Literature DB >> 24387266

RNA-Seq derived identification of differential transcription in the chrysanthemum leaf following inoculation with Alternaria tenuissima.

Huiyun Li, Sumei Chen, Aiping Song, Haibin Wang, Weimin Fang, Zhiyong Guan, Jiafu Jiang1, Fadi Chen.   

Abstract

BACKGROUND: A major production constraint on the important ornamental species chrysanthemum is black spot which is caused by the necrotrophic fungus Alternaria tenuissima. The molecular basis of host resistance to A. tenuissima has not been studied as yet in any detail. Here, high throughput sequencing was taken to characterize the transcriptomic response of the chrysanthemum leaf to A. tenuissima inoculation.
RESULTS: The transcriptomic data was acquired using RNA-Seq technology, based on the Illumina HiSeq™ 2000 platform. Four different libraries derived from two sets of leaves harvested from either inoculated or mock-inoculated plants were characterized. Over seven million clean reads were generated from each library, each corresponding to a coverage of >350,000 nt. About 70% of the reads could be mapped to a set of chrysanthemum unigenes. Read frequency was used as a measure of transcript abundance and therefore as an identifier of differential transcription in the four libraries. The differentially transcribed genes identified were involved in photosynthesis, pathogen recognition, reactive oxygen species generation, cell wall modification and phytohormone signalling; in addition, a number of varied transcription factors were identified. A selection of 23 of the genes was transcription-profiled using quantitative RT-PCR to validate the RNA-Seq output.
CONCLUSIONS: A substantial body of chrysanthemum transcriptomic sequence was generated, which led to a number of insights into the molecular basis of the host response to A. tenuissima infection. Although most of the differentially transcribed genes were up-regulated by the presence of the pathogen, those involved in photosynthesis were down-regulated.

Entities:  

Mesh:

Substances:

Year:  2014        PMID: 24387266      PMCID: PMC3890596          DOI: 10.1186/1471-2164-15-9

Source DB:  PubMed          Journal:  BMC Genomics        ISSN: 1471-2164            Impact factor:   3.969


Background

Chrysanthemum (Chrysanthemum morifolium Ramat.) is the second most commercially valuable ornamental species after rose [1,2]. A serious production constraint is represented by black spot disease (causative pathogen the necrotrophic fungus Alternaria tenuissima (Fr.) Wiltsh) [3]. The disease is most damaging during humid, warm conditions, which makes it a year-round problem for greenhouse-based production [3,4]. Severe infections damage the commercial value of the plant, as they cause leaf necrosis, and reduce the quantity and quality of the flowers [5]. Little is known regarding the chrysanthemum/black spot host-pathogen interaction. However, in the host-pathogen system involving the model species Arabidopsis thaliana and the related pathogen A. brassicicola, the pathogenesis-related protein PR4 is significantly up-regulated [6]. In the tomato/A. alternata system, the ethylene (ET), jasmonate (JA) and salicylic acid (SA) signalling pathways are all activated as part of the host response [7], while the response of mint to A. alternata infection features many proteins related to stress and defence [8]. Finally, Egusa et al. (2009) [9] have shown that the transcription of the genes PGIP (polygalacturonase inhibiting protein) and PPO (polyphenol oxidase) is induced in the leaf of the Japanese pear when challenged by A. alternata. Plant defence responses are first activated in the organs located at the site of infection but are then extended to the uninfected systemic (distal) organs, activating a systemic acquired resistance (SAR) which is effective against a broad spectrum of pathogens in the whole plant [10-12]. However, limited studies have examined the induction of SAR in chrysanthemum/black spot host-pathogen interaction, so far. In the present study, the systemic responses are expected by surveying gene expression profiles in the noninfected (systemic) leaves. RNA-Seq technology has been developed to enable the simultaneous sequencing of very large numbers of short reads, and in so doing has revolutionized the qualitative and quantitative analysis of the transcriptome [13-16]. When applied to cotton infected with a wilt pathogen, of the >32,000 genes identified by mapping the reads to a genomic sequence assembly, over 3,000 were found to be up- or down-regulated as part of the defence response [16]. Similarly, an analysis of the banana-Fusarium oxysporum interaction successfully demonstrated the up-regulation of genes involved in hormone synthesis, pathogenesis-related genes, transcription factors and signalling/regulatory genes [17]. Finally, the lettuce-Botrytis cinerea interaction has been shown to feature the induction of genes involved in the phenylpropanoid pathway and in terpenoid synthesis, as well as a global down-regulation of genes responsible for photosynthesis [18]. In present study, we aimed to 1) elucidate the localized responses to the infections on the inoculated site by comparing libraries generated from mock-inoculated and inoculated leaves; 2) to describe the systemic response by comparing libraries generated from neighbouring leaves from mock-inoculated and inoculated leaves. The present study reports the outcome of a RNA-Seq based analysis of the chrysanthemum-A. tenuissima interaction. The experiment has yielded information regarding the identity of the genes which are either up- or down-regulated as part of the defence response. The majority of the differentially transcribed (DT) genes were involved in either pathogen recognition, reactive oxygen species detoxification, cell wall modification or phytohormone signalling, but also a range of transcription factors, belonging to various families were identified. Validation of the RNA-Seq data was provided by subjecting a set of 23 of the DT genes to quantitative RT-PCR (qPCR).

Results

Analysis of RNA-Seq libraries

The major characteristics of the four libraries (Figure 1) are summarized in Table 1 and Additional file 1: Figure S1. The number of raw reads per library ranged from ~7.2 to ~7.6 million, and the total number of base pairs sequenced from 352,864,582 to 370,177,360 (Table 1) (Accession No. for library A SRS464569; Accession No. for library B SRS480632; Accession No. for library C SRS480633; Accession No. for library D SRS480635). After removal of reads including adaptor sequence, reads in which >10% of the bases were uncertain, a total of, respectively 7,524,234, 7,248,778, 7,201,318 and 7,554,640 clean reads were obtained, corresponding to 368,687,466, 355,190,122, 352,864,582 and 370,177,360 base pairs (Table 1). The proportion of clean reads was >99.30% in each library (Additional file 1: Figure S1).
Figure 1

The source of RNA libraries prepared from mock- and pathogen-inoculated chrysanthemum plants. A and B: mock inoculation, C and D: inoculation with an A. tenuissima spore suspension. A, C: The first and fourth true leaves without any treatment. B: the second and third mock-inoculated true leaves. D: the second and third pathogen-inoculated true leaves. Leaves were harvested at 0 h, 6 h, 24 h, 48 h and 72 h after inoculation.

