Anti-hepatitis C virus compounds obtained from Glycyrrhiza uralensis and other Glycyrrhiza species.

Development of complementary and/or alternative drugs for treatment of hepatitis C virus (HCV) infection is still much needed from clinical and economic points of view. Antiviral substances obtained from medicinal plants are potentially good targets to study. Glycyrrhiza uralensis and G. glabra have been commonly used in both traditional and modern medicine. In this study, extracts of G. uralensis roots and their components were examined for anti-HCV activity using an HCV cell culture system. It was found that a methanol extract of G. uralensis roots and its chloroform fraction possess anti-HCV activity with 50%-inhibitory concentrations (IC(50)) of 20.0 and 8.0 μg/mL, respectively. Through bioactivity-guided purification and structural analysis, glycycoumarin, glycyrin, glycyrol and liquiritigenin were isolated and identified as anti-HCV compounds, their IC(50) being 8.8, 7.2, 4.6 and 16.4 μg/mL, respectively. However, glycyrrhizin, the major constituent of G. uralensis, and its monoammonium salt, showed only marginal anti-HCV activity. It was also found that licochalcone A and glabridin, known to be exclusive constituents of G. inflata and G. glabra, respectively, did have anti-HCV activity, their IC(50) being 2.5 and 6.2 μg/mL, respectively. Another chalcone, isoliquiritigenin, also showed anti-HCV activity, with an IC(50) of 3.7 μg/mL. Time-of-addition analysis revealed that all Glycyrrhiza-derived anti-HCV compounds tested in this study act at the post-entry step. In conclusion, the present results suggest that glycycoumarin, glycyrin, glycyrol and liquiritigenin isolated from G. uralensis, as well as isoliquiritigenin, licochalcone A and glabridin, would be good candidates for seed compounds to develop antivirals against HCV.

50%‐cytotoxic concentrations

envelope

fraction

glyceraldehyde‐3‐phosphate dehydrogenase

hepatitis C virus

50%‐inhibitory concentration

internal diameter

selectivity index

Hepatitis C virus is a member of the genus Hepacivirus and the family Flaviviridae. Based on the heterogeneity of the viral genome, HCV is currently classified into seven genotypes (1–7) and more than 67 subtypes (1a, 1b, 2a, 2b etc.) 1, 2. The viral genome, a single‐stranded, positive‐sense RNA of 9.6 kb, encodes a polyprotein precursor consisting of about 3000 amino acid residues that is cleaved by host and viral proteases to generate 10 mature proteins, namely core, E1, E2, a putative ion channel p7, and nonstructural proteins NS2, NS3, NS4A, NS4B, NS5A and NS5B 3. Core, E1 and E2 are components of the infectious virus particle together with the viral genome; however, the nonstructural proteins constitute the viral replication complex, where replication of the viral genome takes place. The HCV proteins also play essential roles in the pathological processes associated with HCV infection, such as carcinogenesis and glucose and lipid metabolic disorders 4, 5.

Hepatitis C virus is among the major causative agents of chronic hepatitis, hepatic cirrhosis and hepatocellular carcinoma 5, 6, 7. The global prevalence of HCV is >2.5%; thus, about 180 million people are chronically infected with this virus worldwide. A variety of standard treatment regimens using combinations of pegylated interferon, ribavirin and other direct‐acting agents, such as HCV‐specific inhibitors against NS3 protease and NS5A, have been adopted with considerable success. However, some clinically important issues remain unsolved, such as the emergence of drug‐resistant virus and the cost of these drugs. Therefore, development of complementary and/or alternative drugs, especially those from medicinal plants, for treating HCV infection is still much needed from both clinical and economic points of view 8, 9.

