the Mediterranean taxa where deforestation started a few millennia ago (Jansson and Coskun 2008, Buse et al. 2010). At least seems to be able to cope with urbanisation (Thomaes et al. 2008) as long as the habitat turnover allows recolonisation (Thomaes 2009). In addition, beetle collecting can be considered as a threat when it goes hand in hand with large scale habitat destruction or when species rarity causes overexploitation (Holden 2007, Tournant et al. 2012). Another possible consequence of the international stag beetle trade is the introduction of non-native specimens which may cause genetic introgression (Goka et al. 2004) and transmission of parasites potentially pathogenic to native stag beetles (cf. Goka et al. 2004, Kanzaki et al. 2011). Unfortunately, legal protection is often missing or inadequate. The widely distributed is protected by the Habitats Directive of the European Union from 1992 (Luce 1996) and is listed as “near threatened” in the Red Data list of Europe (Nieto and Alexander 2010). and are mentioned in the IUCN list, but are rated “of least concern” (IUCN 2012), while is considered to be “vulnerable” within the EU 27 (Nieto and Alexander 2010). More detailed information on the distribution and ecology of this species group is needed to get a clear view on their conservation status. But unless the problem of identification of European and West Asian is solved, it becomes difficult to set specific conservation priorities, without which rare, neglected and endangered species or Evolutionarily Significant Units (ESUs) may be unrecognised and thus, not given adequate conservation prioritisation (Ryder 1986, Waples 1991, Moritz 1994a, Moritz 1994b, Fraser and Bernatchez 2001). Molecular tools could help identification of stag beetles. The mitochondrial cytochrome c oxidase subunit I (COI) is the most widely used gene in barcoding animals (Hebert et al. 2003). The barcoding practice entails the analysis of the DNA sequence of a part of this mitochondrial gene, typically between 600 and 900 bp. In this study, we investigated the use of the 3’ end of the COI gene, different from the standard barcoding region, for the identification of western Palaearctic species and subspecies.

Material and methods

Taxonomy and morphology

has the widest geographical distribution in the genus and is very variable in form, size and colour (Harvey et al. 2011). Many subdivisions (i.e. subspecies or morphotypes) have been proposed and discussed. (Linnaeus, 1758), the main subspecies found throughout Europe, has, in general, four lamellae on the antennal clubs and is typically bicoloured (black head and thorax, and reddish brown elytra and mandibles). Planet, 1896 with generally six lamellae and large mandibles with a very open apical fork, inhabits southern Turkey and Syria. Sturm, 1843 also has a six lamellate club, but its mandibles are comparable to . It is reported in Greece, Bulgaria and Trakya (European part of Turkey). Furthermore, Planet, 1902 with a four lamellate club and reddish brown colour, is found in the more eastern parts of Turkey and in northern Syria. Deyrolle, 1864, found in central and southern Turkey, has six long lamellae and the inner denticle of the mandibles is followed by two or three denticles. Mulsant & Godart, 1855 is an endemic taxon inhabiting southern France and shows a five lamellate club and slender, slightly curved mandibles with a simple apex and post-median denticle along with a few other denticles. The taxa and Reiche, 1853 are listed as synonyms of by Bartolozzi and Sprecher-Uebersax (2006), but could well be considered as a valid species according to Boucher (unpublished data) while may represent a small form of with five lamellate clubs, a character that can also be found in . Other taxa [ Motschulsky, 1845 (described from Crimea), Planet, 1897 (Kurdistan), Lacroix, 1978 (Georgia) and Mulsant, 1839 (France)], recognised by some authors as valid subspecies or simple synonyms, were not included in this study. Bartolozzi and Sprecher-Uebersax (2006) only list and as separate subspecies. Hallan (2008) adds akbesianus, fabiani, mediadonta, tauricus and , while Krajcik (2001) further includes and , although Schenk and Fiedler (2011) perceived as a separate species. On the other hand, Didier and Séguy (1953) also list Fuessly, 1775 (considered a small form of ) and while Fujita (2010) only recognises but does not list and or the [pentaphyllus + fabiani + pontbrianti] complex. can be found from Albania to Iran and is sometimes considered a synonym of . Unlike , is entirely reddish brown, has a pronotum without a smooth discal line, but with a sinuate posterior and distinct toothed posterior angles (non-sinuate pronotum and blunt angles in ). The mandibles of the males, which are shorter than those of a typical male of equal size, can have an apex with two equal teeth or with the inner tooth fainted and a large internal denticle in the middle. In addition, has six, rarely five, long lamellae on the antennal club. described from France, Italy, North Africa, Albania and Greece, can be perceived as a central Mediterranean species. In contrast to and , the basal denticle of the mandibles of is placed in the lower half. Like , the pronotal sides have sharp posterior angles, but the pronotal disc misses the central smooth line. has six, occasionally five, lamellae on the antennal club. is by some authors subdivided in subspecies Maes, 1995 in North Africa, Colas, 1949 in South France, Gautier des Cottes, 1860 in Corsica, Planet, 1899 in Sicily and finally Thunberg, 1806 elsewhere. In addition, specimens of problematic populations of from a series of localities in central Italy (northern Latium and Umbria), are known to exhibit apparently intermediate morphological characters between and , which are sympatric in these areas (Santoro et al. 2009). The species all have six long lamellae forming the antennal club, their body is stout and entirely reddish or blackish brown. Included in this study are from the Iberian peninsula and the Maghreb, and reported in south-west Turkey. Krajcik (2001) and Hallan (2008) list the latter as a subspecies of . Schenk and Fiedler (2011) recently quoted populations of in western Turkey, but this taxon is not included in this study.