Table 1

Summary of read mapping

Sample IDTotal readsTotal basepairsTotal mapped readsPerfect match<=2 bp mismatchUnique matchMulti-position matchTotal unmapped reads
A
7524234
368687466
5429990
3412870
2017120
3522413
1907577
2094244
(100.00%)
(100.00%)
(72.17%)
(45.36%)
(26.81%)
(46.81%)
(25.35%)
(27.83%)
B
7248778
355190122
5069400
3184769
1884631
3321526
1747874
2179378
(100.00%)
(100.00%)
(69.93%)
(43.94%)
(26.00%)
(45.82%)
(24.11%)
(30.07%)
C
7201318
352864582
5033405
3149786
1883619
3322965
1710440
2167913
(100.00%)
(100.00%)
(69.90%)
(43.74%)
(26.16%)
(46.14%)
(23.75%)
(30.10%)
D
7554640
370177360
5060651
3142621
1918030
3366700
1693951
2493989
 (100.00%)(100.00%)(66.99%)(41.60%)(25.39%)(44.56%)(22.42%)(33.01%)
The source of RNA libraries prepared from mock- and pathogen-inoculated chrysanthemum plants. A and B: mock inoculation, C and D: inoculation with an A. tenuissima spore suspension. A, C: The first and fourth true leaves without any treatment. B: the second and third mock-inoculated true leaves. D: the second and third pathogen-inoculated true leaves. Leaves were harvested at 0 h, 6 h, 24 h, 48 h and 72 h after inoculation. Summary of read mapping

Read mapping

A reference gene database [Raw sequence data were deposited in the NCBI Sequence Read Archive database (http://trace.ncbi.nlm.nih.gov/Traces/sra_sub/sub.cgi?) under accession number SRP029991] which included all known Chrysanthemum morifolium unigene sequences was used to map the RNA-Seq reads. Based on the chosen criteria, 69.75% of the clean reads recognized sequences in this database (Table 1). On a per library basis, the proportions of the clean reads uniquely mapped to the database were, respectively, 46.81%, 45.82%, 46.14% and 44.56%. In addition, the proportion of the clean reads from library D uniquely mapped to the publicly available A.tenuissima database was 0.02%. The number of genes identified increased with the number of reads, but above 6,000,000 reads no further genes were detected, implying full saturation of the transcriptome (Figure 2).
Figure 2

Sequencing saturation analysis of each library. Sequencing saturation in the four libraries of A, B, C and D. The number of different genes detected rose as the read number was increased.

Sequencing saturation analysis of each library. Sequencing saturation in the four libraries of A, B, C and D. The number of different genes detected rose as the read number was increased.

GO classification of DT genes

Of the 217 genes classified as DT genes in the contrast between library A (leaf 1 and 4 of plants mock-inoculated on leaf 2 and 3) and B (mock-treated leaf 2 and 3), 106 could be assigned a GO classification; the equivalent number for the A vs C (leaf 1 and 4 of plants inoculated by the pathogen on leaf 2 and 3) contrast was 418 out of 659, for the B vs D (pathogen-infected leaf 2 and 3) contrast 1,057 out of 1,705, and for the C vs D contrast 294 out of 494 (Additional file 2: Table S1, Additional file 3: Table S2, Additional file 4: Table S3 and Additional file 5: Table S4, Additional file 6: Table S5, Additional file 7: Table S6, Additional file 8: Table S7 and Additional file 9: Table S8). Furthermore, of the 659 genes classified as DT genes in the contrast between library A and C (A vs C), 469 (71.2%) behaved similarly between A vs C and B vs D; the equivalent number for the B vs D contrast was 469 out of 1705 (27.5%) (Additional file 7: Table S6 and Additional file 8: Table S7). For the A vs B contrast, seven genes were categorized as “cellular component”, six as “molecular function” and 14 as “biological process”; the respective distributions in A vs C, B vs D and C vs D were ten, ten and 20, nine, 11 and 20, and nine, nine and 18 (Figure 3). The frequency of DT genes was highest in the contrast B vs D. The commonest molecular functions of the DT genes in this contrast were binding and catalytic activity; in terms of cellular component, most were associated with cells, cell parts, macromolecular complexes, membranes, membrane parts, organelles and organelle parts; finally, in terms of biological process, the majority were associated with cellular processes, metabolic processes and the response to stimulus (Figure 3). Signalling responses to or mediated by JA, SA and ET were well represented, particularly those active in JA-mediated signalling. Some transcription factors and cell wall modification genes were also differentially transcribed, as were genes involved in secondary metabolism (phenylpropanoid pathway and terpenoid synthesis). Among the biological processes well represented among the down-regulated genes were those involved in photosynthesis. In the contrast between B and D, a small number of up-regulated genes belonged to the categories ‘cell killing’, ‘positive regulation of biological process’, ‘membrane-enclosed lumen’ and ‘receptor activity’. A higher number of genes identified in this contrast were associated with ‘response to stimulus’ and ‘signalling’ than in the contrasts A vs B, A vs C and C vs D (Figure 3).
Figure 3

Gene Ontology (GO) classifications of DT genes. DT genes were annotated in three categories: biological process, cellular component and molecular function. Y-axis (right) represents the number of DT genes in each category; Y-axis (left) represents the percentage of a specific category of DT genes within that main category. Panels A, B, C and D (left) represents DT genes in the contrast between library A (leaf 1 and 4 of plants mock-inoculated on leaf 2 and 3) and B (mock-treated leaf 2 and 3) (A-VS-B) (right) , library A and C (leaf 1 and 4 of plants inoculated by the pathogen on leaf 2 and 3) (A-VS-C) (right), library B and D (pathogen-infected leaf 2 and 3) (B-VS-D) (right), library C and D (C-VS-D) (right), respectively.

Gene Ontology (GO) classifications of DT genes. DT genes were annotated in three categories: biological process, cellular component and molecular function. Y-axis (right) represents the number of DT genes in each category; Y-axis (left) represents the percentage of a specific category of DT genes within that main category. Panels A, B, C and D (left) represents DT genes in the contrast between library A (leaf 1 and 4 of plants mock-inoculated on leaf 2 and 3) and B (mock-treated leaf 2 and 3) (A-VS-B) (right) , library A and C (leaf 1 and 4 of plants inoculated by the pathogen on leaf 2 and 3) (A-VS-C) (right), library B and D (pathogen-infected leaf 2 and 3) (B-VS-D) (right), library C and D (C-VS-D) (right), respectively.

Changes in transcription level

The distribution of unigene coverage in each sample was analysed as a way of evaluating the quality of the RNA-Seq dataset (Figure 4). The term “gene coverage” reflects the proportion of the full gene sequence represented by RNA-Seq reads. For most of the unigenes, gene coverage was >50%. The transcription level of each unigene (Additional file 10: Table S9) was derived from the number of relevant reads recovered following Mortazavi et al. (2008) [19]. DT genes (Additional file 6: Table S5, Additional file 7: Table S6, Additional file 8: Table S7, Additional file 9: Table S8) were identified using an algorithm developed by Audic et al. (1997) [20]. Between A and B, 20 genes were up- and 197 down-regulated, between A and C, the totals were 562 and 97, respectively, between B and D, 1,181 and 524, respectively and C and D, 245 and 249, respectively (Figure 5).
Figure 4

Distribution of gene coverage analysis of each library. Distribution of gene coverage in libraries A, B, C and D.

Figure 5

The number of DT unigenes identified in each library contrast.

Distribution of gene coverage analysis of each library. Distribution of gene coverage in libraries A, B, C and D. The number of DT unigenes identified in each library contrast.