Glycyrrhiza uralensis and G. glabra have been widely used as supplementary treatments in both traditional herbal medicine and modern medicine 10, 11. The radix of Glycyrrhiza spp. is commonly known as ‘‘gan cao” in Chinese and licorice in English. Bioactive constituents of Glycyrrhiza species can be classified into triterpenoids (such as glycyrrhizic acid), coumarins (such as glycycoumarin, glycyrin and glycyrol), flavones (such as liquiritin and liquiritigenin), chalcones (such as isoliquiritigenin and licochalcone A), isoflavans (such as glabridin), stilbenoids and other miscellaneous compounds 11. Glycyrrhizic acid, also known as glycyrrhizin and considered the principal component of Glycyrrhiza spp., is a glycosylated triterpenoid saponin that consists of one molecule of glycyrrhetinic acid and two molecules of d‐glucuronic acid. Upon hydrolysis, the aglycone, 18β‐glycyrrhetinic acid (simply called glycyrrhetinic acid), and two molecules of d‐glucuronic acid are released. Glycyrrhizin and other compounds isolated from Glycyrrhiza species reportedly have antiviral activity against a variety of viruses, including HIV, herpes simplex virus, influenza virus, severe acute respiratory syndrome coronavirus, hepatitis viruses and enteroviruses 11, 12, 13, 14, 15. As for hepatitis viruses, glycyrrhizin has been used to treat liver diseases, including chronic hepatitis B and C 10. Although glycyrrhizin decreases serum alanine aminotransferase concentrations in HCV‐infected patients, it does not significantly reduce amounts of HCV RNA 16, 17. It has been reported that a glycyrrhizin‐containing preparation reduces hepatic steatosis in transgenic mice expressing the full‐length HCV polyprotein 18. Recently, anti‐HCV activity of glycyrrhizin in vitro was reported 19, 20. However, clear evidence for it still appears to be lacking.

In this study, we used an HCV cell culture system to examine a methanol extract and a chloroform sub‐fraction of G. uralensis and certain isolated compounds, as well as commercially available purified compounds, such as glycyrrhizin and glycyrrhetinic acid, for their anti‐HCV activity. We report here that glycycoumarin, glycyrin, glycyrol and liquiritigenin isolated from G. uralensis showed anti‐HCV activity whereas glycyrrhizin showed only a marginal anti‐HCV activity. We also found that some other constituents of G. uralensis or of G. inflata and G. glabra , such as isoliquiritigenin, licochalcone A and glabridin, showed anti‐HCV activity.

MATERIALS AND METHODS

Cells and viruses

Huh7.5 cells and the plasmid pFL‐J6/JFH1 21 were kindly provided by Dr. C. M. Rice (Rockefeller University, New York, NY, USA). Huh7.5 cells were cultured in Dulbecco's modified Eagle's medium supplemented with FBS (Biowest, Nuaillé, France), non‐essential amino acids (Invitrogen, Carlsbad, CA, USA), penicillin (100 IU/mL) and streptomycin (100 μg/mL) (Invitrogen) at 37 °C in a 5% CO2 incubator. A cell culture‐adapted strain of HCV genotype 2a (J6/JFH1‐P47) was prepared as described previously 22 and used in this study at an MOI of 2.0.