Taxon sampling and DNA extraction

A large number of entomologists was contacted to obtain material from the different taxa and from different regions. The samples included whole beetles, especially in regions where identification is problematic, as well as parts of a beetle, sometimes found as road kill or as prey leftovers from birds. Samples were dried and kept at room temperature or preserved in absolute ethanol. In total 76 samples were collected. The species identification was performed, using comparative material and available identification keys. Six samples from Israel and Lebanon could not be identified to species. These unidentified specimens have a shape resembling in general the medium to small males of but with a mandibular structure similar to that of (Zilioli et al. unpublished data). The tissue samples used for DNA extraction depended on what was available, but were mostly legs, which contain large muscles and are therefore rich in mitochondrial DNA (mtDNA). DNA was extracted from ground samples with the E.Z.N.A.® Forensic DNA Kit (Omega Bio-Tek), except for samples K1 and U6 (Table 1) from which DNA was extracted following the pan class="Chemical">salting out procedure described by Aljanabi and Martinez (1997). The integrity of the extracted DNA was checked spectrophotometrically on a ND-1000 Nano-Drop (NanoDrop Technologies) and its quality on 1% agarose gels.
Table 1.

List of samples included in the analysis. Primers used are denoted with ‘1’: C1-J-2183 and TL2-N-3014; ‘2’: LCint1F, LCint2F, LCint3F and LCint4F (for sample SB6 also the reverse primers were used); ‘3’: F - 5’ GGGGCATCAGTAGACCTAGC 3’ and R – 5’ TTCAGCAGGTGGTATTAGTTGG 3’.

