Literature DB >> 24423722

Pre-earthquake non-epidemic Vibrio cholerae in Haiti.

Jie Liu1, Christopher Winstead-Derlega, Eric Houpt, Rebecca Heidkamp, Jean Pape, Rebecca Dillingham.   

Abstract

INTRODUCTION: To our knowledge, there was no record of Vibrio cholerae in Haiti until the 2010 post earthquake outbreak.
METHODOLOGY: This study describes the analysis of 301 stool samples from 117 infants in Port-au-Prince, Haiti, who participated in a pediatric nutrition study between July 2008 and October 2009.
RESULTS: Nine samples were identified positive with both SYBR Green and Taqman-MGB probe based molecular assays targeting V. cholerae hlyA and toxR, respectively (Ct = 33-40), but none were O1 or O139.
CONCLUSIONS: Our results from multiple molecular assays demonstrate the presence of non-O1/O139 V. cholerae DNA in stools collected from nine asymptomatic Haitian infants two years prior to the 2010 earthquake.

Entities:  

Mesh:

Substances:

Year:  2014        PMID: 24423722      PMCID: PMC4193672          DOI: 10.3855/jidc.4524

Source DB:  PubMed          Journal:  J Infect Dev Ctries        ISSN: 1972-2680            Impact factor:   0.968


Introduction

Despite the presence of epidemic cholera in the Caribbean throughout the 1800 and 1900s, Haiti was unaffected by cholera from 1960 until several months after the devastating January 12th 2010 earthquake. The cholera epidemic has killed thousands of people, and extensive efforts have focused on the etiology of this outbreak [1,2]. A recent article showed that two distinct populations of V. cholerae were detected in Haiti early in the epidemic and proposed that non-O1/O139 strains likely existed prior to the earthquake based on comparative genomic analysis [3]. However, all the samples tested were collected after the earthquake. Direct evidence of presence of V. cholerae in clinical or environmental samples prior to the earthquake would be valuable.

Methodology

Specimens

As part of a pediatric nutrition study presented elsewhere, we preserved 301 stool samples from 117 infants in Port-au-Prince, Haiti from July 2008 to October 2009 [4]. Surveillance stool samples were collected from study participants at 6, 9, 12, and 18 months of life. Samples were also collected from a post-intervention control group at nine months of life only. Samples were not specifically sought during episodes of diarrheal illness. Samples were aliquoted, stored at −20°C, and shipped to the University of Virginia.

Nucleic acid extraction and amplification

DNA was extracted using the QIAamp DNA stool Mini Kit (Qiagen Inc., Valencia, USA). The protocol was modified to include bead beating with 0.15 mm garnet beads (MO-BIO Laboratories, Inc, Carlsbad, USA) for 2 minutes followed by boiling for 5 minutes before extraction. The samples were tested with PCR assays listed in Table 1.
Table 1

Nucleotide sequences of PCR assays.

TargetSequence (5’ - 3’)*DetectionReference
toxRF: GTTTGGCGAGAGCAAGGTTTR: TCTCTTCTTCAACCGTTTCCAP: CGCAGAGTCGAAATGGCTTGGTaqMan Probe[5]
hlyAF: ATCGTCAGTTTGGAGCCAGTR: TCGATGCGTTAAACACGAAGSYBR Green with melting curve[6]
O1-specificF: CAACAGAATAGACTCAAGAAR: TATCTTCTGATACTTTTCTACSYBR Green with melting curve[7]
O139-specificF: TTACCAGTCTACATTGCCR: CGTTTCGGTAGTTTTTCTGGSYBR Green with melting curve[7]
ctxAF:CGGGCAGATTCTAGACCTCCTGR:CGATGATCTTGGAGCATTCCCACSYBR Green with melting curve[8]
ctxBF: ACTATCTTCAGCATATGCACATGGRclassical CCTGGTACTTCTACTTGAAACGREl tor CCTGGTACTTCTACTTGAAACASYBR Green with melting curve[9]
zotF:TCGCTTAACGATGGCGCGTTTTR:AACCCCGTTTCACTTCTACCCASYBR Green with melting curve[8]
rtxAF:CTGAATATGAGTGGGTGACTTACGR:GTGTATTGTTCGATATCCGCTACGSYBR Green with melting curve[10]
rtxCF: CGACGAAGATCATTGACGACR: CATCGTCGTTATGTGGTTGCSYBR Green with melting curve[10]

F: forward primer; R: reverse primer; P: probe.

Results and discussion

We first screened the samples with SYBR Green and Taqman-MGB probe based molecular assays targeting Vibrio cholerae hlyA and toxR, respectively (Table 1), two widely used gene targets for detection of Vibrio cholerae. A stringent definition of positivity, i.e. positive for both targets was applied to rule out potential non-specific amplification with fecal samples and stochastic detection at lower limit of detection. Among 301 stool samples, nine were identified as positive (hlyA Ct = 35.6 ± 2.4; toxR Ct = 36.8 ± 2.2). This finding was confirmed by amplicon sequencing. Two samples each were from stools collected at ages 6, 9, and 18 months, and three samples were from stools collected at 12 months. We were unable to culture V. cholerae on Thiosulfate-citrate-bile salts-sucrose agar directly or after enrichment in alkaline peptone water, most likely due to the age of the samples, storage conditions, multiple freeze-thaw cycles, etc. Therefore further characterization was continued with DNA directly extracted from stool using the published assays in Table 1, to differentiate O1, O139 and non O1/O139, or to determine the Variable-Number Tandem Repeat (VNTR), or to test for various virulent genes. None of the samples were identified as O1 or O139 with the published assays [7]. Similar to reported genotypic data describing non O1/O139 strains [3], virulence factors, including ctxA, ctxB, zot, rtxA, rtxC, were not detectable in our samples. We further attempted to determine the multilocus Variable-Number Tandem Repeat (VNTR), a useful tool for tracking the origin of V. choleare [11,12]. Five loci (VC0147, VC0436/437, VC1650, VCA0171, VCA0283) were amplified and sequenced, however only one (VC0147) yielded interpretable sequence data for two samples (5 and 6 repeats, respectively) which would likely lead to their categorization as environmental non O1/O139 [3]. Amplicon contamination was ruled out, as we confirmed positivity with a separate toxR assay. In addition, Vibrio cholerae strains that had been handled in the laboratory were all ctxB-positive. Due to the incapability of generating isolates from these samples and potential non-specific amplification with complex nucleic acid from stool samples, full characterization may require metagenomic sequencing. However, our results from multiple molecular assays clearly demonstrated the presence of non-O1/O139 V. cholerae DNA in stools collected from nine asymptomatic Haitian infants two years prior to the earthquake.
  12 in total