Extraction, sub‐fractionation and purification of G. uralensis roots

G. uralensis roots were purchased from Tochimoto Tenkaido (Osaka, Japan). A methanol extract of G. uralensis roots was prepared and subjected to purification procedures, as described previously 23, 24, 25, 26. In brief, G. uralensis roots were dried at room temperature and pulverized. They were then extracted with methanol at 50 °C for 6 hr. The extracts were filtered and the filtrates concentrated by using an evaporator at temperatures not exceeding 40 °C. The residues obtained were re‐suspended in water and successively partitioned between chloroform and n‐butanol. The chloroform extract was subjected to recycling preparative HPLC (solvent system, 100% methanol; column, GS‐320 + GS‐310, 21.5 mm ID × 1000 mm, flow rate; 5.0 mL/min; detection, UV 210 nm: Condition A) to afford 10 fractions (Fr.1 to Fr.10). Fr.7 was subjected to HPLC separation (solvent system, acetonitrile–water; column, Imtakt Unison UK‐C18C (Kyoto, Japan), 4.6 mm ID × 250 mm; flow rate, 2.0 mL/min; detection, UV 254 nm) to give 12 fractions (Fr.7–1 to 7–12) and glycyrin (2.5 mg; Fr.7–9). Fr.7–6 was purified by recycling HPLC (Condition A) to afford glycycoumarin (0.7 mg). Fr.8‐ to Fr.10 were combined and then re‐chromatographed by HPLC (solvent system, acetonitrile–water; column, Imtakt Unison UK‐C18C, 4.6 mm ID × 250 mm; flow rate, 2.0 mL/min; detection, UV 254 nm) to give 15 fractions (Fr.8–1 to Fr.8–15). Fr.8–3 was subjected to recycling HPLC (Condition A) to give liquiritigenin (1.2 mg). Fr.8–9 was purified by recycling HPLC (Condition A) to afford glycyrol (1.1 mg). The 1H‐ and 13C‐NMR spectra were measured with a Jeol ECA 500 spectrometer (500 MHz; Tokyo, Japan). HPLC was performed on a JASCOLC‐2000 plus system (Tokyo, Japan).

Chemicals

Glycyrrhizic acid (cat. no. 074‐03481), glycyrrhizic acid mono‐ammonium salt n‐hydrate (cat. no. 075‐02171), glycyrrhetinic acid (cat. no. 072‐02181) and glabridin (cat. no. 070‐04821) were purchased from Wako Pure Chemical Industries (Osaka, Japan). Liquiritin (cat. no. L8045), liquiritigenin (cat. no. 78825) and licochalcone A (cat. no. 68783) were purchased from Sigma–Aldrich (Tokyo, Japan) and isoliquiritigenin (cat. no. I0822) from Tokyo Chemical Industry (Tokyo, Japan). Licorice‐saponins G2 (cat. no. P2502) and H2 (cat. no. P2503), and glycyrrhetic acid 3‐O‐glucuronide (cat. no. NH080502) were purchased from Funakoshi (Tokyo, Japan). Glycycoumarin, glycyrol, glycyrin and liquiritigenin were isolated from G. uralensis extracts in this study, as described above.

Analysis of anti‐HCV activity of plant extracts and purified compounds

Test samples were weighed and dissolved in DMSO to obtain stock solutions at 10 or 30 mg/mL. The stock solutions were stored at –20 °C until used. Huh7.5 cells were seeded in 24‐well plates (1.6 × 105 cells/well). HCV was mixed with serial dilutions of the test samples (100, 30, 10, 3 and 1 μg/mL) and inoculated into the cells. After 2 hr, the cells were washed with medium to remove residual virus and further incubated in medium containing the same concentrations of the samples as those during virus inoculation. In time‐of‐addition experiments, treatment with the samples was performed only during or after virus inoculation in order to assess the mode of action of the samples examined. Culture supernatants were collected 1 and 2 days post‐infection and titrated for virus infectivity, as described below. Virus and cells treated with medium containing 0.1% DMSO served as controls. Percent inhibition of the virus infectivity for each dilution of the samples was calculated by comparison with mock‐treated controls and IC50 determined.

Virus titration

Virus samples were diluted serially 10‐fold in complete medium and inoculated onto Huh7.5 cells seeded on glass coverslips in a 24‐well plate. After virus adsorption for 2 hr, the cells were washed with medium to remove residual virus and cultured for 24 hr. The virus‐infected cells were stained with an indirect immunofluorescence method as reported previously 27. In brief, the virus‐infected cells were washed with PBS, fixed with 4% paraformaldehyde for 15 min and permeabilized with 0.1% Triton X‐100 in PBS for 15 min at room temperature. After being washed three times with PBS, the cells were incubated with HCV‐infected patient's serum for 1 hr, followed by incubation with FITC‐conjugated goat anti‐human IgG (MBL, Nagoya, Japan). The cells were counterstained with Hoechst 33342 (Molecular Probes, Eugene, OR, USA) for 5 min and HCV‐infected cells were counted under a BZ‐9000 fluorescence microscope (Keyence, Osaka, Japan).