Species / subspeciesCodePrimersHaplotypeGenBank acc. no.CountryLatitudeLongitudeDate of samplingType of conservationGender
Lucanus cervus akbesianusUA11UA1KF737127Turkey37.721833, 30.828278Jun 2010ethanolFemale
UA21UA2KF737128Turkey37.721833, 30.828278Jun 2010ethanolMale
UA31UA3KF737129Turkey37.721833, 30.828278Jun 2010ethanolMale
UA41UA4KF737130Turkey37.676200, 35.8621002010ethanolMale
UA51UA5KF737131Turkey37.676200, 35.8621002010ethanolMale
UX12UX1KF737132Turkey36.900000, 31.000000Jun 2010ethanolMale
U101U10KF737125Turkey37.721833, 30.828278Jun 2010ethanolMale
U111U10KF737126Turkey37.721833, 30.828278Jun 2010ethanolMale
Lucanus cervus cervusA11A1KF737071Belgium50.772652, 4.537656Jul 2008ethanolMale
A31A3KF737072Belgium50.736622, 4.331784Jun 2009ethanolFemale
C12C1KF737093Czech rep.48.797935, 16.803576May 2009ethanolMale
D132A3KF737078France45.391800, 1.139310Jul 2010ethanolMale
D41D4KF737088France43.458090, 1.431787Aug 2010ethanolMale
D221D22KF737092France47.861145, 2.8203272009ethanolFemale
F121A3KF737079Greece39.808333, 22.653889Jun 2009ethanolFemale
F161F16KF737083Greece39.808333, 22.653889Jun 2009ethanolFemale
F231F23KF737082Greece39.762333, 21.663281Jun 2009ethanolMale
G32G3KF737081Hungary47.701586, 18.834592Jul 2009ethanolFemale
I21I2KF737084Italy45.779241, 8.732981Jun 2009ethanolMale
I31A3KF737080Italy45.779241, 8.732981Jun 2009ethanolMale
I41I4KF737085Italy45.779241, 8.732981Jun 2009ethanolMale
N31N3KF737086Portugal38.795900, -9.397390Jul 2010ethanolMale
O93O9KF737087Romania47.102400, 24.450700
S151S15KF737094Spain40.385100, -6.608460Aug 2009ethanolMale
S191A3KF737076Spain43.304009, -4.814970Jul 2009ethanolFemale
V21A3KF737077UK52.028936, 1.067369Aug 2009driedFemale
V263V26KF737091UK50.966300, -0.209294
V443V44KF737089UK51.260100, 0.844280
W92W9KF737090Ukraine49.826900, 36.325800Jun 2007driedMale
X1X1FJ606555France(Lin et al. 2011)
Lucanus cervus fabianiD111D11KF737121France43.195300, 5.753740Jun 2010ethanolMale
Lucanus cervus judaicusUJ11UJ1KF737112Turkey37.068100, 36.261600Jul 2010driedMale
Lucanus cervus laticornisUL21UL2KF737119Turkey36.875669, 30.457431Jun 2007ethanolMale
UL31UL3KF737120Turkey37.763600, 30.5589001995driedMale
Lucanus cervus pentaphyllusC21A3KF737075Czech rep.48.797935, 16.803576May 2009ethanolMale
F131F13KF737104Greece39.808333, 22.653889Jun 2009ethanolFemale
I11A3KF737073Italy45.779241, 8.732981Jun 2009ethanolMale
W72A3KF737074Ukraine48.950200, 38.497600Jul 2002driedMale
Lucanus cervus turcicusB11B1KF737096Bulgaria42.162733, 27.737650Jul 2009ethanolMale
B21B2KF737098Bulgaria41.407800, 25.578583Jul 2009ethanolMale
B71B7KF737099Bulgaria42.060792, 27.977000Jul 2009ethanolMale
B91B1KF737097Bulgaria42.120183, 27.900405
F152F15KF737105Greece39.808333, 22.653889Jun 2009ethanolMale
F71F7KF737107Greece39.866667, 22.733333Jun 2009ethanol
F82F7KF737108Greece39.866667, 22.733333Jun 2009ethanol
F91F9KF737106Greece39.808333, 22.653889Jun 2009ethanolFemale
F111F11KF737100Greece39.808333, 22.653889Jun 2009ethanolMale
F172F17KF737101Greece39.808333, 22.653889Jun 2009ethanol
F201F20KF737102Greece39.808333, 22.653889Jun 2009ethanolMale
F211F21KF737103Greece39.808333, 22.653889Jun 2009ethanolMale
U32U3KF737109Turkey41.800000, 27.950000Jul 2009ethanolMale
Unknown species of LucanusH12H1KF737116Israel33.217100, 35.753500Aug 2009ethanol (after freezing)Male
H21H2KF737113Israel33.217100, 35.753500Aug 2009driedFemale
H32H3KF737117Israel33.217100, 35.753500Jul 2009driedMale
H41H4KF737114Israel33.217100, 35.753500Jul 2009driedMale
H52H5KF737115Israel32.959600, 35.8645001998driedMale
J22J2KF737118LebanonJul 2009driedMale
Lucanus ibericusU61U6KF737110Turkey40.290300, 38.424200
Lucanus tetraodon provincialisD61D6KF737111France43.066700, 5.850000Jun 2010ethanolMale
Lucanus tetraodonX2X2EF487727(Hunt et al. 2007)
Lucanus (Pseudolucanus) barbarossaSB11SB1KF737122Spain40.828139, -3.831811Jul 2004dried, later on ethanolMale
SB62SB6KF737124Spain41.067361, -3.585322Sep 2010ethanolFemale
SB71SB7KF737123Spain36.885000, -3.982000May 2010ethanolMale
Lucanus (Pseudolucanus) macrophyllusUB12UB1KF737095Turkey36.501944, 33.089167Aug 2006driedMale
Dorcus parallelipipedus1K1KF737133Montenegro
X3DQ156023(Hunt et al. 2007)
Lucanus formosanusX4FJ606632(Huang and Lin 2010)
X5FJ606630
X6FJ606628
X5FJ606626
X5FJ606624
X5FJ606622
X8FJ606583
Lucanus hermaniX9FJ606552(Lin et al. 2011)

† sequences with a maximum of seven double peaks.

List of samples included in the analysis. Primers used are denoted with ‘1’: C1-J-2183 and TL2-N-3014; ‘2’: LCint1F, LCint2F, LCint3F and LCint4F (for sample SB6 also the reverse primers were used); ‘3’: F - 5’ GGGGCATCAGTAGACCTAGC 3’ and R – 5’ TTCAGCAGGTGGTATTAGTTGG 3’. † sequences with a maximum of seven double peaks.

