Literature DB >> 24430870

SLC25A23 augments mitochondrial Ca²⁺ uptake, interacts with MCU, and induces oxidative stress-mediated cell death.

Nicholas E Hoffman1, Harish C Chandramoorthy, Santhanam Shanmughapriya, Xueqian Q Zhang, Sandhya Vallem, Patrick J Doonan, Karthik Malliankaraman, Shuchi Guo, Sudarsan Rajan, John W Elrod, Walter J Koch, Joseph Y Cheung, Muniswamy Madesh.   

Abstract

Emerging findings suggest that two lineages of mitochondrial Ca(2+) uptake participate during active and resting states: 1) the major eukaryotic membrane potential-dependent mitochondrial Ca(2+) uniporter and 2) the evolutionarily conserved exchangers and solute carriers, which are also involved in ion transport. Although the influx of Ca(2+) across the inner mitochondrial membrane maintains metabolic functions and cell death signal transduction, the mechanisms that regulate mitochondrial Ca(2+) accumulation are unclear. Solute carriers--solute carrier 25A23 (SLC25A23), SLC25A24, and SLC25A25--represent a family of EF-hand-containing mitochondrial proteins that transport Mg-ATP/Pi across the inner membrane. RNA interference-mediated knockdown of SLC25A23 but not SLC25A24 and SLC25A25 decreases mitochondrial Ca(2+) uptake and reduces cytosolic Ca(2+) clearance after histamine stimulation. Ectopic expression of SLC25A23 EF-hand-domain mutants exhibits a dominant-negative phenotype of reduced mitochondrial Ca(2+) uptake. In addition, SLC25A23 interacts with mitochondrial Ca(2+) uniporter (MCU; CCDC109A) and MICU1 (CBARA1) while also increasing IMCU. In addition, SLC25A23 knockdown lowers basal mROS accumulation, attenuates oxidant-induced ATP decline, and reduces cell death. Further, reconstitution with short hairpin RNA-insensitive SLC25A23 cDNA restores mitochondrial Ca(2+) uptake and superoxide production. These findings indicate that SLC25A23 plays an important role in mitochondrial matrix Ca(2+) influx.

Entities:  

Mesh:

Substances:

Year:  2014        PMID: 24430870      PMCID: PMC3952861          DOI: 10.1091/mbc.E13-08-0502

Source DB:  PubMed          Journal:  Mol Biol Cell        ISSN: 1059-1524            Impact factor:   4.138


INTRODUCTION

The Ca2+ signals in the mitochondria regulate key cellular functions such as energy production and cell death. The transport of Ca2+ across the inner mitochondrial membrane is an essential signaling pathway for cellular metabolic functions. Although basal cytosolic Ca2+ levels are maintained at ∼100 nM, upon agonist-induced cytosolic Ca2+ increase, Ca2+ is sequestered by Ca2+-binding proteins, the endoplasmic reticulum (ER), and mitochondria, which accumulate large amounts of Ca2+ (Nicholls, 2005; Rizzuto ). Although the mitochondrial Ca2+ uniporter (MCU) has low affinity, mitochondrial Ca2+ overload can occur during times of stress because mitochondria are in close proximity to the ER (Rizzuto , 2004). In addition to the MCU (Baughman ; De Stefani ), its regulators, mitochondrial Ca2+ uptake1 (MICU1) and mitochondrial Ca2+ uniporter regulator 1 (MCUR1), were also identified (Perocchi ; Mallilankaraman , b; Hoffman ). The recent discovery of molecular MCU constituents raises the possibility of examining Ca2+ uptake relationships between different mitochondrial protein systems. Here we examine the relationship between MCU and a distinct family of solute carriers (SLC family). Solute carriers in the mitochondria can be divided into two major groups: aspartate/glutamate carriers (Palmieri ) and ATP-magnesium carriers (Satrustegui ), of which solute carrier 25A23 (SLC25A23), SLC25A24, and SLC25A25 are paralogues. SLC25A23 and SLC25A24 transport adenine nucleotides in response to Ca2+ (Aprille, 1988; Fiermonte ; Tewari ; Traba ; Amigo ), but the functional interplay with mitochondrial Ca2+ uptake has not yet been rigorously characterized. However, it has been reported that the deletion of SLC25A23 diminishes oxidative phosphorylation (Amigo ). Further, SLC25A23, SLC25A24, and SLC25A25 contain functional EF hands (Bassi ), which makes their Mg/ATP-Pi carrier function Ca2+ sensitive, similar to other Ca2+-activated channels and carriers. Mitochondrial solute carriers are widespread in eukaryotes and well conserved (Carafoli and Lehninger, 1971; Uribe ; Palmieri, 2004, 2013). For example, Sal1 is a yeast homologue to SLC25A23 that also contains EF-hand domains (Kucejova ). The double inactivation of yeast Sal1 and ATP/ADP translocase (aac2) leads to abnormal mitochondrial DNA. The activation of these solute carriers occurs on the exterior of the inner mitochondrial membrane (Haynes ; Nosek ; Palmieri ), and activators include Ca2+, adenosine 3′5′-cyclical monophosphate, protein kinases, and inositol polyphosphates (Dransfield and Aprille, 1993). Members of the SLC25 family have been identified as the cause of Stanley syndrome (SLC25A20) and Amish microcephaly (SLC20A19), suggesting the functional importance of SCaMCs (Palmieri, 2004; Molinari , 2009). Similar to Sal1, SLC25A24 is involved in regulating the ADP/ATP ratio in mitochondrial matrix (Traba ). However, a recent study using the SLC25A25-knockout mouse showed only moderate effects on metabolism (Anunciado-Koza ). In our search for the molecular identity of the MCU, the group SLC25A23, SLC25A24, and SLC25A25 emerged as being of interest (Mallilankaraman ). They were selected for study because they are predicted to form multitransmembrane domains, sense Ca2+ with functional Ca2+-binding EF-hand motifs, and localize to the mitochondrial inner membrane (del Arco and Satrustegui, 1998, 2004; Iijima ). SLC25A23 is highly expressed in brain, heart, skeletal muscle, liver, and small intestine (Bassi ), and although SLC25A23 has been characterized as a Ca2+-activated ATP-Mg/Pi carrier, the functional interplay and feedback provided by SLC25A23 activity on mitochondrial Ca2+ uptake remain unknown. The purpose of this work is to investigate how this family of solute carriers regulates mitochondrial Ca2+ uptake, bioenergetics, and cell survival. Here we report that knockdown of SLC25A23 reduces mitochondrial Ca2+ uptake while interacting with MCU and MICU1, without altering mitochondrial efflux. The EF-hand domains of SLC25A23 are necessary for its function and thus participate in mitochondrial matrix Ca2+ accumulation and stress-induced cell death.