Transcription factors, cell wall modification genes and genes involved in JA and SA signalling were all regulated by A. tenuissima inoculation

The transcription data indicated that infection by A. tenuissima regulated a number of transcription factors and genes associated with pathogenesis and JA and SA signalling. Three members of the GRAS-type transcription factor family were more abundantly transcribed in the inoculated than in the mock-inoculated leaves. When qPCR was performed on a selection of the 23 of the DT genes to validate the conclusions drawn from the RNA-Seq analysis, all the genes behaved as predicted. Most of the genes examined (the exception was the MYB transcription factor CL9570) were induced after A. tenuissima inoculation (Table 2). The qPCR analysis suggested that genes involved in cell wall modification, JA and SA signalling and transcription factors comprised a network of interactions, providing the host with a capacity to fine-tune its disease response.
Table 2

Genes differentially transcribed in ‘Zaoyihong’ leaves in response to mock-inoculation (B) and inoculation (D)

GeneID
Function
Annotation
B-
D-
B-Relative
D-Relative
   RPKMRPKMlevel of gene expressionlevel of gene expression
 
Transcription factors
 
 
 
 
 
Unigene6575_All
 
MYB family transcription factor
16.44
78.47
38.91 ± 4.27
128.30 ± 8.75
Unigene16113_All
 
MYB family transcription factor
4.16
15.43
2.12 ± 0.25
5.53 ± 0.11
CL9570
 
MYB family transcription factor
40.79
16.56
20.65 ± 0.61
9.22 ± 0.34
Unigene29332_All
 
Ethylene-responsive transcription factor
19.13
95.07
52.19 ± 2.11
134.46 ± 9.55
Unigene17395_All
 
Ethylene-responsive transcription factor
8.06
29.67
1.93 ± 0.16
8.52 ± 0.21
Unigene271_All
 
Ethylene-responsive transcription factor
29.14
105.39
18.36 ± 1.63
59.55 ± 2.61
Unigene7360_All
 
WRKY family transcription factor
140.72
1061.25
91.14 ± 4.36
766.75 ± 123.16
Unigene12209_All
 
WRKY family transcription factor
45.59
291.26
35.82 ± 2.34
253.35 ± 8.63
Unigene37863_All
 
WRKY family transcription factor
100.02
506.41
56.99 ± 3.64
305.58 ± 11.64
Unigene37669_All
 
WRKY family transcription factor
251.80
974.58
159.19 ± 15.47
722.79 ± 37.85
Unigene23051_All
 
NAC transcription factor
18.01
101.86
14.91 ± 1.26
78.02 ± 3.25
Unigene4479_All
 
NAC transcription factor
14.71
43.49
14.59 ± 1.37
39.91 ± 1.47
CL14412
 
NAC transcription factor
33.29
99.47
1.81 ± 0.11
22.31 ± 2.11
Unigene41060_All
 
GRAS family transcription factor
17.43
94.16
49.72 ± 5.56
166.22 ± 8.29
Unigene20543_All
 
GRAS family transcription factor
72.90
271.62
52.64 ± 4.53
169.66 ± 7.79
Unigene11471_All
 
GRAS family transcription factor
15.68
38.84
63.39 ± 4.99
285.75 ± 22.55
 
JA signaling pathway
 
 
 
 
 
Unigene11800_All
 
JAZ gene
20.57
97.20
56.24 ± 2.76
254.24 ± 17.19
Unigene3689_All
 
MYC2 transcription factor
71.44
27.57
34.38 ± 2.78
14.16 ± 0.74
CL10952
 
Vegetative storage protein
65.82
133.03
114.24 ± 4.80
224.06 ± 16.05
 
SA signaling pathway
 
 
 
 
 
Unigene23699_All
 
NPR1 gene
20.05
45.55
147.74 ± 18.02
187.23 ± 7.05
Unigene52251_All
 
TGA transcription factor
7.64
49.89
3.88 ± 0.44
21.00 ± 0.79
 
Cell wall modification
 
 
 
 
 
CL11209
 
Polygalacturonase-inhibiting protein
1.03
30.96
1.01 ± 0.07
15.04 ± 1.08
Unigene9160_All Polyphenol oxidase87.35485.9999.99 ± 26.96499.20 ± 24.85

All these genes were significantly up- or down-regulated (P value < 0.05). The RPKM data were obtained from the RNA-Seq analysis and the relative level of transcript abundance from the qPCR analysis.

Genes differentially transcribed in ‘Zaoyihong’ leaves in response to mock-inoculation (B) and inoculation (D) All these genes were significantly up- or down-regulated (P value < 0.05). The RPKM data were obtained from the RNA-Seq analysis and the relative level of transcript abundance from the qPCR analysis.

Discussion

Global patterns of transcription in response to infection by A. tenuissima

The chrysanthemum genome is polyploid and large, so has not as yet benefited from comprehensive and integrated genomic and transcriptomic sequence analysis. The molecular basis of its defence response against pathogen infection is currently poorly understood, but the advent of high-throughput sequencing technology now allows an unprecedented opportunity to explore it. About 70% of the reads in each of the four RNA-Seq libraries were mappable back to known transcripts (Table 1), a proportion which is somewhat lower than achieved in the lettuce/B. cinerea system [18], probably reflecting the more comprehensive status of the lettuce transcriptome. The 30% of reads which were not mappable are presumably associated with as yet unidentified transcripts [16]. The validation through qPCR of the transcripts identified as regulated by A. tenuissima infection showed that the RNA-Seq method is well suited for the analysis of transcription induced as part of the defence response in chrysanthemum (Table 2). In all, 659 DT genes were identified in the A vs C contrast and 1,705 in B vs D (Figure 5, Tables S7, S8). A comparison with the outcomes of the lettuce/B. cinerea and A. thaliana/B. cinerea interactions [18,21,22] showed that only two genes were up-regulated in all three systems, namely Lsa004290.1, At1g74360 and Unigene7965_All (encoding an LRR protein kinase) and Lsa016859.1, At4g17500 and Unigene17395_All (ERF1). During the early phase of both the lettuce/B. cinerea and the A. thaliana/B. cinerea interactions, genes in the ET pathway are heavily involved in the defence response, a finding which was replicated in the chrysanthemum/A. tenuissima interaction. The RNA-Seq data further show that a large number of genes are involved in the host response between six and 72 h post inoculation, including several genes involved in the JA and SA pathways. Some of these are discussed in more detail below.