1.  Development of a hexaplex PCR assay for rapid detection of virulence and regulatory genes in Vibrio cholerae and Vibrio mimicus.

Authors:  D V Singh; Sree Renjini Isac; R R Colwell
Journal:  J Clin Microbiol       Date:  2002-11       Impact factor: 5.948

2.  Growth in late infancy among HIV-exposed children in urban Haiti is associated with participation in a clinic-based infant feeding support intervention.

Authors:  Rebecca A Heidkamp; Rebecca J Stoltzfus; Daniel W Fitzgerald; Jean W Pape
Journal:  J Nutr       Date:  2012-02-29       Impact factor: 4.798

3.  TaqMan PCR for detection of Vibrio cholerae O1, O139, non-O1, and non-O139 in pure cultures, raw oysters, and synthetic seawater.

Authors:  W J Lyon
Journal:  Appl Environ Microbiol       Date:  2001-10       Impact factor: 4.792

4.  Genomic diversity of 2010 Haitian cholera outbreak strains.

Authors:  Nur A Hasan; Seon Young Choi; Mark Eppinger; Philip W Clark; Arlene Chen; Munirul Alam; Bradd J Haley; Elisa Taviani; Erin Hine; Qi Su; Luke J Tallon; Joseph B Prosper; Keziah Furth; M M Hoq; Huai Li; Claire M Fraser-Liggett; Alejandro Cravioto; Anwar Huq; Jacques Ravel; Thomas A Cebula; Rita R Colwell
Journal:  Proc Natl Acad Sci U S A       Date:  2012-06-18       Impact factor: 11.205

5.  Detection of RTX toxin gene in Vibrio cholerae by PCR.

Authors:  K H Chow; T K Ng; K Y Yuen; W C Yam
Journal:  J Clin Microbiol       Date:  2001-07       Impact factor: 5.948

6.  The origin of the Haitian cholera outbreak strain.

Authors:  Chen-Shan Chin; Jon Sorenson; Jason B Harris; William P Robins; Richelle C Charles; Roger R Jean-Charles; James Bullard; Dale R Webster; Andrew Kasarskis; Paul Peluso; Ellen E Paxinos; Yoshiharu Yamaichi; Stephen B Calderwood; John J Mekalanos; Eric E Schadt; Matthew K Waldor
Journal:  N Engl J Med       Date:  2010-12-09       Impact factor: 91.245

7.  Epidemiological study of Vibrio cholerae using variable number of tandem repeats.

Authors:  Raikamal Ghosh; G Balakrish Nair; Li Tang; J Glenn Morris; Naresh C Sharma; Mamatha Ballal; Pallavi Garg; Thandavarayan Ramamurthy; O Colin Stine
Journal:  FEMS Microbiol Lett       Date:  2008-09-22       Impact factor: 2.742

8.  Method of DNA extraction and application of multiplex polymerase chain reaction to detect toxigenic Vibrio cholerae O1 and O139 from aquatic ecosystems.

Authors:  Irma N G Rivera; Erin K Lipp; Ana Gil; Nipa Choopun; Anwar Huq; Rita R Colwell
Journal:  Environ Microbiol       Date:  2003-07       Impact factor: 5.491

9.  Recent clonal origin of cholera in Haiti.

Authors:  Afsar Ali; Yuansha Chen; Judith A Johnson; Edsel Redden; Yfto Mayette; Mohammed H Rashid; O Colin Stine; J Glenn Morris
Journal:  Emerg Infect Dis       Date:  2011-04       Impact factor: 6.883

10.  Molecular epidemiology of geographically dispersed Vibrio cholerae, Kenya, January 2009-May 2010.

Authors:  Ahmed Abade Mohamed; Joseph Oundo; Samuel M Kariuki; Hamadi I Boga; Shanaz K Sharif; Willis Akhwale; Jared Omolo; Anyangu S Amwayi; David Mutonga; David Kareko; Mercy Njeru; Shan Li; Robert F Breiman; O Colin Stine
Journal:  Emerg Infect Dis       Date:  2012-06       Impact factor: 6.883

View more
  2 in total

1.  A plant from the altiplano of Northern Chile Senecio nutans, inhibits the Vibrio cholerae pathogen.

Authors:  Adrian Paredes; Yanett Leyton; Carlos Riquelme; Glauco Morales
Journal:  Springerplus       Date:  2016-10-13

2.  Characterization of Two Cryptic Plasmids Isolated in Haiti from Clinical Vibrio cholerae Non-O1/Non-O139.

Authors:  Daniela Ceccarelli; Geneviève Garriss; Seon Y Choi; Nur A Hasan; Ramunas Stepanauskas; Mihai Pop; Anwar Huq; Rita R Colwell
Journal:  Front Microbiol       Date:  2017-11-23       Impact factor: 5.640

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.