RESULTS

Silencing of SLC25A23 modulates mitochondrial Ca2+ uptake

To explore the role of SLC25 isoforms, we stably knocked down SLC25A23, SLC25A24, and SLC25A25 using lentiviral short hairpin RNA (shRNA; Mallilankaraman ). We subjected puromycin-resistant, stably expressing lentiviral shRNA HeLa cell clones to quantitative real-time (qRT) PCR to assess SLC25 mRNA levels (Figure 1, A–C). We next examined whether the SLC25A23 #864 shRNA was exclusively on-target, by assessing mRNA levels of SLC25A23, SLC25A24, and SLC25A25 in the SLC25A23 #864 shRNA HeLa clone. As expected, SLC25A23 but not SLC25A24 or SLC25A25 mRNA was knocked down (Supplemental Figure S1), confirming the specificity of the #864 shRNA. HeLa cell maximal knockdown clones #864, #594, and #739 for SLC25A23, SLC25A24, and SLC25A25, respectively, were assayed using confocal microscopy for cytosolic Ca2+ (Fluo-4) and mitochondrial Ca2+ (Rhod-2 AM) dynamics after stimulation with the G-protein–coupled receptor (GPCR) agonist histamine (100 μM; Madesh ; Hawkins , b; Davidson and Duchen, 2012; Mallilankaraman , b). SLC25A23 knockdown (KD) but not SLC25A24 KD or SLC25A25 KD exhibited diminished mitochondrial Ca2+ uptake (Figure 1, D–F, bottom left). To complement the rhod-2 AM results, we transfected HeLa SLC25A23 KD, SLC25A24 KD, and SLC25A25 KD clones with the genetic mitochondrial Ca2+ reporter GCaMP2-mt and assayed after histamine (100 μM) stimulation. GCaMP2-mt fluorescence corroborated that SLC25A23 KD reduces mitochondrial Ca2+ uptake, whereas SLC25A24 KD and SLC25A25 KD are unaltered (Figure 1, G–J). Having observed a reduction of mitochondrial Ca2+ uptake by SLC25A23 KD but not SLC25A24 KD or SLC25A25 KD, we assessed cytosolic Ca2+ clearance after histamine stimulation. Cytosolic Ca2+ measured by Fluo-4 was examined in an extended time interval to evaluate whether decreased mitochondrial Ca2+ uptake in SLC25A23 KD reciprocally sustained cytosolic [Ca2+] (Quintana ). HeLa SLC25A23 KD and Neg shRNA cells were challenged with histamine, and fluorescence was recorded for 1000 s (Figure 1K). Quantitation of the cytosolic Ca2+ fluorescence area under the curve demonstrated marked deceleration of cytosolic Ca2+ clearance (Figure 1L).
FIGURE 1:

RNA interference–mediated silencing of SLC25A23, SLC25A24, and SLC25A25 reveals that SLC25A23 reduces mitochondrial Ca2+ uptake. (A) qRT-PCR results of SLC25A23 KD, (B) SLC25A24 KD, and (C) SLC25A25 KD clones. SLC25A23 KD clones #864 and #867 show reduced mRNA levels by 95 and 95.2%, respectively. (D) HeLa cells were stimulated with 100 μM histamine at 50 s. SLC25A23 clone 864 shRNA cytosolic Ca2+ trace (top left), mitochondrial Ca2+ trace (bottom left), and quantitation of mitochondrial rhod-2 fluorescence (right). (E) SLC25A24 clone 594 shRNA cytosolic Ca2+ trace (top left), mitochondrial Ca2+ trace (bottom left), and quantitation of mitochondrial Ca2+ uptake (right). (F) SLC25A25 clone 739 shRNA cytosolic Ca2+ trace (top left), mitochondrial Ca2+ trace (bottom left), and quantitation of mitochondrial Ca2+ uptake (right). (G) Representative image of transiently transfected HeLa cells expressing mitochondria-targeted Ca2+ indicator GCaMP2. (H) GCaMP2-mt HeLa cells were stimulated with 100 μM histamine at 60 s. SLC25A23 clone 864 mitochondrial Ca2+ trace (GCaMP2; scale 0–4096 f.a.u.). (I) SLC25A24 KD mitochondrial Ca2+ trace. (J) SLC25A25 KD mitochondrial Ca2+ trace. (K) SLC25A23 KD and Neg shRNA HeLa cells cytosolic Ca2+ clearance trace (Fluo-4; scale 0–4096 f.a.u.). (L) Quantitation of cytosolic Ca2+ clearance as area under the curve. Data are mean ± SEM (n = 3–5). *p < 0.05 compared with Neg shRNA.

RNA interference–mediated silencing of SLC25A23, SLC25A24, and SLC25A25 reveals that SLC25A23 reduces mitochondrial Ca2+ uptake. (A) qRT-PCR results of SLC25A23 KD, (B) SLC25A24 KD, and (C) SLC25A25 KD clones. SLC25A23 KD clones #864 and #867 show reduced mRNA levels by 95 and 95.2%, respectively. (D) HeLa cells were stimulated with 100 μM histamine at 50 s. SLC25A23 clone 864 shRNA cytosolic Ca2+ trace (top left), mitochondrial Ca2+ trace (bottom left), and quantitation of mitochondrial rhod-2 fluorescence (right). (E) SLC25A24 clone 594 shRNA cytosolic Ca2+ trace (top left), mitochondrial Ca2+ trace (bottom left), and quantitation of mitochondrial Ca2+ uptake (right). (F) SLC25A25 clone 739 shRNA cytosolic Ca2+ trace (top left), mitochondrial Ca2+ trace (bottom left), and quantitation of mitochondrial Ca2+ uptake (right). (G) Representative image of transiently transfected HeLa cells expressing mitochondria-targeted Ca2+ indicator GCaMP2. (H) GCaMP2-mt HeLa cells were stimulated with 100 μM histamine at 60 s. SLC25A23 clone 864 mitochondrial Ca2+ trace (GCaMP2; scale 0–4096 f.a.u.). (I) SLC25A24 KD mitochondrial Ca2+ trace. (J) SLC25A25 KD mitochondrial Ca2+ trace. (K) SLC25A23 KD and Neg shRNA HeLa cells cytosolic Ca2+ clearance trace (Fluo-4; scale 0–4096 f.a.u.). (L) Quantitation of cytosolic Ca2+ clearance as area under the curve. Data are mean ± SEM (n = 3–5). *p < 0.05 compared with Neg shRNA.

SLC25A23 KD decreases mitochondrial Ca2+ uptake without altering efflux rate

To demonstrate that indeed SLC25A23 KD reduced mitochondrial Ca2+ uptake, we suspended permeabilized HeLa cells in intracellular matrix (ICM) buffer containing succinate to energize the mitochondria, thapsigargin to inhibit ER Ca2+ uptake via sarco/endoplasmic reticulum Ca2+ ATPase (SERCA), and added Fura-2FF to monitor extramitochondrial changes. We then pulsed cells with 10 μM Ca2+ to measure the mitochondrial Ca2+ uptake rate. Although the influx pathway is described by the rapid Ca2+ uptake channel MCU, Ca2+ efflux is mediated by the Na+/Ca2+ exchanger, with a distinct, relatively slow kinetic rate. Ca2+ efflux was measured by blocking the major Ca2+ uptake channel, the mitochondrial uniporter, with Ru360 (Zhou ; Hajnoczky ), followed by blockage of the mitochondrial Na+/Ca2+ exchanger with CGP37157 (Cox ; Palty ; Wei ). Finally, uncoupler carbonyl cyanide m-chlorophenyl hydrazone (CCCP) was added to trigger release of all mitochondria-stored Ca2+, thus validating that equal amounts of total Ca2+ were pulsed. SLC25A23 KD only altered mitochondrial Ca2+ influx (Figure 2, A–C), whereas efflux rate and total mitochondrial [Ca2+] were unchanged (Figure 2, A, D, and E). Although statistically insignificant, a trend seemed to exist in the SLC25A23 KD total Ca2+ in which total SLC25A23 KD Ca2+ was reduced from Neg shRNA, presumably due to reduced influx rate. Knockdown of SLC25A24 and SLC25A25 did not alter influx rate, efflux rate, and total mitochondrial [Ca2+] (Supplemental Figure S2). The intact and permeabilized cell data indicate a SLC25A23 role in mitochondrial Ca2+ uptake.
FIGURE 2:

Knockdown of SLC25A23 reduces mitochondrial Ca2+ uptake rate. (A) Average traces with mean data point for each time point plotted with SE of permeabilized (40 μg/ml digitonin) HeLa cells loaded with the ratiometric Ca2+ indicator Fura2-FF and pulsed with 10 μM Ca2+ at 350 s to measure mitochondrial Ca2+ uptake, followed by addition of 1 mM RU360 at 550 s, 10 μM CGP37157 at 610 s and 2 μM uncoupler CCCP at 750 s. SLC25A23 KD showed reduced extra mitochondrial Ca2+ clearance. (B) Zoom of Ca2+ uptake from A (between 300 and 550 s). (C) Quantitation of Ca2+ influx rate. (D) Quantitation of Ca2+ efflux rate after addition of Ru360. (E) Quantitation of CCCP-induced Ca2+ release shows no significant difference in total Ca2+. Data are mean ± SEM (n = 3). **p < 0.01 compared with Neg shRNA; n.s., not significant.