Cytotoxicity assay

The cytotoxicity of the samples was assessed by WST‐1 assay as described previously with a slight modification 27. In brief, Huh7.5 cells in 96‐well plates were treated with serial dilutions of the samples or 0.1% DMSO as a control for 48 hr. At the end of the treatment, 10 μL of WST‐1 reagent (Roche, Mannheim, Germany) was added to each well and the cells cultured for 1 hr. The WST‐1 reagent is absorbed by the cells and converted to formazan by mitochondrial dehydrogenases. The amount of formazan, which correlates with the number of living cells, was determined by measuring the absorbance of each well using a microplate reader at 450 and 630 nm. Percent cell viability compared to the control was calculated for each dilution of the samples and CC50 were determined.

Immunoblotting

Cells were lysed with an SDS sample buffer, after which equal amounts of protein were subjected to SDS–polyacrylamide gel electrophoresis and transferred onto a polyvinylidene difluoride membrane (Millipore, Bedford, MA, USA), as described previously 28, 29. The membranes were incubated with the respective primary antibodies. The primary antibodies used were mouse monoclonal antibodies against HCV NS3 and GAPDH (Millipore). Horseradish peroxidase‐conjugated goat anti‐mouse immunoglobulin (Invitrogen) was used to visualize the respective proteins by means of an enhanced chemiluminescence detection system (ECL; GE Healthcare, Buckinghamshire, UK).

Real‐time quantitative RT‐PCR

Real‐time quantitative RT‐PCR was performed as described previously 28, 29. In brief, total RNA was extracted from the cells using a ReliaPrep RNA cell miniprep system (Promega, Madison, WI, USA) according to the manufacturer's instructions. One microgram of total RNA was reverse transcribed using a GoScript Reverse Transcription system (Promega) with random primers and subjected to real‐time quantitative PCR analysis using SYBR Premix Ex Taq (TaKaRa, Kyoto, Japan) in a MicroAmp 96‐well reaction plate and an ABI PRISM 7500 system (Applied Biosystems, Foster City, CA, USA). The HCV‐specific primers to amplify an NS5A region of the viral genome were 5′‐AGACGTATTGAGGTCCATGC‐3′ (sense) and 5′‐CCGCAGCGACGGTGCTGATAG‐3′ (antisense). Human GAPDH gene expression was measured using primers 5′‐GCCATCAATGACCCCTTCATT‐3′ (sense) and 5′‐TCTCGCTCCTGGAAGATGG‐3′, which served as an internal control.

RESULTS

Anti‐HCV activity of a methanol extract and sub‐fractions of G. uralensis roots

First, we examined a crude methanol extract of G. uralensis roots for anti‐HCV activity using the HCV J6/JFH1‐P47 strain and Huh7.5 cells. The IC50 and CC50 values of the crude methanol extract were 20.0 and 300 μg/mL, respectively, the selectivity indexes (SI: CC50/IC50) being 15 (Table 1). We further partitioned the methanol extract using different solvents and found that the anti‐HCV activity was concentrated into a chloroform partition, whose IC50 and CC50 were 8.0 and 93 μg/mL, respectively, the SI being 11.6.

Table 1

Anti‐HCV activity (IC50), cytotoxicity (CC50) and selectivity index (SI) of extracts of G. uralensis roots

Sample	IC50 (µg/mL)	CC50 (µg/mL)	SI
Methanol extract	20.0	300	15.0
Chloroform partition	8.0	93	11.6
n‐butanol partition	17.5	250	14.3
Water partition	95.0	>500	>5.3

Next, we sub‐fractionated the chloroform partition by using recycling HPLC and examined the sub‐fractions for anti‐HCV activity. We found significant anti‐HCV activity with fractions 6–10, IC50 ranging between 2.9 and 4.9 μg/mL (Table 2). We further tried to purify a major component(s) in fractions 6–10 by using recycling HPLC: we identified glycycoumarin 30, glycyrin 31, glycyrol 32 and liquiritigenin 33 by NMR spectrum analysis (data not shown).