Pathogen recognition-related genes modulated by A. tenuissima infection

Plant pattern recognition receptors (PRRs) perceive microbe-associated molecular patterns (MAMPs), a set of molecular signatures encompassing whole classes of microbes. This recognition initiates a basal level of immunity (termed MAMP-triggered immunity) [23]. Receptor-like kinases (RLKs), which form the largest plant receptor family, are PRRs localized at the plasma membrane [24]. The involvement of RLKs in certain host-pathogen interactions has been well documented experimentally [18]. The RNA-Seq-based transcriptomic analysis of the lettuce/B. cinerea interaction has revealed that several types of RLK are differentially transcribed [18], and the same phenomenon was recorded in the chrysanthemum/A. tenuissima interaction. The damage caused by microbes can induce the host to synthesize MAMP-like products, termed damage-associated molecular patterns (DAMPs) [23]. Oligogalacturonides (OGs) released from the plant cell wall activate the DAMP-associated response. The induction of an OG receptor wall-associated kinase (WAK) has been suggested as being necessary for the survival A. thaliana challenged by pathogen infection [25]. Five WAK-like kinases (encoded by Unigene52017_All, Unigene36001_All, Unigene55763_All, Unigene49198_All and Unigene12436_All) were among the DT genes detected in the B vs D contrast (Additional file 11: Table S10), and a sixth (Unigene49198_All) was identified in the A vs C contrast (Additional file 12: Table S11). Another study showed that WAKs were involved in the immune responses against B. cinerea. Furthermore, transgenic plants overexpressing WAK1 conferred resistance to B. cinerea in A. thaliana[26]. Genes encoding a second class of PRR, the leucine-rich repeat RLKs (LRR-RLKs), are known to be involved in both basal and cultivar-specific host immunity [27]. In A. thaliana, BRI1 encodes an LRR-RLK which forms a heterodimeric complex with a second LRR-RLK called BAK1 acting as a negative regulator of microbial infection-induced cell death [27]. Bak1 mutants develop spreading necrosis after the triggering of apoptosis by infection with B. cinerea[27]. The transcription of two LRR-RLK (Unigene20925_All and Unigene27322_All), four BRI-like (Unigene55939_All, Unigene15368_All, Unigene29292_All, Unigene18133_All), six BAK1 genes (Unigene37501_All, Unigene36228_All, Unigene16709_All, Unigene16958_All, Unigene14705_All, and Unigene27008_All), and two somatic embryogenesis receptor kinase (SERK) genes (Unigene22508_All, Unigene14416_All) was modulated by A. tenuissima infection in the B vs D contrast (Additional file 13: Table S12), as were an additional two BRI-like (Unigene15368_All and Unigene4877_All), a somatic embryogenesis receptor kinase (SERK) genes (Unigene22508_All), and four BAK1 genes (Unigene36228_All, Unigene4877_All, Unigene14705_All and Unigene27008_All) in the A vs C contrast (Additional file 12: Table S11). All the above genes were up-regulated except for Unigene18133_All. In the lettuce/B. cinerea interaction, one BRI-like (Lsa034184.1) gene was up-regulated, but no BAK1 genes [18]. The products of genes encoding cysteine-rich receptor-like kinases (CRKs) are RLKs which contain an extracellular cysteine-rich repeat domain. These genes are reportedly activated by oxidative stress, pathogen attack and exposure to SA [18,28-30]. Although less widely researched, they have been characterized to be involved in the pathogen defense and programmed cell death in A. thaliana[28,30]. Here, three CRKs were identified as DT genes (Unigene55939_All, Unigene15489_All and Unigene14705_All) in the B vs D comparison (Additional file 14: Table S13) and a further three (Unigene4299_All, Unigene14705_All and Unigene15489_All) in the A vs C comparison (Additional file 15: Table S14). Thus, PRR-RLKs are clearly involved in the chrysanthemum host response to A. tenuissima infection. The early activation of these genes may reflect their transcription as an attempt by the host to recognize MAMPs/DAMPs.

ROS (reactive oxygen species) detoxification genes modulated by A. tenuissima infection

MAMPs are known to trigger the production of ROS in response to pathogen infection, largely derived from NADPH oxidase activity (commonly referred to as “respiratory burst oxidase homologues” (rboh)) [17,31]. Two chrysanthemum rboh homologues were recognized: Unigene300_All (homologue of rbohD) and Unigene45792_All (rbohF); both were differentially transcribed in the B vs D (Additional file 16: Table S15) and A vs C contrasts (Additional file 17: Table S16). The lettuce rbohD homologue (Lsa002796.1) was induced 48 h after infection with B. cinerea, but its rbohF homologue (Lsa018309.1) was not up-regulated [18]. In A. thaliana, both rbohD and rbohF are required for ROS detoxification [32]. Two further pathogen-inducible α-dioxygenases (Unigene32071_All and Unigene12359_All) (Additional file 16: Table S15) were differentially transcribed in the B vs D contrast, and one (Unigene32071_All) in A vs C (Additional file 17: Table S16); this class of gene was also up-regulated in the lettuce/B. cinerea system; its product is involved in protecting the cell against oxidative stress [18].

Genes associated with photosynthesis were mostly down-regulated by A. tenuissima infection

DT genes involved in photosynthesis were uniformly down-regulated in the B vs D contrast, with the sole exception of Unigene2020_All (Additional file 18: Table S17). In the contrast C vs D, four photosynthesis-related DT genes were detected, and all were down-regulated (Additional file 19: Table S18). The response mirrors the outcomes in the lettuce/B. cinerea and lettuce/Verticillium dahliae systems [18,33], as well as in other documented plant-pathogen interactions [34-39]. Unigene6198_All, predicted to be involved in the determination of the plant’s circadian clock, was down-regulated in both the B vs D (Additional file 18: Table S17) and C vs D contrasts (Additional file 19: Table S18). Similar examples of the suppression of such genes by pathogen infection have been described in both lettuce [18] and A. thaliana[40]. In the case of A. thaliana, B. cinerea infection appears to dampen the oscillating transcription of certain core clock components, leading to the suggestion that the pathogen attempts to dampen the host’s defence response, because a set of genes associated with plant immune responses was revealed to be regulated by the plant’s circadian clock [41].

Genes associated with cell wall protection affected by A. tenuissima infection

Both PGIP and PPO were up-regulated in response to A. tenuissima infection (Table 2). PGIP and PPO are known to respond to various cues [42-48], including the presence of A. solani[42], A. triticina[49], A. macrospora[50], Sclerospora graminicola[51] and Colletotrichum lindemuthianum[52]. PGIP transcript abundance increased over the period 6–24 h after inoculation with A. tenuissima (Table 2). Many fungi secrete endo-polygalacturonase, an enzyme which degrades the polysaccharides present in the plant cell wall. Host genes involved in the early defence response include those which help to reinforce the cell wall, and thereby inhibit pathogen entry. PGIP’s role in mediating resistance to A. alternata infection has been shown in both rough lemon and Japanese pear [9,53], while the growth of B. cinerea is restricted in transgenic tomato heterologously expressing pear PGIP[54]. PPO transcription in chrysanthemum was enhanced after inoculation (Table 2), similar to what has been observed in the leaf of Japanese pear inoculated with A. alternata[9]. In tomato, the constitutive expression of PPO increases host resistance to Pseudomonas syringae, while its down-regulation enhances susceptibility [55,56].

JA and SA signalling pathway-related genes involved in the response to A. tenuissima infection

CmJAZ (Unigene11800_All), CmMYC2 (Unigene3689_All), CmVSP (CL10952), CmNPR1 (Unigene23699_All) and CmTGA (Unigene52251_All) were all induced by A. tenuissima infection (Table 2). NPR1 is a major component of SA signalling, functioning as a co-activator of the TGA transcription factors known to regulate the transcription of various SA-responsive genes [57]. JAZ (jasmonate ZIM domain) proteins repress JA signalling by binding to transcriptional regulators such as MYC2. The degradation of JAZ proteins relieves the JAZ-mediated repression of the JA signalling pathway and thereby activates a large number of JA responsive genes [57,58]. JA and SA both play an important part in host defence against herbivorous insects and microbial pathogens. In A. thaliana, VSP2 and PR-1 are, respectively, JA- and SA-responsive proteins [58]. Overall, a number of genes within the JA and SA signalling pathways are involved in the defence response of chrysanthemum against A. tenuissima infection.

