| Literature DB >> 24423722 |
Jie Liu1, Christopher Winstead-Derlega, Eric Houpt, Rebecca Heidkamp, Jean Pape, Rebecca Dillingham.
Abstract
INTRODUCTION: To our knowledge, there was no record of Vibrio cholerae in Haiti until the 2010 post earthquake outbreak.Entities:
Mesh:
Substances:
Year: 2014 PMID: 24423722 PMCID: PMC4193672 DOI: 10.3855/jidc.4524
Source DB: PubMed Journal: J Infect Dev Ctries ISSN: 1972-2680 Impact factor: 0.968
Nucleotide sequences of PCR assays.
| Target | Sequence (5’ - 3’) | Detection | Reference |
|---|---|---|---|
| toxR | F: GTTTGGCGAGAGCAAGGTTT | TaqMan Probe | [ |
| hlyA | F: ATCGTCAGTTTGGAGCCAGT | SYBR Green with melting curve | [ |
| O1-specific | F: CAACAGAATAGACTCAAGAA | SYBR Green with melting curve | [ |
| O139-specific | F: TTACCAGTCTACATTGCC | SYBR Green with melting curve | [ |
| ctxA | F:CGGGCAGATTCTAGACCTCCTG | SYBR Green with melting curve | [ |
| ctxB | F: ACTATCTTCAGCATATGCACATGG | SYBR Green with melting curve | [ |
| zot | F:TCGCTTAACGATGGCGCGTTTT | SYBR Green with melting curve | [ |
| rtxA | F:CTGAATATGAGTGGGTGACTTACG | SYBR Green with melting curve | [ |
| rtxC | F: CGACGAAGATCATTGACGAC | SYBR Green with melting curve | [ |
F: forward primer; R: reverse primer; P: probe.