Sequencing

We first attempted to sequence the COI barcoding region with the primers developed by Folmer et al. (1994) on a subset of samples. Despite PCR optimization trials, amplification of this fragment largely failed. Instead, a 800 bp fragment of the 3’ end of the COI gene was amplified using the primer set C1-J-2183 (5’ CAACATTTATTTTGATTTTTTGG 3’) and TL2-N-3014 (5’ TCCAATGCACTAATCTGCCATATTA 3’) (Simon et al. 1994). This fragment does not overlap with the standard barcoding region. For samples O9 and V44 (Table 1) we used species-specific primers (F - 5’ GGGGCATCAGTAGACCTAGC 3’ and R – 5’ TTCAGCAGGTGGTATTAGTTGG 3’), designed from sequences on GenBank and used to PCR amplify a 1089 bp stretch of the COI gene. Reactions were performed in total volumes of 40 µl containing 5.2 µl of 10 × Taq buffer with 500 mM KCl (Fermentas, Thermo Scientific), 3.12 µl of MgCl2 (25 mM), 0.78 µl dNTP (10 mM), 2.08 µl of each PageBreakPageBreakPageBreakPageBreakprimer (10 µM), 0.8 U Taq DNA polymerase (Fermentas, Thermo Scientific), 26.42 µl sterile distilled water. 12 µl of diluted DNA (3.5–5 ng/ µl) was added. The temperature cycle was 94 °C for 1 min, then 5 cycles of 94 °C for 1 min, 45 °C for 1 min 30 s and 72 °C for 1 min and 30 s. This was followed by 40 cycles of 94 °C for 1 min, 50 °C for 1 min 30 s and 72 °C for 1 min, and finally a single cycle at 72 °C for 5 min. PCR products were cleaned enzymatically with DNA Clean & ConcentratorTM-5 (Zymo Research). When samples failed to amplify, mostly dried or bad quality samples, internal primers were used to allow amplification of four overlapping fragments of about 250 bp within the same 3’ end of the COI gene: LCint1 (F – 5’ CTTCGGCCACCCAGAAGT 3’ and R – 5’ TCCAGTAGGAACAGCAATRAT 3’), LCint2 (F – 5’ CGAGCCTACTTCACATCAGC 3’ and R – 5’ GCAAAAACTGCACCTATTGAAA 3’), LCint3 (F – 5’ GCTCACTTCCATTATGTACTTTCAA 3’ and R – 5’ GAGAGCCAAATGATGAAATAATGTT 3’) and LCint4 (F – 5’ CCCTGATGCCTACACCACAT 3’ and R – 5’ CCAATGCACTAATCTGCCATA 3’). PCR amplification was performed in 2.6 µl of 10x Taq buffer with 500 mM KCl, 2.08 µl of MgCl2 (25 mM), 0.39 µl dNTP (10 mM), 2.6 µl of each primer (10 µM), 0.8 U Taq DNA polymerase (Fermentas, Thermo Scientific), 9.57 µl sterile distilled water, resulting in a total volume of 20 µl to which 6 µl of diluted DNA (3.5–5 ng/ µl) was added. The PCR reaction was then conducted with the following cycle: 94 °C for 3 min, then 45 cycles of 94 °C for 45 s, 59 °C for 45 s and 72 °C for 1 min 30 s, and finally a single cycle at 72 °C for 6 min. PCR products were checked on 2% agarose horizontal gels and purified using USB® ExoSAP-IT® (Isogen Life Science). DNA sequencing was performed by a commercial company (BaseClear, Leiden, the Netherlands) or on an automatic ABI 3500 Genetic Analyzer (Applied Biosystems). Both forward and reverse primers were used except when internal primers were used for PCR, in which case sequencing was performed using the respective forward primers (except for five samples of , where both forward and reverse primers were used). COI sequences available on GenBank were added. The COI sequence of obtained by Lin et al. (2011; GenBank acc. no. FJ606555) was used as a reference for the subspecies with the highest number of specimens in this study. We selected two Asian stag beetle species, Planet, 1899 and DeLisle, 1973, and (Linnaeus, 1758) (lesser stag beetle; Lucanidae) as outgroup species. Except for one available sample of the latter, the COI gene sequences of the taxa were obtained from GenBank (: Hunt et al. 2007; GenBank acc. no. DQ156023; : Huang and Lin 2010; GenBank acc. no. FJ606632, FJ606630, FJ606628, FJ606626, FJ606624, FJ606622, FJ606583; : Lin et al. 2011; GenBank acc. no.: FJ606552). In the study of Hunt et al. (2007) the Dorcinae formed a sisterclade of the Lucaninae. Finally, part of the COI sequence of obtained by Hunt et al. (2007; GenBank acc. no. EF487727) was used in addition to the sequence of . DNA sequences have been deposited in GenBank under accession numbers KF737071 to KF737133 (Table 1).