Knockdown of SLC25A23 reduces mitochondrial Ca2+ uptake rate. (A) Average traces with mean data point for each time point plotted with SE of permeabilized (40 μg/ml digitonin) HeLa cells loaded with the ratiometric Ca2+ indicator Fura2-FF and pulsed with 10 μM Ca2+ at 350 s to measure mitochondrial Ca2+ uptake, followed by addition of 1 mM RU360 at 550 s, 10 μM CGP37157 at 610 s and 2 μM uncoupler CCCP at 750 s. SLC25A23 KD showed reduced extra mitochondrial Ca2+ clearance. (B) Zoom of Ca2+ uptake from A (between 300 and 550 s). (C) Quantitation of Ca2+ influx rate. (D) Quantitation of Ca2+ efflux rate after addition of Ru360. (E) Quantitation of CCCP-induced Ca2+ release shows no significant difference in total Ca2+. Data are mean ± SEM (n = 3). **p < 0.01 compared with Neg shRNA; n.s., not significant.

SLC25A23 EF hands are necessary for mitochondrial Ca2+ uptake

SLC25A23 is predicted to be a multitransmembrane, mitochondrial-resident protein with three EF-hand motifs. After examining the EF-hand consensus sequence, we determined that only two of the three EF-hand motifs contain functional Ca2+-binding sites. To investigate the role of Ca2+-sensing properties of SLC25A23, we overexpressed GFP-tagged mutants of the two EF hands (EF1 D22A/E33K and EF2 D90A/E101K) in SLC25A23 KD cells (Figure 3A). Expression and mitochondrial localization were verified with mitochondrial membrane potential (ΔΨm) indicator tetramethylrhodamine ethyl ester (TMRE; Figure 3B). After verifying transient expression of SLC25A23 EF-hand mutants, we loaded HeLa cells with Rhod-2 AM and stimulated them with histamine. The EF-hand mutants exhibited a reduction of mitochondrial Ca2+ uptake (Figure 3, C and D). These data suggest that the EF hands are essential for SLC25A23 Ca2+ sensing and that SLC25A23 EF hands function to increase mitochondrial Ca2+ uptake.
FIGURE 3:

SLC25A23 EF-hand mutants dampen mitochondrial Ca2+ uptake. (A) Scheme depicting EF1 and EF2 mutant constructs. (B) HeLa cells were transfected with EF-hand mutants, and localization to the mitochondria was visualized with mitochondrial indicator TMRE. (C) EF1 and EF2 mutants show decreased mitochondrial Ca2+ uptake assessed by confocal imaging after histamine stimulation. (D) Quantitation of mitochondrial Ca2+ peak uptake using mitochondrial Ca2+ indicator Rhod-2 AM. Data are mean ± SEM (n = 3). *p < 0.05 compared with Neg shRNA.

SLC25A23 EF-hand mutants dampen mitochondrial Ca2+ uptake. (A) Scheme depicting EF1 and EF2 mutant constructs. (B) HeLa cells were transfected with EF-hand mutants, and localization to the mitochondria was visualized with mitochondrial indicator TMRE. (C) EF1 and EF2 mutants show decreased mitochondrial Ca2+ uptake assessed by confocal imaging after histamine stimulation. (D) Quantitation of mitochondrial Ca2+ peak uptake using mitochondrial Ca2+ indicator Rhod-2 AM. Data are mean ± SEM (n = 3). *p < 0.05 compared with Neg shRNA.

SLC25A23 interacts with mitochondrial Ca2+ uniporter complex components MCU and MICU1

To determine the mechanism by which SLC25A23 modulates mitochondrial Ca2+ uptake, we asked whether SLC25A23 interacts with MCU or MICU1. Flag-tagged SLC25A23 was transfected into COS7 cells stably expressing GFP-tagged, full-length MCU or hemagglutinin (HA)-tagged full-length MICU1. The cell lysates from transfected cells were subjected to immunoprecipitation and Western blot analysis. Immunoprecipitation of GFP-tagged MCU pulled down SLC25A23 (Figure 4A) with MCU/MICU1 known interaction serving as a positive control. Correspondingly, HA-tagged MICU1 pulled down SLC25A23 (Figure 4B). The results of the coimmunoprecipitation demonstrate that SLC25A23 interacts with MCU and MICU1, two proteins believed to be of critical importance to mitochondrial Ca2+ influx.
FIGURE 4:

SLC25A23 interacts with MCU and MICU1 and modulates IMCU. (A) Stably MCU-GFP–expressing COS7 cells were transfected with Flag-tagged, full-length MICU1 or SLC25A23. After immunoprecipitation with GFP antibody, total cell lysates and immunoprecipitated materials were subjected to Western blot analysis. Cell lysates were probed with anti-Flag (top left) or anti-GFP antibodies (bottom left) to serve as inputs. Immunoprecipitated samples were probed with anti-Flag (top right) or anti-GFP antibodies (bottom right). Anti-GFP antibodies coimmunoprecipitate full-length MICU1 and SLC25A23. n = 3. (B) Stably MICU1-HA–expressing COS7 cells were transfected with Flag-tagged SLC25A23. After immunoprecipitation with HA antibody, total cell lysates and immunoprecipitated materials were subjected to Western blot analysis. Cell lysates were probed with anti-Flag (top left) or anti-HA antibodies (bottom left) to serve as inputs. Immunoprecipitated samples were probed with anti-Flag (top right) or anti-HA antibodies (bottom right). Anti-HA antibodies to MICU1-HA coimmunoprecipitate Flag-tagged SLC25A23. n = 3. (C) Mitoplast current (IMCU) from HeLa cells was recorded before and after application of 5 mM Ca2+ to the bath medium. Currents were measured during a voltage ramp as indicated. Traces are a representative single recording of IMCU from Neg shRNA (black) and SLC25A23 KD (gray). n = 5 or 6. (D) Traces are a representative single recording of IMCU. The IMCU was recorded in the presence of 5 mM Ca2+ and 300 μM Pi in Neg shRNA (black) and SLC25A23 KD (gray). n = 6. (E) IMCU densities (pA/pF) for Neg shRNA (black) and SLC25A23 KD (gray). Mean ± SEM; *p < 0.05, ***p < 0.001; ns, not significant; n = 5 or 6.