Transcription factors responding to A. tenuissima infection

Transcription factors are central to the control of the timing and placement of defence response gene expression [59]. Their mode of action is to first recognize and then bind to regulatory elements located in the promoter region of their target genes, thereby activating or de-activating their transcription. Here, five classes of transcription factor (MYB, AP2/ERF, WRKY, NAC and GRAS) were identified among the DT genes responding to A. tenuissima infection. In A. thaliana, AtMYB30, AtMYB44 and AtMYB96 are all involved in the triggering of apoptosis and therefore resistance against biotrophic bacterial pathogens such as Pseudomonas syringae[60-64]. AtMYB108 is required for resistance against B. cinerea and A. brassicicola[65]. The transcription of AtMYB58 has been associated with secondary cell wall formation [66]. Here, one CmMYB copy (Unigene6575_All and a homologue of AtMYB58), was prominently transcribed from 48 h after inoculation with A. tenuissima (Table 2). Therefore, it was speculated that CmMYB (Unigene6575_All) may be involved in defence response to the necrotrophic fungus A. tenuissima through the regulation of secondary cell wall biosynthesis. Modifications to the plant cell wall were already recognized as the potential mechanism of resistance, which was previously provided by the reports on the response of plants to fungal challenges [67]. A second CmMYB (Unigene16113_All, homologous to AtMYB74) was also up-regulated by A. tenuissima infection (Table 2). In A. thaliana, AtMYB74 reportedly responds to salinity stress and the exogenous supply of abscisic acid, ETH and JA [68], but not as yet to pathogen infection. Therefore, it was speculated that this gene may be involved in defense response to the necrotrophic fungus A. tenuissima and may be also associated with ABA and JA signaling in Chrysanthemum. Other transcription factors in the AP2/ERF, WRKY, NAC and GRAS families were abundantly transcribed in the leaf following A. tenuissima inoculation. Many reports have also indicated that four families of transcription factors: MYB proteins, ethylene-responsive-element-binding factors (ERF), WRKY proteins and NAC proteins link to plant stress responses, such as pathogens [59,60,69-72]. Little evidence has been provided to date regarding the participation of GRAS transcription factors in the defence response. In conclusion, it was clear that infection with A. tenuissima induced a wide range of genes in the chrysanthemum leaf. The response involved a complex set of interactions between pathogenesis-related genes, genes in the JA and SA signalling pathway and transcription factors. A more detailed understanding of the identity of these genes will help to unravel the molecular basis of the defence response of chrysanthemum to A. tenuissima infection, and eventually lead to the recognition of candidates for the targeted genetic improvement of chrysanthemum.

Conclusions

In this study, we characterized the leaf transcriptome of chrysanthemum and provided the comparative DT genes involeved in the interaction between chrysanthemum and A. tenuissima. These findings provide a substantial contribution to existing sequence resources of chrysanthemum, and a strong basis for further characterization of gene expression profiles in the interaction of chrysanthemum and A. tenuissima. The majority of the DT genes were those involved in pathogen recognition, reactive oxygen species detoxification, cell wall modification, phytohormone signalling, and transcription factors belonging to various families were also identified, which will improve our understanding of the molecular mechanisms underlining direct response and induced systemic resistance of chrysanthemum to A. tenuissim.

Methods

Plant materials, A. tenuissima inoculum preparation and inoculation

The chrysanthemum variety ‘Zaoyihong’ was obtained from the Chrysanthemum Germplasm Resource Preserving Centre, Nanjing Agricultural University, China. Uniform cuttings were propagated in sand, and rooted seedlings transplanted into a 2:1 mixture of garden soil and vermiculite without fertilizer supplementation. The plants were grown under a 16 h photoperiod with a day/night temperature of, respectively, 25°C and 18°C. The relative humidity was maintained at 68-75% [3]. A. tenuissima conidia were isolated from diseased chrysanthemum plants, and cultured on potato dextrose agar at 25°C. An aqueous suspension of 106 spores per ml was prepared with a few drops of Triton X-100 added as a wetting agent [3]. The surface of the second and third true leaves of 20 day old root cuttings was punctured with a needle (approximately 0.30 mm diameter), and a 10 μl droplet of spore suspension was placed on the puncture site. Mock treatments comprised 10 μl droplets of sterile distilled water. After inoculation, the plants were held at 100% relative humidity and 25°C in the dark for 24 h, and then illuminated with 120 μmol m-2 s-1 cool white fluorescent light with a 12 h photoperiod. The leaves of three seedlings were sampled for each treatment at 0 h, 6 h, 24 h, 48 h and 72 h after inoculation. The samples collected at defined time points of each treatment were pooled for RNA-seq.

RNA extraction

Four separate libraries (A-D, see Figure 1) were prepared. Extracts of the second and the third true leaves of mock-treated and pathogen-infected plants gave rise to, respectively, libraries B and D, while extracts of the first and the fourth noninfected (systemic) true leaves of plants gave rise to libraries A and C. Total RNA was isolated using a Total RNA Isolation System (Takara, Japan), following the manufacturer’s recommendations. The quality of the total RNA (RNA Integrity Number > 6.5 and 28S:18S > 1.0) was verified using a 2100 Bioanalyzer RNA Nano chip device (Agilent, Santa Clara, CA, USA) and its concentration ascertained using an ND-1000 spectrophotometer (NanoDrop, Wilmington, DE). The standards applied were 1.8 ≤ OD260/280 ≤ 2.2 and OD260/230 ≥ 1.8. At least 10 μg RNA was pooled in an equimolar fashion from each of the three sampled plants [73].

cDNA library construction and Illumina sequencing

Each total RNA extract was first treated with RNase-free DNase I (TaKaRa, Dalian, China) to remove contaminating DNA, and the mRNA content was concentrated by capturing on magnetic oligo (dT) beads. The mRNA was fragmented to a size of ~200 bp using a fragmentation buffer, and the resulting fragments used to synthesize the first cDNA strand by priming with random hexamers. The second strand was generated using a SuperScript Double-Stranded cDNA Synthesis kit (Invitrogen, Camarillo, CA), purified via magnetic beads, the ends repaired and a single adenine base added to the 3′ ends. Sequencing adaptors were then ligated to the fragments, and agarose gel electrophoresis used to select the range of fragments suitable for PCR amplification. Sequencing using an Illumina HiSeq™ 2000 platform was performed at the Beijing Genomics Institute (Shenzhen, China; http://www.genomics.cn/index.php), following the manufacturer’s protocols.

Treatment of sequence data

Raw reads were saved as .fastq files, and filtered to remove adaptor sequences, reads in which the proportion of non-called bases was > 10% and reads in which low quality (≤ 5) bases represented > 50% of the read. The remaining reads were mapped onto the set of chrysanthemum unigene sequences using SOAPaligner/SOAP2 [74]. A maximum of two mismatches was permitted for the purpose of alignment. The frequency of occurrence of individual reads was normalized to RPKM (reads per kb per million reads) [19]. Differential transcription between pathogen-inoculated and mock samples was based on the log2 ratio of the two RPKM values. All raw RNA-Seq data have been deposited at the sequence read archive (SRA) of NCBI (Additional file 20: Table S19).