Alignment and sequence quality control

Overall quality of the sequences was evaluated manually. Only samples with high quality chromatograms for at least 300 bp were retained for further analyses. Sequences were aligned by hand and using CLUSTALW v1.4 (Thompson et al. 1994) in BIOEDIT v7.0.0 (Hall 1999). Sequences were trimmed to 670 bases. Duplicate haplotypes were removed using DUPLICATESFINDER v1.1 (http://bioinfotutlets.blogspot.be/2009/09/duplicates-finder-java-standalone.html). We searched for potential NUMTs (nuclear mitochondrial pseudogene sequences) or heteroplasmy by manually checking for the presence of double peaks and indels, and by looking for stop codons (Song et al. 2008, Calvignac et al. 2011) using MEGA c5.01 with the implemented invertebrate mtDNA genetic code to translate the sequences (Tamura et al. 2011). We only retained sequences with a maximum of 7 polymorphic positions, which were treated as ambiguities. Finally, we constructed a Neighbour-Joining (NJ) tree with MEGA5 using 10 000 bootstraps, based on Kimura’s 2-parameter distances (K2P) (Kimura 1980). For comparison, a Bayesian inference approach (BI) was used as well. The Bayesian analysis was conducted with MRBAYES v3.1.2 (Huelsenbeck and Ronquist 2001, Ronquist and Huelsenbeck 2003) under the GTR+I+G model, simulating 4 Monte Carlo Markov Chains (MCMC) for 2 000 000 generations each. Trees were sampled every 100 generations and the first 300 000 generations were excluded as burn-in. A consensus tree was constructed with posterior probabilities. The MRBAYES analyses were carried out on the Bioportal at Oslo University (http://www.bioportal.uio.no). The GTR+I+G model used in MRBAYES is closely related to the TIM3+I+G model, which was selected by JMODELTEST v0.1.1 (Guindon and Gascuel 2003, Posada 2008) as the best-fit model under the Akaike information criterion (AIC).

Genetic distances and nucleotide diagnostics

As K2P-distance is the most commonly used distance metric in DNA barcoding (Hebert et al. 2003), it was employed here for comparison. It allows to compare the behavior of the DNA fragment we used to the standard barcode region which is situated in the same gene. When possible, simple nucleotide diagnostics were identified for each (sub)species. If less than two simple nucleotide diagnostics were present (Sarkar et al. 2002), a compound diagnostic was detected using the algorithm of Wong et al. (2009).

Results

Alignment and sequence quality

Of a total of 76 samples, thirteen samples with low quality sequences were removed: five PageBreak, one , three and four . Three sequences showed a few double peaks: one (SB6: 5 ambiguous sites), one (UB1: 7 ambiguous sites) and one unidentified species of (J2: 2 ambiguous sites) (Table 1). None exhibited indels or stop codons which are indicative of the presence of NUMTs (Buhay 2009). The remaining 63 samples and 11 sequences obtained from GenBank are listed in Table 1. The final alignment entailed 74 sequences, representing 60 haplotypes. Incomplete sequences were obtained for the following taxa: taxon H4 with 500 bp of which the reverse sequence failed and taxon J2 of which forward sequences of only the first and third smaller fragments could be produced, resulting in a total of 383 bp. Both taxa were specimens of the unidentified specimens (Table 1). Likewise, the sequence of found in GenBank (named X2), was 122 bp short at the 3’ end. One other taxon, H3 ( sp.) missed a mere 5 bp at the 5’ end. Both the NJ tree and the BI tree showed the same overall configuration (Figure 1 and Appendix 1, respectively) except for the position of the unidentified specimens. In the NJ tree these specimens fall into two clusters with unresolved affinities (Figure 1). In the BI tree they form a single well-supported clade together with specimens identified as and (Appendix 1). The unidentified specimens fail to form a single monophyletic cluster as one subclade also includes . The BI tree showed to be monophyletic with probability 1, instead of paraphyletic as was shown in the NJ tree with bootstrap support below 70%. In both trees, several species as well as subspecies fall into distinct clades, whereas , , , and cluster in the same shallow clade (called the ‘ clade’ hereafter). In addition, three out of four samples of share a haplotype with (haplotype A3) which is the most common haplotype among sequences (Table 1). Within this clade , and are polyphyletic. Unexpectedly, one sample of and the sample of are also embedded in this clade. Looking at the sequences, they only differ from haplotype A3 at their five and seven ambiguous sites, respectively. Because the two other specimens of form a separate clade with , sample SB6 is excluded from further calculations but will be discussed below.
Figure 1.

Bootstrap consensus NJ tree inferred from 10 000 replicates, with a cut off value of 70%, based on K2P-distances between 60 haplotypes of the 3’ end of the COI gene.

Bootstrap consensus NJ tree inferred from 10 000 replicates, with a cut off value of 70%, based on K2P-distances between 60 haplotypes of the 3’ end of the COI gene.

Genetic distances

The nucleotide composition of all the sequences was AT-rich, with 29.5% A, 35.2% T, 15.5% G and 19.7% C. There were 36.4% nucleotide sites variable and 12.1% variable amino acid sites, of which 94.3% and 77.8% were parsimony informative, respectively. When was excluded from the dataset, variable sites decreased to 33.3% for nucleotides and 7.2% for amino acids (94.2% and 56.2% parsimony informative, respectively). Nucleotide composition and K2P-distances calculated for each codon position are shown in Table 3.
Table 3.