SLC25A23 interacts with MCU and MICU1 and modulates IMCU. (A) Stably MCU-GFP–expressing COS7 cells were transfected with Flag-tagged, full-length MICU1 or SLC25A23. After immunoprecipitation with GFP antibody, total cell lysates and immunoprecipitated materials were subjected to Western blot analysis. Cell lysates were probed with anti-Flag (top left) or anti-GFP antibodies (bottom left) to serve as inputs. Immunoprecipitated samples were probed with anti-Flag (top right) or anti-GFP antibodies (bottom right). Anti-GFP antibodies coimmunoprecipitate full-length MICU1 and SLC25A23. n = 3. (B) Stably MICU1-HA–expressing COS7 cells were transfected with Flag-tagged SLC25A23. After immunoprecipitation with HA antibody, total cell lysates and immunoprecipitated materials were subjected to Western blot analysis. Cell lysates were probed with anti-Flag (top left) or anti-HA antibodies (bottom left) to serve as inputs. Immunoprecipitated samples were probed with anti-Flag (top right) or anti-HA antibodies (bottom right). Anti-HA antibodies to MICU1-HA coimmunoprecipitate Flag-tagged SLC25A23. n = 3. (C) Mitoplast current (IMCU) from HeLa cells was recorded before and after application of 5 mM Ca2+ to the bath medium. Currents were measured during a voltage ramp as indicated. Traces are a representative single recording of IMCU from Neg shRNA (black) and SLC25A23 KD (gray). n = 5 or 6. (D) Traces are a representative single recording of IMCU. The IMCU was recorded in the presence of 5 mM Ca2+ and 300 μM Pi in Neg shRNA (black) and SLC25A23 KD (gray). n = 6. (E) IMCU densities (pA/pF) for Neg shRNA (black) and SLC25A23 KD (gray). Mean ± SEM; *p < 0.05, ***p < 0.001; ns, not significant; n = 5 or 6. Given that SLC25A23 interacts with MCU, we next sought to determine whether the knockdown of SLC25A23 modulates MCU activity (IMCU). To measure IMCU, we performed mitoplast patch clamping. In the patch clamp of whole-mitoplast configuration, the addition of 5 mM Ca2+ to the bath triggered an inwardly rectifying Ca2+ current, which was reduced in SLC25A23 KD mitoplasts in the nominal phosphate buffer condition (Figure 4, C and E). Because SLC25A23 was previously described as a Mg-ATP/Pi carrier (Fiermonte ), we measured the IMCU in Neg shRNA and SLC25A23 KD mitoplasts supplemented with 300 μM phosphate (Zoccarato and Nicholls, 1982; Figure 4, D and E). The IMCU was increased by the presence of phosphate in Neg shRNA but not in SLC25A23 KD mitoplasts (Figure 4, C–E). This result suggests that the Mg-ATP/Pi carrier function of SLC25A23 enhances IMCU activity.

Mitochondrial Ca2+ uptake reduction by SLC25A23 KD preserves ΔΨm

Because mitochondria Ca2+ uptake relies on ΔΨm as a driving force, we asked whether the reduced mitochondrial Ca2+ uptake exhibited by SLC25A23 knockdown was due to a difference in basal driving force, ΔΨm. HeLa cells with maximal knockdown (clone 864) and moderate knockdown (clone 863) and a SLC25A23 rescue construct (Figure 1A and Supplemental Figure S3) showed neither ΔΨm nor basal morphological phenotype changes when compared with a Neg shRNA HeLa cell clone, using two different ΔΨm indicators, TMRE and rhodamine 123 (Figure 5, A and B). These data show that SLC25A23 knockdown does not alter basal ΔΨm.
FIGURE 5:

SLC25A23 knockdown prevents mitochondrial Ca2+ uptake and subsequently preserves ΔΨm. (A) Mitochondrial morphology and ΔΨm was assessed by confocal microscopy using TMRE and rhodamine 123. Hoechst 33342 was used as a nuclear marker. (B) Quantitation of confocal TMRE fluorescence. (C) Representative traces of permeabilized (40 μg/ml digitonin) HeLa cells loaded with the ratiometric Ca2+ indicator Fura-2FF and ratiometric ΔΨm fluorophore JC-1 and pulsed with 10 μM Ca2+ to trigger ΔΨm loss, followed by addition of the uncoupler CCCP (1 μM). ΔΨm loss was similar between Neg shRNA control and partial knockdown clone 863. Clone 864 shows abrogated ΔΨm loss after six Ca2+ pulses, and the first pulse is not completely cleared from the cytosol. (D) Quantitation after the addition of the uncoupler CCCP shows ΔΨm preservation in clone 864. Data are mean ± SEM (n = 3–5). *p < 0.05, **p < 0.01, and ns, not significant compared with Neg shRNA.

SLC25A23 knockdown prevents mitochondrial Ca2+ uptake and subsequently preserves ΔΨm. (A) Mitochondrial morphology and ΔΨm was assessed by confocal microscopy using TMRE and rhodamine 123. Hoechst 33342 was used as a nuclear marker. (B) Quantitation of confocal TMRE fluorescence. (C) Representative traces of permeabilized (40 μg/ml digitonin) HeLa cells loaded with the ratiometric Ca2+ indicator Fura-2FF and ratiometric ΔΨm fluorophore JC-1 and pulsed with 10 μM Ca2+ to trigger ΔΨm loss, followed by addition of the uncoupler CCCP (1 μM). ΔΨm loss was similar between Neg shRNA control and partial knockdown clone 863. Clone 864 shows abrogated ΔΨm loss after six Ca2+ pulses, and the first pulse is not completely cleared from the cytosol. (D) Quantitation after the addition of the uncoupler CCCP shows ΔΨm preservation in clone 864. Data are mean ± SEM (n = 3–5). *p < 0.05, **p < 0.01, and ns, not significant compared with Neg shRNA. We next examined active-state mitochondrial Ca2+ handling and ΔΨm simultaneously using a permeabilized cell system loaded with cytosolic Ca2+ indicator Fura-2FF and ΔΨm indicator JC-1 (Madesh and Hajnoczky, 2001; Madesh , 2009; Roy ; Mallilankaraman , b). JC-1 is preferred to DiOC6(3) and rhodamine 123 in ΔΨm studies when ΔΨm may collapse (Salvioli ), which occurs when excessive Ca2+ is taken into the mitochondria. We found that the extramitochondrial delivery of Ca2+ pulses promoted a larger decay of ΔΨm in control shRNA HeLa cells than with SLC25A23 #864 knockdown HeLa cells (Figure 5, C and D). Intermediate knockdown of SLC25A23 (#863) partially preserved ΔΨm (Figure 5, C, bottom left, and D). We next verified SLC25A23’s role by reexpressing #864 shRNA–insensitive SLC25A23 cDNA. We were able to restore Ca2+ flux and associated ΔΨm (Figure 3, C, bottom right, and D). These results suggest that SLCA25A23 participates in mitochondrial Ca2+-uptake regulation.

SLC25A23 increases basal reactive oxygen species and decreases antioxidant levels

Because SLC25A23 is involved in Ca2+-activated adenine nucleotide transport, we examined mitochondrial DNA (mtDNA) copy number. Depletion of mitochondrial DNA copy number results in disassembly of electron transport chain components and thus drives reactive oxygen species (ROS) overproduction and mitochondrial malfunction (Hom ). We found that KD of SLC25A23 did not alter mtDNA copy number in HeLa cells when compared with either negative or partial KD (#863) shRNA clones (Figure 6, A and B), supporting our finding of no gross mitochondrial abnormalities. In complement, we also studied the mitochondrial oxygen consumption rate (OCR) and NAD(P)H levels. Silencing of SLC25A23 in HeLa cells did not significantly alter mitochondrial OCR and NAD(P)H content (Supplemental Figure S4). We next investigated whether SLC25A23 KD affects mitochondrial ROS production. We assayed for mitochondrial superoxide (mROS) using the mitochondrial targeting superoxide indicator MitoSOX Red. Surprisingly, basal mROS levels were lower in SLC25A23 KD than in control (Figure 6, C and D), and reconstitution of SLC25A23 in clone #864 partially restored the mROS levels (Figure 6, C and D). However, mROS levels in SLC25A24 KD and SLC25A25 KD were similar to those in Neg shRNA cells. We next assessed whether levels of the major antioxidant glutathione changed in SLC25A23 KD cells. Indeed, reduced glutathione levels are higher in SLC25A23 KD (Figure 6, E and F). Together these results demonstrate that knockdown of SLC25A23 has no effect on basal mitochondrial bioenergetics but lowers basal mROS.
FIGURE 6:

Knockdown of SLC25A23 lowers basal mitochondrial ROS production. (A) HeLa cells were transfected with mito-GFP (green), and cells were immunostained with anti-DNA antibody (red). Images were acquired using a Zeiss LSM 710 META NLO imaging system. Representative images of Neg shRNA (top), clone 863 (middle), and clone 864 (bottom). (B) Quantitation of total mitochondrial anti-DNA spots per cell as determined by ImageJ Particle Analyzer counting all resolvable (>0.37 μm) binary-colored particles. (C) HeLa cells were loaded with the mitochondrial superoxide indicator MitoSOX Red and the nuclear marker Hoechst 33342. (D) Quantitation of MitoSOX Red fluorescence. (E) HeLa cells were loaded with the reduced glutathione indicator monochlorobimane (mBCl) and imaged using a Zeiss LSM 510 with 405-nm excitation. (F) Quantitation of mBCl-GSH fluorescence. Data are mean ± SEM (n = 3). *p < 0.05, **p < 0.01, ***p < 0.001 compared with #864 shRNA or Neg shRNA.

Knockdown of SLC25A23 lowers basal mitochondrial ROS production. (A) HeLa cells were transfected with mito-GFP (green), and cells were immunostained with anti-DNA antibody (red). Images were acquired using a Zeiss LSM 710 META NLO imaging system. Representative images of Neg shRNA (top), clone 863 (middle), and clone 864 (bottom). (B) Quantitation of total mitochondrial anti-DNA spots per cell as determined by ImageJ Particle Analyzer counting all resolvable (>0.37 μm) binary-colored particles. (C) HeLa cells were loaded with the mitochondrial superoxide indicator MitoSOX Red and the nuclear marker Hoechst 33342. (D) Quantitation of MitoSOX Red fluorescence. (E) HeLa cells were loaded with the reduced glutathione indicator monochlorobimane (mBCl) and imaged using a Zeiss LSM 510 with 405-nm excitation. (F) Quantitation of mBCl-GSH fluorescence. Data are mean ± SEM (n = 3). *p < 0.05, **p < 0.01, ***p < 0.001 compared with #864 shRNA or Neg shRNA.

Knockdown of SLC25A23 protects cells from oxidative stress

Having observed reduction of mitochondrial Ca2+ uptake and mROS production during the basal state, we finally examined whether knockdown of SLC25A23 alleviates cell death during active mitochondrial Ca2+-overload conditions. SLC25A23 knockdown #864 and partial knockdown #863 both exhibited strong global preservation of ATP when compared with negative shRNA after ROS stressors (Figure 7A). Because ATP levels were preserved in the SLC25A23 KD, we performed a cell death assay using t-butyl hydroperoxide (t-BH) challenge. Oxidant-treated cells were stained with cell death markers annexin V and propidium iodide and imaged using confocal microscopy. Similar to the observed preservation of ATP levels, SLC25A23 KD was protective against t-BH stress, whereas SLC25A23 #864 rescue exhibited cell death comparable to negative shRNA HeLa cells (Figure 7, B and C). These results establish the role of SLCA25A23 as a link between mitochondrial Ca2+ uptake and cell death after oxidative stress.
FIGURE 7:

Knockdown of SLC25A23 preserves cellular ATP levels and cell viability. (A) Knock­down of SLC25A23 preserves ATP levels after oxidant challenge. HeLa cells (Neg shRNA, 863, and 864) were challenged with superoxide generation system (xanthine + xanthine oxidase), hydrogen peroxide (H2O2), t-butyl hydroperoxide, or ionomycin. After 6 h, cellular ATP levels were assessed using the CellTiter-Glo Luminescent kit. (B) HeLa cells (Neg shRNA, #863, and #864) were treated with t-butyl hydroperoxide for 6 h and then stained with the cell death markers annexin V and propidium iodide. (C) Quantitation of annexin V–positive staining. Data are mean ± SEM (n = 3). *p < 0.05, **p < 0.01, and ***p < 0.001, and ns, not significant compared with Neg shRNA or #864 shRNA.

Knockdown of SLC25A23 preserves cellular ATP levels and cell viability. (A) Knock­down of SLC25A23 preserves ATP levels after oxidant challenge. HeLa cells (Neg shRNA, 863, and 864) were challenged with superoxide generation system (xanthine + xanthine oxidase), hydrogen peroxide (H2O2), t-butyl hydroperoxide, or ionomycin. After 6 h, cellular ATP levels were assessed using the CellTiter-Glo Luminescent kit. (B) HeLa cells (Neg shRNA, #863, and #864) were treated with t-butyl hydroperoxide for 6 h and then stained with the cell death markers annexin V and propidium iodide. (C) Quantitation of annexin V–positive staining. Data are mean ± SEM (n = 3). *p < 0.05, **p < 0.01, and ***p < 0.001, and ns, not significant compared with Neg shRNA or #864 shRNA.