Identification of DT genes

Following Audic and Claverie (1997) [20], a stringent algorithm was developed to identify DT genes. The FDR (false discovery rate) provides a criterion to determine the P-value threshold in multiple tests and analyses by manipulating the FDR value. Here, differential transcription was declared provided that the P-value was < 0.05, the FDR ≤ 0.001 and the absolute value of log2 induction ratios of treated samples compared with mock-treatment or control (CK) was ≥ 1.0. Standard gene ontology (GO) was used to describe DT gene functionality, and a hypergeometric test was used to map the DT genes to GO terms based on the BGI WEGO (Web Gene Ontology Annotation Plot, http://wego.genomics.org.cn/cgi-bin/wego/index.pl).

Quantitative real-time PCR (qPCR) validation

The transcription of 23 selected candidate genes was determined using quantitative real time PCR (qPCR). The samples collected at different time points were pooled, which were used for qPCR analysis, contaminating DNA removed by RNase-free DNase I treatment and the first cDNA strand synthesized using a Super RT kit (BioTeke, Beijing, China). A set of gene-specific primer pairs (sequences given in Table 3) was designed using Primer3 software [18,75]. qPCRs were based on SYBR_Green I (TOYOBO’, Japan) implemented in a Rotor-Gene 3000 device (Corbett, Australia). The chrysanthemum EF1α gene was used as a reference. Each 25 μl qPCR reaction contained 10 μl SYBR Green PCR master mix, 0.2 μM of each primer and 10 ng cDNA, and the amplification regime consisted of an initial denaturation of 95°C/60 s, followed by 40 cycles of 95°C/15 s, 55°C/15 s, 72°C/20 s. Transcript abundances are given as the mean ± SE of three replicates. Relative transcription levels were calculated using the 2-△△CT method [76].
Table 3

Primers of quantitative reverse transcription-polymerase chain reaction for validation of the digital gene expression data

Gene IDPrimer F (5′-3′)Primer R (5′-3′)Basic annotation
Unigene6575_All
CGGAATCAAGAAAGGTGCAT
ATTCATCCATCGTAGCCTGC
MYB family transcription factor
Unigene16113_All
CGTTGTGACGAGAGGAGTGA
CTTCTTCGGATGGGAATTGA
MYB family transcription factor
CL9570
AAAATGCTGGATTGCTGAGG
AAGACCATTTGTTGCCAAGG
MYB family transcription factor
Unigene29332_All
CAATTTCATTACCGAGGCGT
TGCCTAGCCATCTTCGAGTT
Ethylene-responsive transcription factor
Unigene17395_All
ACGAGATCCCAACAAAGGTG
TTGGACCCTTTGAAACGAAG
Ethylene-responsive transcription factor
Unigene271_All
CTCTAACTCCGTGCCTCGTC
TTAGAGGGGTTAGGAGGCGT
Ethylene-responsive transcription factor
Unigene7360_All
CACCTCGTGGTAGTGGGAGT
TGACTGCCATTATCGGTCAA
WRKY family transcription factor
Unigene12209_All
GTGGCTGAGATTGGTGGTTT
GCCTTTACAAGCGTTTCAGC
WRKY family transcription factor
Unigene37863_All
GGATCATCTCAGGGGGATTT
GACAACAGCATCACCACCAC
WRKY family transcription factor
Unigene37669_All
TAGATGCACATACCGCAAGG
TTTTCAGGCAAAGGTGGTTC
WRKY family transcription factor
Unigene23051_All
ACCTACAAACATCGGCTTCG
CTTCGAAAATGGTGCCCTAA
NAC transcription factor
Unigene4479_All
CAGCCAAAAATACCCTGCAT
ACGGACGAAAAACTGATTGG
NAC transcription factor
CL14412
AGTGTCCCTTCACCACCTTCG
CCGTTTCTCGTGACCCTGTT
NAC transcription factor
Unigene41060_All
GTAATCTGGAGCATGGGTGG
CTTAATGGTGTGCCCGTTTC
GRAS family transcription factor
Unigene20543_All
CTTGTTGCGAAACTGAGCTG
GACCCCTGCTGAAAAGATGA
GRAS family transcription factor
Unigene11471_All
TCGAGGGGAAGGAAACACTA
GGTTCTTCACAAGCCGACAT
GRAS family transcription factor
Unigene11800_All
AAATGTTTCGGTTTTCGACG
GATCTTTGTTAGGTGCCGGA
JAZ gene
Unigene3689_All
CATTGATGTAACAAACGGCG
AACCAACGCTTCTACACGCT
MYC2 transcription factor
CL10952
CCATTGACCCAAGCAACTTT
TTGAATACGGCTCCTCCATC
Vegetative storage protein
Unigene23699_All
CAAAGCATTGGATTGTGACG
TCTAAGATTGACATCCGCCC
NPR1 gene
Unigene52251_All
CCGGCTTTGATTGAACTGAT
CGTGGTTTCGTGGGTAGAGT
TGA transcription factor
CL11209
GCCGTATAATCGCTCTCACC
CCGGTGAGGTTTGTCAGTTT
Polygalacturonase-inhibiting protein
Unigene9160_AllTGAACACAACCAAGATGGGACCTCCACCTTGTCCACTGTTPolyphenol oxidase
Primers of quantitative reverse transcription-polymerase chain reaction for validation of the digital gene expression data

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

LHY and SAP contributed to RACE PCR, real-time PCR, bioinformatics analysis and writing of the manuscript. CFD, JJF and CSM conceived of the study, and participated in its design and contributed to revisions of the manuscript. FWM and GZY participated in experiment materials preparation. WHB helped with the RNA extraction. All authors read and approved the final manuscript.

Additional file 1: Figure S1

Composition of the raw reads in the four RNA libraries. “Clean” reads are those remaining after removal of adaptor sequences, reads in which the proportion of non-called bases was >10% and reads in which low quality (≤ 5) bases represented >50% of the reads. The numbers in parentheses indicate the percentage of each type of read present. Click here for file

Additional file 2: Table S1

GO classification of the genes differentially transcribed in the contrast between libraries A and B. Click here for file

Additional file 3: Table S2

GO classification of the genes differentially transcribed in the contrast between libraries A and C. Click here for file

Additional file 4: Table S3

GO classification of the genes differentially transcribed in the contrast between libraries B and D. Click here for file

Additional file 5: Table S4

GO classification of the genes differentially transcribed in the contrast between libraries C and D. Click here for file

Additional file 6: Table S5

Genes differentially transcribed in the contrast between libraries A and B. The criteria applied for assigning significance were: P-value < 0.05, FDR ≤ 0.001, and estimated absolute |log2Ratio(B/A)| ≥ 1. Genes listed in descending order of absolute |log2Ratio(B/A)|. GeneIDs retrieved from the Chrysanthemum Reference Sequence Database. Annotation of unigene sequences performed using BlastX (E <10). The “GeneLength” column gives the length of exon sequence. A- and B expression: frequency of unigene transcripts in libraries A and B, respectively. A- and B-RPKM: reads per kb per million reads for each unigene in libraries A and B, respectively. Log2 Ratio(B/A): the ratio between the RPKM in B and the RPKM in A. Up-Down-Regulation(B/A), P-value and FDR of each gene are also shown. KEGG: annotation according to the KEGG database by BLAST. Blast nr: identification of homologues in GenBank. GO Component, GO Function and Go Process: ontology information of Cellular Components, Molecular Function and Biological Processes of Gene-corresponding GO terms. “-”: no hit. Click here for file