Nucleotide composition and K2P-distances at each codon position of the 670 bp COI region.

Codon position
1st2nd3rd
% A31.418.938.2
% T26.642.536.6
% G25.616.24.9
% C16.422.420.4
K2P-distance0–0.1070–0.0320–0.999
Although specimen J2 of the unidentified specimens of PageBreakPageBreak clustered with the other specimens of the same taxon in the NJ and BI trees, the pairwise interspecific K2P-distances with J2 differed substantially from those with H1 to H5 (comparisons with not included). More specifically, the minimum pairwise interspecific K2P-distance between J2 and the other unidentified taxa was 0.064 opposed to 0.087–0.095 when taking H1 to H5 into account. J2 is one of three incomplete sequences and missing information from position 179 to 399 in the sequence of J2 where several simple nucleotide diagnostics are present (Appendix 2). Therefore, this sample was removed from the dataset for subsequent analysis. The congeneric interspecific K2P-distances between the western Palaearctic taxa and the eastern Asian species and range from 0.156 to 0.198. Distances between taxa of and went from 0.211 until 0.259. K2P-distances within and between the investigated western Palaearctic taxa of are shown in Table 2. As indicated by the NJ and BI trees, the taxa , , and cannot be distinguished based on the COI fragment; K2P-distances range from 0 to 0.021, and all taxa are reciprocally polyphyletic. Whereas the first three subspecies of are distinguished solely on the basis of the number of lamellae on the antennal club, is morphologically much more distinctive, resembling . Although is part of the clade, it shows slightly higher K2P-distances with the other members of this clade (0.028–0.032). Note that we only had a single specimen. Moderate to relatively high within (sub)species distances were found for (0.085), certain specimens of the unidentified sp. (max. 0.054) and (0.53). On the other hand, between the latter and a small to moderate distance exists (0.004 and 0.058). This is also the case between taxa H2 and H4 of the unknown sp. and (K2P-distance of 0.018 and 0.016, respectively). The remaining distances between (sub)species ranged from 0.087 and 0.179.
Table 2.

Intra- and interspecific K2P-distances for the 670 bp COI gene of western Palaearctic (sub)species. NA: intraspecific K2P-distance cannot be presented because only one sample is available.

Lucanus cervus cervusLucanus cervus pentaphyllusLucanus cervus turcicusLucanus cervus fabianiLucanus cervus akbesianusLucanus cervus judaicusLucanus cervus laticornisLucanus ibericusLucanus tetraodonLucanus (Pseudolucanus) macrophyllusLucanus (Pseudolucanus) barbarossaunknown Lucanus sp.
Lucanus cervus cervus0–0.018
Lucanus cervus pentaphyllus0–0.0180–0.014
Lucanus cervus turcicus0.001–0.0210.003–0.0170–0.017
Lucanus cervus fabiani0.161–0.1670.160–0.1630.159–0.169NA
Lucanus cervus akbesianus0.118–0.1610.121–0.1550.121–0.1650.159–0.1740–0.045
Lucanus cervus judaicus0.151–0.1640.153–0.1600.155–0.1700.1670.144–0.154NA
Lucanus cervus laticornis0.134–0.1600.134–0.1550.132–0.1640.162–0.1650.135–0.1500.089–0.0940.085
Lucanus ibericus0.029–0.0390.034–0.0350.028–0.0370.1740.132–0.1510.1740.141–0.168NA
Lucanus tetraodon0.125–0.1290.124–0.1280.122–0.1300.168–0.1790.098–0.1230.151–0.1560.132–0.1510.131–0.1360.024
Lucanus (Pseudolucanus) macrophyllus0–0.0120–0.0140.006–0.0150.1590.116–0.1410.1470.130–0.1450.0280.120–0.124NA
Lucanus (Pseudolucanus) barbarossa0.153–0.1630.155–0.1610.155–0.1670.004–0.0580.127–0.1710.153–0.1650.146–0.1670.166–0.1720.159–0.1770.149–0.1570.053
unknown Lucanus sp.0.091–0.1620.093–0.1590.95–0.1680.143–0.1720.119–0.1500.016–0.0660.088–0.1130.109–0.1690.120–0.1520.087–0.1470.136–0.1700.002–0.054
Intra- and interspecific K2P-distances for the 670 bp COI gene of western Palaearctic (sub)species. NA: intraspecific K2P-distance cannot be presented because only one sample is available. Nucleotide composition and K2P-distances at each codon position of the 670 bp COI region. These results do not show a distinct barcoding gap or other threshold to distinguish putative species, which is chiefly due to a lack of phylogenetic resolution to differentiate the said species and subspecies. If we consider the taxa of the clade to be members of the same species, 99.4% of all intra(sub)specific comparisons showed K2P-distances below 5% and 99.8% of the pairwise inter(sub)specific distances were above 5%. Nucleotide diagnostics are listed in Appendix 2. No diagnostic combination of nucleotide positions and characters were found for the taxa of the clade, not included. As the number of species and the sample size per species are rather limited, the nucleotide diagnostics should be considered with caution.