DISCUSSION

The main finding of our work is that SLC25A23 participates in mitochondrial Ca2+ uptake while interacting with key mitochondrial Ca2+ uniporter molecules MCU and MICU1. The RNA interference–mediated silencing of SLC25A23 demonstrated SLC25A23’s role as a facilitator of mitochondrial Ca2+ uptake and mROS production and subsequently alters cell death. In addition, SLC25A23 EF hands are necessary for mitochondrial Ca2+ function of SLC25A23. The MCU channel complex and the mitochondrial solute carriers functionally integrate to create the physiological mitochondrial Ca2+ transportome, which comprehensively drives kinetics and maintains equilibrium. Recent findings regarding the interactions of MCU, both distal and proximal, are the emerging focus of mitochondrial biology (Mori ; Mallilankaraman , b). A further example of the signal interaction of MCU and solute carriers is SLC25A12, which is a protein of the mitochondrial inner membrane (del Arco and Satrustegui, 1998) and responds to Ca2+ by intermembrane-space EF hands (Pardo ; Marmol ). In this case, the direct Ca2+-induced function of SLC25A12 is to increase mitochondrial levels of NAD(P)H (Satrustegui ; Wibom ). In addition, correlative gene expression analysis in cancer cell lines strongly supports our conclusion that SLC25A23 Ca2+ uptake plays a role in ROS-dependent cell death but does not alter mitochondrial bioenergetics (Huang ). Further, SLC25A23, SLC25A37, and SLC25A4 were implicated in cancer-related fatigue, a major quality-of-life determinant (Hsiao ). Surprisingly, not only does SLC25A23 functionally regulate MCU Ca2+ influx, possibly by Ca2+-activated phosphate anion flow, which balances the net charge of matrix ion influx, but also the multipass transmembrane SLC25A23 interacts with MCU, perhaps due to hydrophobic interactions in the transmembrane portions. SLC25A23 interaction with MICU1 may be indirect through MCU, or SLC25A23 could sequester MICU1, thus increasing IMCU. The functional regulation of MCU by SLC25A23 and the biophysical characterization of SLC25A23/MCU/MICU1 complex need further investigation. Our results show evidence of SLC25A23 interaction with MCU and functional IMCU modulation of MCU by SLC25A23, suggesting a supercomplex integrating channels and carriers in microdomains for enhanced sensitivity. In support of this concept, a recent SILAC MS/MS study identified SLC25A3 (phosphate carrier; Palmieri, 2004) as a possible MCU transportome component in the 293T cell line (Sancak ). Although SLC25A23 was not detected in this pull-down approach (Sancak ), it is possible that cell type and the solute carrier conserved domain are key factors in solute carrier/MCU interaction. SLC25A23 expression was reported to be nominal in kidney (293T is a human embryonic kidney epithelial cell line) and other tissues as compared with brain and liver (Traba ). Together these findings suggest that rigorous interaction studies are warranted to define the MCU supercomplex. Although we show that MCU-mediated Ca2+ uptake interacts with the function of SLC25A23, the two systems are distinct, as SLC25A23 is derived from a separate lineage (Bick ). However, both MCU and SLC25A23 have orthologues extending back to the common ancestor of eukaryotes, suggesting the possibility of coevolution (Flicek ). Mitochondrial Ca2+ overload often results in loss of ΔΨm, causing bioenergetic collapse (Bernardi ; Rizzuto ). SLC25A23 silencing preserved ΔΨm while reducing Ca2+ uptake after GPCR stimulation. In addition, we found that SLC25A23 has a ROS-dependent cell death function, as knockdown of SLC25A23 preserves ATP, indicative of maintained ΔΨm, intact proton pumping, and decreased cell death. In particular, the enhanced survival after t-BT is especially significant, as t-BH induction of cell death requires Ca2+ (Crompton and Costi, 1988) and can be rescued by ethylene glycol tetraacetic acid (EGTA) (Crompton ), establishing a link through SLC25A23 from Ca2+ to t-BH–induced cell death. Our results as a whole demonstrate that SLC25A23 enhances mitochondrial Ca2+ uptake. Functionally, SLC25A23 senses Ca2+ after GPCR stimulation and provides a response that enhances MCU-mediated mitochondrial Ca2+ uptake. Since the identification of mitochondrial Ca2+ current (Kirichok ), several molecules, including uncoupling proteins 2 and 3 (Trenker ), LETM1 (Jiang ), MICU1 (Perocchi ; Mallilankaraman ; Hoffman ), MCU (Baughman ; De Stefani ), MCUR1 (Mallilankaraman ), MICU2 (Plovanich ), MCUb (Raffaello ), and EMRE (Sancak ), have been described as mitochondrial Ca2+ signal integrators. In total, our study reveals SLC25A23 as a mitochondrial Ca2+-uptake regulator with significant ROS and cell death implications, providing a mechanism for targeting of MCU-dependent Ca2+ overload.

MATERIALS AND METHODS

Ca2+ uptake and ΔΨm measurement in permeabilized cell system

Mitochondrial Ca2+ uptake and ΔΨm were determined by simultaneous monitoring of cytosolic Ca2+ with Fura-2FF (0.5 μM; Life Technologies, Grand Island, NY) and ΔΨm with the lipophilic cationic dye 5,5′,6,6′-tetrachloro-3,3′-tetraethylbenzimi­dazolcarbocyanine (JC-1; 800 nM; Life Technologies) changes. Cells grown in T-75 flasks were trypsinized, neutralized with fetal bovine serum, centrifuged at 1500 rpm for 5 min, aspirated, resuspended in 20 ml of phosphate-buffered saline, centrifuged at 800 rpm for 3 min, aspirated, and then resuspended in ICM buffer containing 40 μg/ml digitonin to permeabilize the cells, protease inhibitors (EDTA-free cOMPLETE tablets; Roche Applied Science, Indianapolis, IN), and 2 μM thapsigargin to block the SERCA pump. Mitochondria were energized with 2 mM of succinate (Hawkins ), and then 8 × 106 cells were resuspended in 1 ml of ICM buffer and followed by Fura-2FF as a cytosolic Ca2+ indicator. After 20 s of data recording, JC-1 was added. At 480 s and every 120 s thereafter, 10 μM Ca2+ was added. CCCP, 2 μM, was added at 1200 s. Fluorescence was measured using a dual-wavelength fluorimeter (PTI) with 490-nm excitation and 535-nm emission for monomeric JC-1 and 570/595 nm for the J-aggregate. The ΔΨm was calculated as the ratio of J-aggregate and the monomer (Irrinki ).

Cell culture

HeLa cells were cultured using low-glucose DMEM (GIBCO, Life Technologies) containing 10% fetal bovine serum and 1% penicillin/streptomycin, with or without 2 μg/ml puromycin and with or without G418 (500 μg/ml). For each isoform—SLC25A23, SLC25A24, and SLC25A25—five shRNA constructs were expressed.

Generation of stable SLC25A23, SLC25A24, and SLC25A25 shRNA knockdown and rescue HeLa cell clones

The following shRNA sequences were obtained from Open Biosystems, Pittsburgh, PA: for SLC25A23, #863, CCTGAATCTTAGACTCTTATA; #864, CGAGTCAGCTATCAAGTTCAT; #865, CGGCTGAACAGAATCGTTCAA; #866, CGTCTACGAGACTCTGAAGAA; and #867, CTGCTCATGTTTCACAGTCTT; for SLC25A24, #592, GACACTGGGTCTGACTATTTC; #593, TATTAGGTATCATACCTTATG; #594, TGGCCTCTTTCGACGAATTAT; #595, TTCGGGTGGTTTACGTTTATG; and #720 ATGAGCTCTTGAAGTCCTATT; and for SLC25A25, #736, AGACCGAGTTCCAGTACTTTG; #737, CTGCCGAGCTGAAGTCCATTT; #738, GGGACTTGGGAGTCAAGATAT; #739, CCCGAATCAGCCATCAAATTC; and #740 CCCTCGTCCAATCCCATAATC. HeLa cells (5 × 105/well) grown in six-well plates were transduced with the lentivirus for knockdown. Two days posttransduction, the cells were selected with puromycin (2 mg/ml) for 6–10 d and expanded. For the rescue studies, a SLC25A23 construct resistant to #864 shRNA knockdown was created (OriGene Technologies, Rockville, MD). The rescue plasmid encoding SLC25A23 cDNA harbored four silent point mutations in the region complementary to SLC25A23 shRNA. The #864 knockdown cells were transfected with SLC25A23 rescue construct, and the knockdown cells expressing shRNA-resistant SLC25A23 cDNAs were selected with 500 μg/ml G418 (Life Technologies).

qRT PCR analysis

The knockdown and overexpression were assessed by qRT PCR. Briefly, total RNA was isolated from HeLa wild type (WT), Neg shRNA, SLC25A23 KD, SLC25A24 KD, and SLC25A25 KD and rescue cells, using the RNeasy Mini Kit (Qiagen, Valencia, CA) in accordance with the manufacturer's instructions. Total RNA (1 μg) was reverse transcribed with the Verso cDNA Kit (Abgene, Cambridge, United Kingdom). Real-time qPCRs were performed with the gene-specific Solaris qPCR gene expression assay kit (Abgene) as per the manufacturer's instructions. (SLC25A23: forward primer, AACAGGGTATCTCCTCTGAG, reverse primer, AGTCTTGACCGGAACCAG, and probe, AGTCTTGACCGGAACCAG; SLC25A24: forward primer, ATGC­AGGCTCAAGCCATGT, reverse primer, GCCTCTGTAAAGTCCTGGTA, and probe, TCCAAAGAAGGAATACC; and SLC25A25: forward primer, TGGAAGCATTCCACGATCT, reverse primer, TGAACTCATCCGGGACCGTTA, and probe, ATGTGGG­TGAG­AATCTA). The relative gene expression was calibrated with WT type using 7300 Real Time PCR system RQ study software (Applied Biosystems, Carlsbad, CA).