Additional file 7: Table S6

Genes differentially transcribed in the contrast between libraries A and C. The criteria applied for assigning significance were: P-value < 0.05, FDR ≤ 0.001, and estimated absolute |log2Ratio(C/A)| ≥ 1. Genes listed in descending order of absolute |log2Ratio(C/A)|. GeneIDs retrieved from the Chrysanthemum Reference Sequence Database. Annotation of unigene sequences performed using BlastX (E <10). The “GeneLength” column gives the length of exon sequence. A- and C expression: frequency of unigene transcripts in libraries A and C, respectively. A- and C–RPKM: reads per kb per million reads for each unigene in libraries A and C, respectively. Log2 Ratio(C/A): the ratio between the RPKM in C and the RPKM in A. Up-Down-Regulation(C/A), P-value and FDR of each gene are also shown. KEGG: annotation according to the KEGG database by BLAST. Blast nr: identification of homologues in GenBank. GO Component, GO Function and Go Process: ontology information of Cellular Components, Molecular Function and Biological Processes of Gene-corresponding GO terms. “-”: no hit. Click here for file

Additional file 8: Table S7

Genes differentially transcribed in the contrast between libraries B and D. The criteria applied for assigning significance were: P-value < 0.05, FDR ≤ 0.001, and estimated absolute |log2Ratio(D/B)| ≥ 1. Genes listed in descending order of absolute |log2Ratio(D/B)|. GeneIDs retrieved from the Chrysanthemum Reference Sequence Database. Annotation of unigene sequences performed using BlastX (E <10). The “GeneLength” column gives the length of exon sequence. B- and D expression: frequency of unigene transcripts in libraries B and D, respectively. B- and D-RPKM: reads per kb per million reads for each unigene in libraries B and D, respectively. Log2 Ratio(D/B): the ratio between the RPKM in D and the RPKM in B. Up-Down-Regulation(D/B), P-value and FDR of each gene are also shown. KEGG: annotation according to the KEGG database by BLAST. Blast nr: identification of homologues in GenBank. GO Component, GO Function and Go Process: ontology information of Cellular Components, Molecular Function and Biological Processes of Gene-corresponding GO terms. “-”: no hit. Click here for file

Additional file 9: Table S8

Genes differentially transcribed in the contrast between libraries C and D. The criteria applied for assigning significance were: P-value < 0.05, FDR ≤ 0.001, and estimated absolute |log2Ratio(D/C)| ≥ 1. Genes listed in descending order of absolute |log2Ratio(D/C)|. GeneIDs retrieved from the Chrysanthemum Reference Sequence Database. Annotation of unigene sequences performed using BlastX (E <10). The “GeneLength” column gives the length of exon sequence. C– and D expression: frequency of unigene transcripts in libraries C and D, respectively. C- and D-RPKM: reads per kb per million reads for each unigene in libraries C and D, respectively. Log2 Ratio(D/C): the ratio between the RPKM in D and the RPKM in C. Up-Down-Regulation(D/C), P-value and FDR of each gene are also shown. KEGG: annotation according to the KEGG database by BLAST. Blast nr: identification of homologues in GenBank. GO Component, GO Function and Go Process: ontology information of Cellular Components, Molecular Function and Biological Processes of Gene-corresponding GO terms. “-”: no hit. Click here for file

Additional file 10: Table S9

The transcription level of each unigene derived from the number of relevant reads recovered in the four libraries. The “GeneLength” column gives the length of exon sequence. Click here for file

Additional file 11: Table S10

The differential transcription of Wall-associated receptor kinase-like (WAK-like) genes in the contrast B vs D. The criteria applied for assigning significance were: P-value < 0.05, FDR ≤ 0.001, and estimated absolute |log2Ratio(D/B)| ≥ 1. RPKM: reads per kb per million reads. Click here for file

Additional file 12: Table S11

The differential transcription of Wall-associated receptor kinase-like (WAK-like), brassinosteroid insensitive 1 (BRI-like), somatic embryogenesis receptor kinase (SERK), and BRI1-associated receptor kinase 1 (BAK1) genes in the contrast A vs C. The criteria applied for assigning significance were: P-value < 0.05, FDR ≤ 0.001, and estimated absolute |log2Ratio(C/A)| ≥ 1. RPKM: reads per kb per million reads. Click here for file

Additional file 13: Table S12

The differential transcription of leucine-rich repeat receptor-like kinase (LRR-RLK), brassinosteroid insensitive 1 (BRI-like), BRI1-associated receptor kinase 1 (BAK1), and somatic embryogenesis receptor kinase (SERK) genes in the contrast B vs D. The criteria applied for assigning significance were: P-value < 0.05, FDR ≤ 0.001, and estimated absolute |log2Ratio(D/B)| ≥ 1. RPKM: reads per kb per million reads. Click here for file

Additional file 14: Table S13

The differential transcription of cysteine-rich receptor-like protein kinase (CRKs) genes in the contrast B vs D. The criteria applied for assigning significance were: P-value < 0.05, FDR ≤ 0.001, and estimated absolute |log2Ratio(D/B)| ≥ 1. RPKM: reads per kb per million reads. Click here for file

Additional file 15: Table S14

The differential transcription of cysteine-rich receptor-like protein kinase (CRKs) genes in the contrast A vs C. The criteria applied for assigning significance were: P-value < 0.05, FDR ≤ 0.001, and estimated absolute |log2Ratio(C/A)| ≥ 1. RPKM: reads per kb per million reads. Click here for file

Additional file 16: Table S15

The differential transcription of respiratory burst oxidase, and alpha-dioxygenase genes in the contrast B vs D. The criteria applied for assigning significance were: P-value < 0.05, FDR ≤ 0.001, and estimated absolute |log2Ratio(D/B)| ≥ 1. RPKM: reads per kb per million reads. Click here for file

Additional file 17: Table S16

The differential transcription of respiratory burst oxidase, and alpha-dioxygenase genes in the contrast A vs C. The criteria applied for assigning significance were: P-value < 0.05, FDR ≤ 0.001, and estimated absolute |log2Ratio(C/A)| ≥ 1. RPKM: reads per kb per million reads. Click here for file

Additional file 18: Table S17

The differential transcription of photosynthesis and circadian rhythm-related genes in the contrast B vs D. The criteria applied for assigning significance were: P-value < 0.05, FDR ≤ 0.001, and estimated absolute |log2Ratio(D/B)| ≥ 1. RPKM: reads per kb per million reads. Click here for file

Additional file 19: Table S18

The differential transcription of photosynthesis and circadian rhythm-related genes in the contrast C vs D. The criteria applied for assigning significance were: P-value < 0.05, FDR ≤ 0.001, and estimated absolute |log2Ratio(D/C)| ≥ 1. RPKM: reads per kb per million reads. Click here for file

Additional file 20: Table S19

High-throughput sequencing metadata. Click here for file
  58 in total

1.  Reactive oxygen species signaling in response to pathogens.

Authors:  Miguel Angel Torres; Jonathan D G Jones; Jeffery L Dangl
Journal:  Plant Physiol       Date:  2006-06       Impact factor: 8.340

Review 2.  Early signaling events induced by elicitors of plant defenses.