Table 2

Anti‐HCV activity (IC50), cytotoxicity (CC50) and selectivity index (SI) of recycling HPLC fractions of chloroform partition of G. uralensis roots

Sample	IC50 (µg/mL)	CC50 (µg/mL)	SI
Fraction 1	>30	>30	na
Fraction 2	>30	>30	na
Fraction 3	>30	>30	na
Fraction 4	>30	>30	na
Fraction 5	20	>30	>1.5
Fraction 6	2.9	65	22
Fraction 7	3.6	40	11
Fraction 8	2.9	40	14
Fraction 9	2.9	>70	>24
Fraction 10	4.9	>70	>14

na, not applicable.

Anti‐HCV activity of G. uralensis‐derived purified compounds and related chemical compounds obtained from other Glycyrrhiza species

We then examined the purified compounds obtained from the G. uralensis extracts (glycycoumarin, glycyrin, glycyrol and liquiritigenin) and other Glycyrrhiza‐derived chemical compounds, such as glycyrrhizin and its derivatives. We found that glycyrrhizin (glycyrrhizic acid) and its monoammonium salt (glycyrrhizic acid monoammonium), the latter being more water‐soluble than the former, possessed only marginal anti‐HCV activity, IC50 values being 180 and 320 μg/mL, respectively (Table 3). The aglycone of glycyrrhizin, glycyrrhetinic acid, showed more significant anti‐HCV activity than did glycyrrhizin, its IC50 being 40 μg/mL. It should be noted that their anti‐HCV activities were weaker than those of the recycling HPLC fractions 6–10 of the G. uralensis extract. The monoglucuronide form of glycyrrhizin, glycyrrhetic acid 3‐O‐glucuronide, did not show significant anti‐HCV activity at the concentration tested. These results suggest that another compound(s) in fractions 6–10 was responsible for the anti‐HCV activity. Two other saponins tested in this study, licorice‐saponins G2 and H2, did not show detectable anti‐HCV activity. On the other hand, coumarins, such as glycycoumarin, glycyrin and glycyrol, which were isolated in this study (purity >90%) from the G. uralensis extracts, showed potent anti‐HCV activity, IC50 being 4.6–8.8 μg/mL. Liquiritigenin, which was also isolated from the G. uralensis extracts, showed weaker anti‐HCV activity than the coumarins. Also, isoliquiritigen, licochalcone A and glabridin exhibited potent anti‐HCV activity, their IC50 being 3.7, 2.5 and 6.2 μg/mL, respectively. It should be noted that licochalcone A and glabridin have been reported to be absent in G. uralensis but present in G. inflata and G. glabra 34.

Table 3

Anti‐HCV activity (IC50), cytotoxicity (CC50) and selectivity index (SI) of G. uralensis‐ and other Glycyrrhiza spp‐derived compounds

Sample	IC50 (µg/mL)	CC50 (µg/mL)	SI
Triterpenoids
Glycyrrhizin	180	560	3.1
Glycyrrhizic acid monoammonium	320	690	2.2
Glycyrrhetic acid 3‐O‐glucuronide	>30b	>30	na
Glycyrrhetinic acid	40.0	77.4	1.9
Licorice‐saponin G2	>30b	>30	na
Licorice‐saponin H2	>30b	>30	na
Coumarins
Glycycoumarin (isolated)	8.8	69.0	7.8
Glycyrin (isolated)	7.2	25.0	3.5
Glycyrol (isolated)	4.6	35.5	7.7
Flavonoids
Flavanones
Liquiritin	75.0	570	7.6
Liquiritigenin	16.4	125	7.6
Chalcones
Isoliquiritigenin	3.7	11.0	3.0
Licochalcone Aa	2.5	20.0	8.0
Isoflavan
Glabridina	6.2	22.7	3.7

Not detected in G. uralensis 34.