Cytosolic and mitochondrial Ca2+ dynamics

HeLa cells were grown on 25-mm glass coverslips for 48 h and loaded with 2 μM Rhod-2 AM (50 min) and 5 μM Fluo-4 AM (30 min) (Life Technologies) in extracellular medium (Madesh ; Mallilankaraman ). After 1 min of baseline recording, agonist (histamine, 100 μM) was added, and confocal images were recorded every 3 s (510 Meta; Carl Zeiss, Thornwood, NY) at 488- and 561-nm excitation using a 63× oil objective to simultaneously monitor cytoplasmic and mitochondrial Ca2+ dynamics. Images were analyzed and quantified using ImageJ (National Institutes of Health, Bethesda, MD) and custom-made software (Spectralyzer, Elmsford, NY).

Assessment of mitochondrial Ca2+ influx and efflux rates

HeLa cells were permeabilized and loaded with the ratiometric Ca2+ indicator Fura2-FF. Cells were pulsed with 10 μM Ca2+ at 350 s to measure mitochondrial Ca2+ uptake, followed by addition of 1 μM Ru360 at 550 s, 10 μM CGP37157 at 610 s, and 2 μM CCCP at 750 s.

Coimmunoprecipitation assay

Cell extracts were prepared from either stably or transiently transfected COS-7 cells using RIPA buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 0.25% deoxycholic acid, 1 mM EDTA, 1% NP-40, protease inhibitor cocktail [Complete; Roche, Indianapolis, IN], and 1 mM phenylmethylsulfonyl fluoride). To study the interaction of MCU with SLC25A23, we used GFP-tagged MCU and Flag-tagged SLC25A23. Flag-tagged MICU1 was used as a positive control (Hoffman ). Stably MCU-GFP–expressing COS7 cells were transfected with Flag-tagged, full-length MICU1 or SLC25A23. Similarly for understanding the interaction of SLC25A23 with MICU1, stably MICU1-HA–expressing COS7 cells were transfected with Flag-tagged SLC25A23. After immunoprecipitation with anti-GFP (Evrogen, Moscow, Russia) or anti-HA (Thermo Scientific, Waltham, MA) antibody, total cell lysates and immunoprecipitated materials were subjected to Western blot analysis. Ten percent of cell lysates were probed with anti-Flag (Sigma-Aldrich, St. Louis, MO), anti-GFP or anti-HA antibodies to serve as inputs, and similarly, immunoprecipitated samples were probed with their corresponding antibodies.

IMCU recording

Mitoplast patch clamp recordings were conducted at 30°C as previously described (Kirichok ; Hoffman ). IMCU was recorded using a computer-controlled Axon200B patch-clamp amplifier with a Digidata 1320A acquisition board (pClamp 10.0 software; Axon Instruments, Sunnyvale, CA). Mitoplasts were bathed in CaCl2 (5 mM) ± Pi (300 μM), sodium gluconate (150 mM), KCl (5.4 mM), and 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES; 10 mM), pH 7.2. The pipette solution contained sodium gluconate (150 mM), NaCl (5 mM), sucrose (135 mM), HEPES (10 mM), and EGTA (1.5 mM), pH 7.2. After formation of GΩ seals (pipette resistance, 15–25 MΩ), the mitoplasts were ruptured with 200- to 400-mV pulses varying from 2- to 6-ms duration. Mitoplast capacitance was measured (2.2–3.8 pF). After capacitance compensation, mitoplasts were held at 0 mV, and IMCU was elicited with a voltage ramp (from −160 to 80 mV, 120 mV/s).

Oxygen consumption rate

HeLa cells (1 × 106) were permeabilized with 20 μg/ml digitonin in 140 μl of intracellular medium (120 mM KCl, 10 mM NaCl, 1 mM KH2PO4, 20 mM HEPESTris, pH 7.2), and oxygen consumption rate was measured using a MT200A MitoCell Clark-type electrode and MT200A MitoCell chamber (Strathkelvin Instruments, Motherwell, United Kingdom) during constant stirring (Irrinki ). Next, in 1-min intervals, 5 mM complex I substrates malate/pyruvate, 100 nM complex I inhibitor rotenone, 5 mM complex II substrate succinate, 50 nM complex II inhibitor antimycin A, 0.4 mM complex V substrates tetramethylphenylenediamine/2.5 mM ascorbate, and 1 μM complex IV inhibitor sodium azide were added (Irrinki ).

NAD(P)H autofluorescence measurement

NAD(P)H autofluorescence was measured through the change in autofluorescence of NAD(P)H at 350/460 nm (excitation/emission) with a multiwavelength-excitation, dual-wavelength-emission fluorimeter (Delta RAM; PTI, Birmingham, NJ; Jones ). Briefly, cells (8 × 106 cells) were suspended in Hank's balanced salt solution (Sigma-Aldrich) and permeabilized with digitonin (Hawkins ). NAD(P)H levels were monitored before and after 10 μM rotenone.

Confocal ΔΨm measurement

HeLa cells were plated in six-well plates containing 0.2% gelatin–coated glass coverslips (Thapa ), and 100 nM TMRE perchlorate was added to cells and incubated for 30 min at 37°C. Nuclear DNA stain, 2-(4-ethoxyphenyl)-6-[6-(4-methylpiperazin-1-yl)-1H-benzimidazol-2-yl]-1H-benzimidazole (Hoescht 33342), was added for 5 min. Image acquisition was performed using a Carl Zeiss 510 confocal microscope using a 63× oil objective with excitation at 561 and 405 nm, respectively. Images were quantified using ImageJ (Madesh ).

Mitochondrial ROS measurement

HeLa cells were loaded with the mitochondrial superoxide–sensitive fluorophore MitoSOX Red (Life Technologies; 10 μM) in extracellular matrix (ECM) containing 2% bovine serum albumin (BSA) at 37°C for 10 min. Cells were incubated with Hoescht 33342 for an additional 5 min at room temperature. Cells were then washed, resuspended in ECM containing 0.2% BSA, and imaged using a Carl Zeiss 710 two-photon confocal microscope with a 20× liquid immersion objective at 405 and 561 nm for Hoescht 33342 and MitoSOX Red, respectively (Robinson ; Mukhopadhyay ).

Mitochondrial DNA content measurement

HeLa cells were transiently transfected with the mitochondrial marker monomeric yellow fluorescent protein plasmid construct. After 48 h, cells were fixed and stained for mitochondrial DNA using monoclonal anti-DNA antibody conjugated with secondary goat anti-mouse immunoglobulin M–Alexa Fluor 594 (Life Technologies). Slides were mounted using ProLong Gold Antifade reagent (Molecular Probes). Images were acquired using a Carl Zeiss 710 two-photon confocal microscope with a 63× oil objective. mtDNA was quantified using ImageJ software.

ATP measurement

ATP levels were measured using the CellTiter-Glo Luminescent Cell Viability Assay (Promega, Madison, WI) as per the manufacturer's instructions. ATP levels (luminescence) were measured in a model 96F nontreated white microwell plate (Nunc, Rochester, NY) using a Victor X5 2030 multilabel reader (Perkin Elmer, Waltham, MA; Irrinki ). To verify loading quantity, a Bradford assay was performed.

Assessment of cell death

HeLa cells were challenged with t-butyl hydroperoxide (200 μM). After treatment, the cells were labeled with annexin V–Alexa 405 conjugate for 25 min with annexin binding buffer (Molecular Probes, Life Technologies). During annexin V binding, propidium iodide (0.5 μg/ml) was also loaded to visualize plasma membrane integrity. Cell death was monitored using a Carl Zeiss 510 Meta confocal imaging system (Madesh , 2005, 2009).