Discussion

The present study shows that the sequenced COI fragment could discriminate several of the investigated western Palaearctic PageBreakPageBreak species and alleged subspecies of . Well differentiated species and subspecies were , and , as well as the two eastern Asian species and . Difficulties in molecular identification remained between and , and the unidentified species, and between taxa of the clade. Although thoroughly sampled within their distribution range, and could not be discriminated with a barcoding approach. Likewise, three out of four samples of possessed the most common haplotype of . Next to introgression following recent or past hybridisation events, incomplete sorting of ancestral variation may be the reason for the polyphyletic pattern. It is not known if can be infected with the endosymbiotic bacteria , which can cause mitochondrial introgression between closely related species (e.g. Whitworth et al. 2007). Nonetheless, infections with are quite common among insects, and should be taken into account (Hilgenboecker et al. 2008). However, the shift from four to five or even six lamellar segments on the antennal club is, at least in this tree of maternal inheritance, not synapomorphic among all individuals, and the number of lamellae may represent a case of parallel evolution or a phenotypically plastic trait within , such that and may merely represent morphotypes of . This hypothesis seems less likely for . Although this taxon’s haplotype only differed from the main haplotype, A3, by its seven ambiguous sites, it has a very distinct morphology. The same can be said about , which was part of the same clade, but showed higher pairwise K2P-distances (0.028–0.032) when comparing it to the other taxa of the clade. Lumping and together with the subspecies , and seems therefore ill advice. Like PageBreak, one sample of , SB6, was embedded in the clade, opposed to the other two samples that clustered with . The taxa of the latter group showed K2P-distances between 0.004 and 0.058, which indicates a close relationship between and , as well as being very variable. High intraspecific variability could be indicative of cryptic diversity or population structure (Diptera: Meier et al. 2006; Lycaenidae: Wiemers and Fiedler 2007; Coleoptera, Nitidulidae: De Biase et al. 2012; Hemiptera, Cicadidae: Nunes et al. 2013). Despite the moderate to low genetic distance between and , these taxa are morphologically very distinct. This leaves us with either incomplete lineage sorting or introgression. Considering that both taxa have very proximate distribution ranges, introgressive hybridisation is likely. Even complete loss of the original mitochondrial genome of a species, resulting in a species with only mitochondrial genomes of the introgressed species is not unheard of (Hailer et al. 2012). Likewise, as and occur sympatrically in Spain and Portugal (Méndez 2003), recent hybridisation and introgression cannot be ruled out as another or supplementary cause of the polyphyletic status of (Avise 2000). Because SB6 merely differed from A3 at its five ambiguous sites, it could be perceived as a shared haplotype, which would corroborate this hypothesis (e.g. Nicholls et al. 2012). , and also have overlapping distributions. The former two were even sampled on the same tree in a Turkish forest (M. A. Cimaz, personal communication). In captivity, they do not seem to interbreed, which is concordant with our reporting of no shared haplotypes. Finally, the samples from Israel and Lebanon that were unidentified at the species level, seemed closely related and formed a paraphyletic clade with . Nevertheless, some of these samples could well be of a different species, indicated by the higher pairwise genetic distances (0.042–0.066). A detailed morphological and phylogenetic study is required here to investigate the number of species and relationship with . A distinct barcoding gap was absent for several species and subspecies of . This may either represent a low phylogenetic signal from the COI fragment for some relationships, a problem of basing a taxonomy on just one or a few morphological traits, or both. The use of the COI gene for barcoding purposes has had mixed results. High intraspecific variability (DeSalle et al. 2005) and closely related species (e.g. Funk and Omland 2003, Hajibabaei et al. 2006) can lead to an overlap in genetic distances, making the technique ineffective, as was shown here. In addition, NUMTs may complicate results and could cause the number of species to be overestimated (Song et al. 2008). Besides, the evolutionary history of the gene in question could be different from that of the studied species (Maddison 1997, Edwards 2009). Consequently, other or additional genes, ribosomal or nuclear, are recommended for barcoding purposes (Dupuis et al. 2012).