No detectable HCV inhibition at 30 μg/mL. na, not applicable.

Mode‐of‐action of G. uralensis‐derived isolated compounds and related compounds obtained from other Glycyrrhiza species

To determine whether the anti‐HCV effects of the compounds of Glycyrrhiza species are exerted on the entry or post‐entry stage, we performed the following time‐of‐addition experiments.

HCV was mixed with a test compound and the mixture inoculated into the cells. After virus adsorption for 2 hr, the residual virus and test sample were removed and the cells re‐fed with fresh medium without the test sample for 46 hr. This experiment examines the antiviral effect at the entry step.

HCV was inoculated into the cells in the absence of a test sample. After virus adsorption for 2 hr, the residual virus was removed and the cells treated with the test samples for 46 hr. This experiment examines the antiviral effect at the post‐entry step.

As a positive control, HCV mixed with the test sample was inoculated into the cells. After virus adsorption for 2 hr, the residual virus and test sample were removed and the cells treated with the test samples for 46 hr.

We found that all the Glycyrrhiza species‐derived compounds as well as the chloroform partition of the G. uralensis extract exerted their antiviral effects after virus inoculation (Table 4). These results suggest that all the anti‐HCV compounds of Glycyrrhiza species tested in this study, namely, glycycoumarin, glycyrin, glycyrol, liquiritigenin, isoliquiritigenin, licochalcone A and glabridin, as well as the chloroform extract, act primarily at the post‐entry step.

Table 4

Mode‐of‐action analysis of anti‐HCV activities of G. uralensis‐ and other Glycyrrhiza spp.‐derived compounds

Compound	Conc. (mg/mL)a	Anti‐HCV activity (% inhibition)
		During‡	After‡	During & afterb
Chloroform partition	30	28.6	100	100
Glycycoumarin	20	16.7	100	100
Glycyrin	15	18.4	98.3	99.6
Glycyrol	10	21.3	100	100
Liquiritigenin	30	15.5	90.0	87.2
Isoliquiritigenin	8	14.1	91.0	82.5
Licochalcone A	5	0	94.4	93.8
Glabridin	12	0	91.0	93.8

The concentrations of each compound used were 2 × IC50.

Treatment with the compound was administered only during, only after or both during and after virus inoculation.

Inhibition of HCV RNA replication and HCV protein synthesis by glycycoumarin, glycyrin, and glycyrol obtained from G. uralensis

To further confirm that G. uralensis‐derived compounds exert their anti‐HCV activities at the post‐entry step, Huh7.5 cells were inoculated with HCV for 2 hr, followed by treatment with each of compounds for 1–2 days. The results obtained clearly demonstrated that glycycoumarin, glycyrin and glycyrol inhibit HCV RNA replication, resulting in decreased HCV protein synthesis as demonstrated by both real‐time quantitative RT‐PCR and immunoblotting analyses (Fig. 1a, b). We also confirmed that production of HCV infectious particles is inhibited by glycycoumarin, glycyrin and glycyrol at 1 and 2 days post‐infection (Fig 1c).

Figure 1

Effects of glycycoumarin, glycyrin and glycyrol isolated from (a) Huh 7.5 cells infected with HCV J6/JFH1 and treated with either glycycoumarin (20 μg/mL), glycyrin (15 μg/mL), glycyrol (10 μg/mL) or left untreated were subjected to western blot analysis using monoclonal antibody against the HCV NS3 protein at 1 and 2 days post‐infection. GAPDH served as an internal control to verify equal amounts of sample loading. Signal intensities of NS3 were normalized to the corresponding GAPDH signal. (b) Amounts of HCV RNA in the cells described in (a) were measured by real‐time quantitative RT‐PCR analysis. These amounts were normalized to GAPDH mRNA expression. Data represent means ± SEM of data from two independent experiments. The value for the untreated control at 1 day post‐infection is arbitrarily expressed as 1.0. * P < 0.001, compared with the control. (c) Amounts of HCV infectious particles in the supernatants of the cultures described in (a) and (b) were determined: data for glycycoumarin, glycyrin, glycyrol and the untreated control are shown. Data represent means ± SEM of data from two independent experiments. * P < 0.05; † P < 0.01, compared with the untreated control; dpi, days post infection.