Authors:  Angela Garcia-Brugger; Olivier Lamotte; Elodie Vandelle; Stéphane Bourque; David Lecourieux; Benoit Poinssot; David Wendehenne; Alain Pugin
Journal:  Mol Plant Microbe Interact       Date:  2006-07       Impact factor: 4.171

3.  SOAP2: an improved ultrafast tool for short read alignment.

Authors:  Ruiqiang Li; Chang Yu; Yingrui Li; Tak-Wah Lam; Siu-Ming Yiu; Karsten Kristiansen; Jun Wang
Journal:  Bioinformatics       Date:  2009-06-03       Impact factor: 6.937

4.  Promoter analyses and transcriptional profiling of eggplant polyphenol oxidase 1 gene (SmePPO1) reveal differential response to exogenous methyl jasmonate and salicylic acid.

Authors:  Santoshkumar M Shetty; Arun Chandrashekar; Yeldur P Venkatesh
Journal:  J Plant Physiol       Date:  2012-02-27       Impact factor: 3.549

5.  Changes in the leaf proteome profile of Mentha arvensis in response to Alternaria alternata infection.

Authors:  Ragini Sinha; Sharmila Chattopadhyay
Journal:  J Proteomics       Date:  2010-11-23       Impact factor: 4.044

6.  Spatial and temporal transcriptomic analysis of the Arabidopsis thaliana-Botrytis cinerea interaction.

Authors:  Joseph M K Mulema; Katherine J Denby
Journal:  Mol Biol Rep       Date:  2011-07-23       Impact factor: 2.316

7.  Tomato Polyphenol Oxidase (Differential Response of the Polyphenol Oxidase F Promoter to Injuries and Wound Signals).

Authors:  P. Thipyapong; J. C. Steffens
Journal:  Plant Physiol       Date:  1997-10       Impact factor: 8.340

8.  Requirement for the induced expression of a cell wall associated receptor kinase for survival during the pathogen response.

Authors:  Z H He; D He; B D Kohorn
Journal:  Plant J       Date:  1998-04       Impact factor: 6.417

9.  MYB58 and MYB63 are transcriptional activators of the lignin biosynthetic pathway during secondary cell wall formation in Arabidopsis.

Authors:  Jianli Zhou; Chanhui Lee; Ruiqin Zhong; Zheng-Hua Ye
Journal:  Plant Cell       Date:  2009-01-02       Impact factor: 11.277

10.  Comparative EST transcript profiling of peach fruits under different post-harvest conditions reveals candidate genes associated with peach fruit quality.

Authors:  Paula Vizoso; Lee A Meisel; Andrés Tittarelli; Mariano Latorre; Juan Saba; Rodrigo Caroca; Jonathan Maldonado; Veronica Cambiazo; Reinaldo Campos-Vargas; Mauricio Gonzalez; Ariel Orellana; Herman Silva
Journal:  BMC Genomics       Date:  2009-09-10       Impact factor: 3.969

View more
  15 in total

1.  Comparative analysis of chrysanthemum transcriptome in response to three RNA viruses: Cucumber mosaic virus, Tomato spotted wilt virus and Potato virus X.

Authors:  Hoseong Choi; Yeonhwa Jo; Sen Lian; Kyoung-Min Jo; Hyosub Chu; Ju-Yeon Yoon; Seung-Kook Choi; Kook-Hyung Kim; Won Kyong Cho
Journal:  Plant Mol Biol       Date:  2015-04-23       Impact factor: 4.076

2.  A temporal gene expression map of Chrysanthemum leaves infected with Alternaria alternata reveals different stages of defense mechanisms.

Authors:  Ye Liu; Jingjing Xin; Lina Liu; Aiping Song; Zhiyong Guan; Weimin Fang; Fadi Chen
Journal:  Hortic Res       Date:  2020-03-01       Impact factor: 6.793

3.  The integration of transcriptomic and transgenic analyses reveals the involvement of the SA response pathway in the defense of chrysanthemum against the necrotrophic fungus Alternaria sp.

Authors:  Xiting Zhao; Lingyu Song; Liwei Jiang; Yuting Zhu; Qinghui Gao; Dandan Wang; Jing Xie; Meng Lv; Ping Liu; Mingjun Li
Journal:  Hortic Res       Date:  2020-06-01       Impact factor: 6.793

4.  De novo transcriptome assembly of pummelo and molecular marker development.

Authors:  Mei Liang; Xiaoming Yang; Hang Li; Shiying Su; Hualin Yi; Lijun Chai; Xiuxin Deng
Journal:  PLoS One       Date:  2015-03-23       Impact factor: 3.240

5.  Transcriptome profiling of pyrethroid resistant and susceptible mosquitoes in the malaria vector, Anopheles sinensis.

Authors:  Guoding Zhu; Daibin Zhong; Jun Cao; Huayun Zhou; Julin Li; Yaobao Liu; Liang Bai; Sui Xu; Mei-Hui Wang; Guofa Zhou; Xuelian Chang; Qi Gao; Guiyun Yan
Journal:  BMC Genomics       Date:  2014-06-09       Impact factor: 3.969

6.  RNA-seq Transcriptome Response of Flax (Linum usitatissimum L.) to the Pathogenic Fungus Fusarium oxysporum f. sp. lini.

Authors:  Leonardo Galindo-González; Michael K Deyholos
Journal:  Front Plant Sci       Date:  2016-11-24       Impact factor: 5.753

7.  Comparative de novo transcriptome profiles in Asparagus officinalis and A. kiusianus during the early stage of Phomopsis asparagi infection.

Authors:  Mostafa Abdelrahman; Naoyuki Suzumura; Mai Mitoma; Satoshi Matsuo; Takao Ikeuchi; Mitsutaka Mori; Kyoko Murakami; Yukio Ozaki; Masaru Matsumoto; Atsuko Uragami; Akira Kanno
Journal:  Sci Rep       Date:  2017-06-01       Impact factor: 4.379

8.  Phylogenetic and transcription analysis of chrysanthemum WRKY transcription factors.

Authors:  Aiping Song; Peiling Li; Jiafu Jiang; Sumei Chen; Huiyun Li; Jun Zeng; Yafeng Shao; Lu Zhu; Zhaohe Zhang; Fadi Chen
Journal:  Int J Mol Sci       Date:  2014-08-19       Impact factor: 5.923

9.  Comparative Transcriptome Analysis of Isoetes Sinensis Under Terrestrial and Submerged Conditions.

Authors:  Tao Yang; Xing Liu
Journal:  Plant Mol Biol Report       Date:  2015-06-27       Impact factor: 1.595

10.  Effects of early feeding on the host rumen transcriptome and bacterial diversity in lambs.

Authors:  Weimin Wang; Chong Li; Fadi Li; Xiaojuan Wang; Xiaoxue Zhang; Ting Liu; Fang Nian; Xiangpeng Yue; Fei Li; Xiangyu Pan; Yongfu La; Futao Mo; Fangbin Wang; Baosheng Li
Journal:  Sci Rep       Date:  2016-08-31       Impact factor: 4.379

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.