BACKGROUND: With the rapid spread of pyrethroid resistance in the main malaria vectors from Benin and the various resistance mechanisms involved (metabolic resistance and knock-down resistance (kdr), it is important to foresee effective resistance management strategies. Thus, the knowledge of the insensitive acetylcholinesterase (ace-1R) effects on phenotypes of An. gambiae will help us to strengthen basic and operational research on the development of strategies that will use organophosphates or carbamates as alternatives against pyrethroids-resistant malaria vectors in the field. METHODS: Larvae and pupae of Anopheles gambiae s.l. mosquitoes were collected from the breeding sites in Ouemé , Atacora, and Alibori departments. CDC susceptibility tests were conducted on unfed female mosquitoes aged 2-5 days old. CDC bioassays were performed with stock solutions of fenitrothion (50 μg per bottle) and bendiocarb (12.5 μg per bottle). PCR techniques were used to detect species and Ace-1 mutations. RESULTS: Anopheles gambiae Seme and Kandi populations were susceptible to fenitrothion whereas Anopheles gambiae Tanguieta and Malanville populations were resistant. An. gambiae populations from Seme, Kandi and Malanville were fully susceptible to bendiocarb whereas those from Tanguieta have developed a strong resistance to the same insecticide. A slight decrease in mortality rate was observed with 97.91% in populations of mosquitoes from Malanville. PCR revealed that all specimens tested were Anopheles gambiae s.s.. CONCLUSION: This study demonstrated the need to monitor organophosphate (OPs) and Carbamates resistance among populations of the An. gambiae s.l. in Benin, to determine its spread and anticipate vector control failure where these insecticides are used. However, further studies are needed to understand the current distribution of the Ace-1R mutation in other localities in the south-north transect Benin.
BACKGROUND: With the rapid spread of pyrethroid resistance in the main malaria vectors from Benin and the various resistance mechanisms involved (metabolic resistance and knock-down resistance (kdr), it is important to foresee effective resistance management strategies. Thus, the knowledge of the insensitive acetylcholinesterase (ace-1R) effects on phenotypes of An. gambiae will help us to strengthen basic and operational research on the development of strategies that will use organophosphates or carbamates as alternatives against pyrethroids-resistant malaria vectors in the field. METHODS: Larvae and pupae of Anopheles gambiae s.l. mosquitoes were collected from the breeding sites in Ouemé , Atacora, and Alibori departments. CDC susceptibility tests were conducted on unfed female mosquitoes aged 2-5 days old. CDC bioassays were performed with stock solutions of fenitrothion (50 μg per bottle) and bendiocarb (12.5 μg per bottle). PCR techniques were used to detect species and Ace-1 mutations. RESULTS: Anopheles gambiae Seme and Kandi populations were susceptible to fenitrothion whereas Anopheles gambiae Tanguieta and Malanville populations were resistant. An. gambiae populations from Seme, Kandi and Malanville were fully susceptible to bendiocarb whereas those from Tanguieta have developed a strong resistance to the same insecticide. A slight decrease in mortality rate was observed with 97.91% in populations of mosquitoes from Malanville. PCR revealed that all specimens tested were Anopheles gambiae s.s.. CONCLUSION: This study demonstrated the need to monitor organophosphate (OPs) and Carbamates resistance among populations of the An. gambiae s.l. in Benin, to determine its spread and anticipate vector control failure where these insecticides are used. However, further studies are needed to understand the current distribution of the Ace-1R mutation in other localities in the south-north transect Benin.