DISCUSSION

Glycyrrhiza species possess a variety of bioactive compounds, such as: (i) triterpenoids, for example, glycyrrhizin, glycyrrhetic acid 3‐O‐glucuronide, glycyrrhetinic acid and various licorice‐saponins; (ii) coumarins, for example, glycycoumarin, glycyrin and glycyrol; (iii) flavanones, for example, liquiritin and liquiritigenin; (iv) chalcones, for example, isoliquiritigenin and licochalcone; (v) isoflavans, for example, glabridin; (vi) stilbenoids, for example, dihydrostilbenes; and other miscellaneous compounds 11. In this connection, flavanones, chalcones and isoflavans are members of flavonoids.

Glycyrrhizin is the major constituent of Glycyrrhiza species, representing 1–9% of the total 14. Glycyrrhizin and other compounds isolated from Glycyrrhiza species reportedly possess antiviral activity against a variety of viruses 11, 12, 13, 14, 15. With regard to HCV, it was recently reported that glycyrrhizin inhibits HCV infection in Huh‐7 cells 19, 20. On the other hand, controversial observations have been reported in clinical settings; namely, that glycyrrhizin has no significant effect on amounts of HCV RNA whereas it reduces serum alanine aminotransferase concentrations in HCV‐infected patients 16, 17. These apparently contradictory findings might be explained by a membrane‐stabilizing effect of glycyrrhizin; clear evidence for antiviral activity of glycyrrhizin is still lacking 10. In the present study, we observed that glycyrrhizin and glycyrrhizic acid monoammonium showed only marginal anti‐HCV activity (Table 3). Glycyrrhetinic acid showed significant anti‐HCV activity. However, their anti‐HCV activities were significantly weaker than that of the HPLC fractions obtained from G. uralensis extract. On the other hand, we found that certain coumarins, such as glycycoumarin, glycyrin and glycyrol, and a flavanone, liquiritigenin, isolated from G. uralensis, as well as other compounds contained in Glycyrrhiza species, possess potent anti‐HCV activities. Mode‐of‐action analysis revealed that all the Glycyrrhiza‐derived anti‐HCV compounds tested act primarily at the post‐entry step. Consistent with our observations, other researchers have also reported that two flavonoids, isoliquiritigenin and glycycoumarin, extracted from Glycyrrhizae radix, either G. uralensis or G. glabra, inhibit replication of an HCV subgenomic RNA replicon in vitro 35. The IC50 values of isoliquiritigenin and glycycoumarin against HCV subgenomic replicon were 6.2 and 15.5 μg/mL, respectively. On the other hand, to the best of our knowledge, there are no published reports so far regarding anti‐HCV activities of glycyrin and glycyrol. It has been reported that glycyrin, which is known to possess peroxisome proliferator‐activated receptor‐γ ligand‐binding activity, shows antibacterial activity against Streptococcus pyogenes, Haemophilus influenzae and Moraxella catarrhalis 36, 37, 38. Glycyrol reportedly exerts anti‐inflammatory effects by binding to calcineurin to inhibit its activity 39, 40. However, the possible antimicrobial activity of glycyrol has not been reported. Further study is needed to elucidate the detailed mechanism of anti‐HCV activities of glycyrin and glycyrol, and also possible antiviral activities against viruses other than HCV.

In conclusion, our results suggest that glycycoumarin, glycyrin, glycyrol and liquiritigenin isolated from G. uralensis, as well as isoliquiritigenin, licochalcone A and glabridin, would be good candidates for seed compounds to develop antivirals against HCV.

DISCLOSURE

The authors have no conflicts of interest to declare.