Conclusions

This study revealed that while the 3’ terminus of COI contained sufficient information to resolve relationships among a number of closely related taxa, many others could not be robustly discriminated. Genotyping of additional specimens, especially of PageBreak, , , and , as well as all western Palaearctic taxa is needed to fully explore COI genetic diversity and to investigate the roles of phenotypic plasticity, hybridisation and incomplete lineage sorting underlying stag beetle biodiversity and inform taxonomic investigations. We therefore see this study as a starting point for future research which should also endeavour to combine analysis of nuclear markers, such as the internal transcribed spacer (ITS) and 28S rRNA gene (e.g. Smith et al. 2007), in combination with a detailed morphological investigation, to find a useful molecular identification tool for all western Palaearctic sp.

Authors’ contributions

The work presented here was carried out in collaboration between all authors. AT, KDG, GA, PA and LB defined the subject and the design of the study. KDG designed methods and experiments in the laboratory and supervised laboratory work. KC analysed the data, interpreted results and wrote the paper. AT was responsible for collecting the samples and co-wrote the taxonomical part of the paper. JM discussed analyses. GA, ES, NMcK and PS provided five sequences and revised primarily the material and methods section and the interpretation of the results. MZ, LB and PA provided samples and co-wrote the paper, particularly the taxonomical section. DH and RM provided samples. All authors have contributed to, revised and approved the manuscript.
  29 in total

1.  Biological identifications through DNA barcodes.

Authors:  Paul D N Hebert; Alina Cywinska; Shelley L Ball; Jeremy R deWaard
Journal:  Proc Biol Sci       Date:  2003-02-07       Impact factor: 5.349

2.  MrBayes 3: Bayesian phylogenetic inference under mixed models.

Authors:  Fredrik Ronquist; John P Huelsenbeck
Journal:  Bioinformatics       Date:  2003-08-12       Impact factor: 6.937

3.  Mitochondrial barcodes are diagnostic of shared refugia but not species in hybridizing oak gallwasps.

Authors:  James A Nicholls; Richard J Challis; Serap Mutun; Graham N Stone
Journal:  Mol Ecol       Date:  2012-06-25       Impact factor: 6.185

4.  Many species in one: DNA barcoding overestimates the number of species when nuclear mitochondrial pseudogenes are coamplified.

Authors:  Hojun Song; Jennifer E Buhay; Michael F Whiting; Keith A Crandall
Journal:  Proc Natl Acad Sci U S A       Date:  2008-08-29       Impact factor: 11.205

5.  jModelTest: phylogenetic model averaging.

Authors:  David Posada
Journal:  Mol Biol Evol       Date:  2008-04-08       Impact factor: 16.240

6.  MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods.

Authors:  Koichiro Tamura; Daniel Peterson; Nicholas Peterson; Glen Stecher; Masatoshi Nei; Sudhir Kumar
Journal:  Mol Biol Evol       Date:  2011-05-04       Impact factor: 16.240

7.  Defining 'Evolutionarily Significant Units' for conservation.

Authors:  C Moritz
Journal:  Trends Ecol Evol       Date:  1994-10       Impact factor: 17.712

8.  Identifying sharks with DNA barcodes: assessing the utility of a nucleotide diagnostic approach.

Authors:  Eugene H-K Wong; Mahmood S Shivji; Robert H Hanner
Journal:  Mol Ecol Resour       Date:  2009-05       Impact factor: 7.090

9.  Does the DNA barcoding gap exist? - a case study in blue butterflies (Lepidoptera: Lycaenidae).

Authors:  Martin Wiemers; Konrad Fiedler
Journal:  Front Zool       Date:  2007-03-07       Impact factor: 3.172

10.  How many species are infected with Wolbachia?--A statistical analysis of current data.

Authors:  Kirsten Hilgenboecker; Peter Hammerstein; Peter Schlattmann; Arndt Telschow; John H Werren
Journal:  FEMS Microbiol Lett       Date:  2008-02-28       Impact factor: 2.742

View more
  3 in total

1.  Phylogeography and DNA-based species delimitation provide insight into the taxonomy of the polymorphic rose chafer Protaetia (Potosia) cuprea species complex (Coleoptera: Scarabaeidae: Cetoniinae) in the Western Palearctic.

Authors:  Dominik Vondráček; Aneta Fuchsová; Dirk Ahrens; David Král; Petr Šípek
Journal:  PLoS One       Date:  2018-02-20       Impact factor: 3.240

2.  Phylogeographic structure and ecological niche modelling reveal signals of isolation and postglacial colonisation in the European stag beetle.

Authors:  Karen Cox; Niall McKeown; Gloria Antonini; Deborah Harvey; Emanuela Solano; An Van Breusegem; Arno Thomaes
Journal:  PLoS One       Date:  2019-04-25       Impact factor: 3.240

3.  The complete mitochondrial genome of stag beetle Lucanus cervus (Coleoptera: Lucanidae) and phylogenetic analysis.

Authors:  Dan Chen; Jing Liu; Luca Bartolozzi; Xia Wan
Journal:  PeerJ       Date:  2019-12-19       Impact factor: 2.984

  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.