Statistical analysis

All experiments were performed three or more times. Data from multiple experiments were quantified and are expressed as mean ± SEM, and differences between groups were analyzed by using a two-tailed Student's t test. p < 0.05 was considered significant in all analyses. Data were plotted with either GraphPad Prism (La Jolla, CA), version 5.0, or SigmaPlot 11.0 software.
  72 in total

1.  Imaging mitochondrial calcium signalling with fluorescent probes and single or two photon confocal microscopy.

Authors:  Sean M Davidson; Michael R Duchen
Journal:  Methods Mol Biol       Date:  2012

2.  Integrative genomics identifies MCU as an essential component of the mitochondrial calcium uniporter.

Authors:  Joshua M Baughman; Fabiana Perocchi; Hany S Girgis; Molly Plovanich; Casey A Belcher-Timme; Yasemin Sancak; X Robert Bao; Laura Strittmatter; Olga Goldberger; Roman L Bogorad; Victor Koteliansky; Vamsi K Mootha
Journal:  Nature       Date:  2011-06-19       Impact factor: 49.962

Review 3.  Transportsomes and channelsomes: are they functional units for physiological responses?

Authors:  Yasuo Mori; Shigeki Kiyonaka; Yoshikatsu Kanai
Journal:  Channels (Austin)       Date:  2011-09-01       Impact factor: 2.581

4.  Mitochondrial Ca2+ influx and efflux rates in guinea pig cardiac mitochondria: low and high affinity effects of cyclosporine A.

Authors:  An-Chi Wei; Ting Liu; Sonia Cortassa; Raimond L Winslow; Brian O'Rourke
Journal:  Biochim Biophys Acta       Date:  2011-02-26

5.  JC-1, but not DiOC6(3) or rhodamine 123, is a reliable fluorescent probe to assess delta psi changes in intact cells: implications for studies on mitochondrial functionality during apoptosis.

Authors:  S Salvioli; A Ardizzoni; C Franceschi; A Cossarizza
Journal:  FEBS Lett       Date:  1997-07-07       Impact factor: 4.124

6.  NF-kappaB protects cells from gamma interferon-induced RIP1-dependent necroptosis.

Authors:  Roshan J Thapa; Suresh H Basagoudanavar; Shoko Nogusa; Krishna Irrinki; Karthik Mallilankaraman; Michael J Slifker; Amer A Beg; Muniswamy Madesh; Siddharth Balachandran
Journal:  Mol Cell Biol       Date:  2011-05-16       Impact factor: 4.272

7.  Requirement of FADD, NEMO, and BAX/BAK for aberrant mitochondrial function in tumor necrosis factor alpha-induced necrosis.

Authors:  Krishna M Irrinki; Karthik Mallilankaraman; Roshan J Thapa; Harish C Chandramoorthy; Frank J Smith; Neelakshi R Jog; Rajesh Kumar Gandhirajan; Steven G Kelsen; Steven R Houser; Michael J May; Siddharth Balachandran; Muniswamy Madesh
Journal:  Mol Cell Biol       Date:  2011-07-11       Impact factor: 4.272

8.  Inactivation of the mitochondrial carrier SLC25A25 (ATP-Mg2+/Pi transporter) reduces physical endurance and metabolic efficiency in mice.

Authors:  Rea P Anunciado-Koza; Jingying Zhang; Jozef Ukropec; Sudip Bajpeyi; Robert A Koza; Richard C Rogers; William T Cefalu; Randall L Mynatt; Leslie P Kozak
Journal:  J Biol Chem       Date:  2011-02-04       Impact factor: 5.157

9.  A forty-kilodalton protein of the inner membrane is the mitochondrial calcium uniporter.

Authors:  Diego De Stefani; Anna Raffaello; Enrico Teardo; Ildikò Szabò; Rosario Rizzuto
Journal:  Nature       Date:  2011-06-19       Impact factor: 49.962

10.  MICU1 encodes a mitochondrial EF hand protein required for Ca(2+) uptake.

Authors:  Fabiana Perocchi; Vishal M Gohil; Hany S Girgis; X Robert Bao; Janet E McCombs; Amy E Palmer; Vamsi K Mootha
Journal:  Nature       Date:  2010-08-08       Impact factor: 49.962

View more
  50 in total

Review 1.  The molecular era of the mitochondrial calcium uniporter.

Authors:  Kimberli J Kamer; Vamsi K Mootha
Journal:  Nat Rev Mol Cell Biol       Date:  2015-08-19       Impact factor: 94.444

Review 2.  Why don't mice lacking the mitochondrial Ca2+ uniporter experience an energy crisis?

Authors:  Pei Wang; Celia Fernandez-Sanz; Wang Wang; Shey-Shing Sheu
Journal:  J Physiol       Date:  2018-10-11       Impact factor: 5.182

Review 3.  Mitochondrial calcium and the regulation of metabolism in the heart.

Authors:  George S B Williams; Liron Boyman; W Jonathan Lederer
Journal:  J Mol Cell Cardiol       Date:  2014-11-07       Impact factor: 5.000

Review 4.  Molecular mechanism of mitochondrial calcium uptake.

Authors:  Lele Wang; Xue Yang; Yuequan Shen
Journal:  Cell Mol Life Sci       Date:  2014-12-30       Impact factor: 9.261

5.  Ferutinin Induces Membrane Depolarization, Permeability Transition Pore Formation, and Respiration Uncoupling in Isolated Rat Liver Mitochondria by Stimulation of Ca2+-Permeability.

Authors:  Tatsiana Ilyich; Oksana Charishnikova; Szymon Sekowski; Maria Zamaraeva; Vitali Cheshchevik; Iosif Dremza; Nina Cheshchevik; Lyudmila Kiryukhina; Elena Lapshina; Ilya Zavodnik
Journal:  J Membr Biol       Date:  2018-03-28       Impact factor: 1.843

6.  The mitochondrial calcium uniporter underlies metabolic fuel preference in skeletal muscle.

Authors:  Jennifer Q Kwong; Jiuzhou Huo; Michael J Bround; Justin G Boyer; Jennifer A Schwanekamp; Nasab Ghazal; Joshua T Maxwell; Young C Jang; Zaza Khuchua; Kevin Shi; Donald M Bers; Jennifer Davis; Jeffery D Molkentin
Journal:  JCI Insight       Date:  2018-11-15

7.  The Proton-Coupled Monocarboxylate Transporter Hermes Is Necessary for Autophagy during Cell Death.

Authors:  Panagiotis D Velentzas; Lejie Zhang; Gautam Das; Tsun-Kai Chang; Charles Nelson; William R Kobertz; Eric H Baehrecke
Journal:  Dev Cell       Date:  2018-10-11       Impact factor: 12.270

Review 8.  Mitochondrial Ca2+ signaling.

Authors:  Trayambak Pathak; Mohamed Trebak
Journal:  Pharmacol Ther       Date:  2018-07-20       Impact factor: 12.310

9.  Structural Insights into Mitochondrial Calcium Uniporter Regulation by Divalent Cations.

Authors:  Samuel K Lee; Santhanam Shanmughapriya; Mac C Y Mok; Zhiwei Dong; Dhanendra Tomar; Edmund Carvalho; Sudarsan Rajan; Murray S Junop; Muniswamy Madesh; Peter B Stathopulos
Journal:  Cell Chem Biol       Date:  2016-08-25       Impact factor: 8.116

Review 10.  Subcellular ROS imaging methods: Relevance for the study of calcium signaling.

Authors:  David M Booth; Suresh K Joseph; György Hajnóczky
Journal:  Cell Calcium       Date:  2016-05-04       Impact factor: 6.817

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.