Malaria control in Africa is mainly based on the use of indoor residual spraying (IRS) and insecticide-treated nets (ITN) with pyrethroid insecticides essentially because of their knockdown effect, their excito-repellent properties and their low mammaliantoxicity [1].Pyrethroids are the only insecticides currently available for use on bednets. It is clear that, because resistance to these compounds is widespread in Africa [2-5], interest in using IRS (Indoor Residual Spraying) to control malaria vectors is resurging. This IRS strategy is preferentially based on the use of organophosphates and carbamates, either alone or in combination with pyrethroid impregnated bednets [6].These insecticides inactivate acetylcholinesterase (AChE), an enzyme responsible for neurotransmitter degradation at the cholinergic nerve synapse. However, resistance to OPs and Carbamates based on reduced sensitivity of AChE1 has been detected among An. gambiae from Cote d’Ivoire [7,8]. It was also shown that the AChE1 insensitivity reported in An. gambiae, Anophelesalbimanus Wiedemann, and Culex pipiens L. was due to the same glycine-serine substitution at position 119 resulting from a single point mutation GGC to AGC in the ace-1 gene [8,9]. Although the mutation ace-1 G119S provided cross-resistance to organophosphates and carbamates, the resistance level greatly varied between both insecticide families [10].The Benin National Malaria Control Programme has implemented indoor residual spraying (IRS) campaign under the financial support of the PMI (President’s Malaria Initiative) using bendiocarb in the north of the country since 2011. The same product was previously used to control Anopheles gambiae s.l. populations from Ouemé department in southern Benin (2008-2010).The present study propose was to assess the resistance status of malaria vectors from Malanville, Kandi, Tanguieta and Seme to bendiocarb and fenitrothion.Moreover, this study evaluated the presence and extent of the distribution of the ace-1R mutation within and among these An. gambiae s.l. populations in the south and north Benin, where pyrethroid resistance was also reported in An. gambiae[11,12].
Methods
Study area
The study area is located in Republic of Benin (West Africa) and includes three departments, Ouemé, Atacora and Alibori departments (Figure 1). In Ouemé department located in the South-Eastern Benin, the study was carried out in Seme district recently under IRS with bendiocarb. In Atacora department located in the North-Western Benin, the study was carried out in Tanguieta district under IRS with bendiocarb whereas in Alibori department located in the far north of Benin, the study was carried out in Kandi district, a cotton growing area and in Malanville district, a rice growing area located near the Niger River. The choice of the study sites took into account the economic activities of populations, their usual protection practices against mosquito bites, the indoor residual spraying (IRS) in progress in some of these localities and peasant practices to control farming pests. These factors have a direct impact on the development of insecticide resistance in the local mosquito vectors. Seme is in Ouemé region characterized by a sub-equatorial type of climate with four seasons, two rainy seasons (March-July and September-November) and two dry seasons (December-March and August-September). The temperature ranges from 25 to 30°C with the annual mean rainfall between 900 and 1,500 mm. The northern zone (Tanguieta, Kandi and Malanville) is characterized by a Sudanian climate with only one rainy season per year (May to October) and one dry season (November-April). The temperature ranged from 22 to 33°C with the annual mean rainfall of 1,300 mm.
Figure 1
Map of the study area.
Map of the study area.
Field mosquito collection
Anopheles gambiae s.l. mosquitoes were collected during the rainy seasons (March-July and September-November 2012) across Seme district selected in southern Benin. Anopheles gambiae s.l. mosquitoes were also collected during the rainy season (May to October) across Tanguieta, Kandi and Malanville districts selected in northern Benin. Larvae and pupae were collected from breeding sites and kept in separated labeled bottles related to each locality. The samples were reared to adults in the CREC (Centre de Recherche Entomologique de Cotonou, Benin) insectary. Anopheles gambiae Kisumu, a reference susceptible strain, was used as a control for the bioassay tests. Susceptibility tests were done following a CDC protocol on unfed female mosquitoes aged 2–5 days old, reared from the larval and pupal collections. All susceptibility tests were conducted in the CREC laboratory at 25+/−2°C and 70 to 80% relative humidity.
Testing insecticide susceptibility
Females An. gambiae aged 2 to 5 days old were exposed to the CDC diagnostic dosage of various insecticides according to the CDC protocol [13]. The following insecticides were tested: fenitrothion (50 μg per bottle) and bendiocarb (12.5 μg per bottle). Mosquitoes were exposed for two hours to insecticide-treated bottles and monitored at different time intervals (15, 30, 35, 40, 45, 60, 75, 90, 105, 120 minutes). This allowed us to determine the percentage of total mortality (Y axis) against the exposure time (X axis) for all replicates using a linear scale. Dead and surviving mosquitoes were separately stored in individual tubes with silicagel and preserved at -20°C in the laboratory, for further molecular characterization.
PCR detection of species and Ace-1 mutations
Specimens of An. gambiae from the CDC bioassay tests were subjected to the An. gambiae species specific PCR assays for species identification [14]. The PCR-RFLP diagnostic test was used to detect the presence of G119S mutation (ace.1R gene) as described by Weill et al.[8]. Mosquito genomic DNA was amplified using the primers Ex3AGdir 5′GATCGTGGACACCGTGTTCG3′ and Ex3AGrev 5′AGGATGGCCCGCTGGAACAG3′ according to Weill et al.[8]. One microlitre of total DNA extracted from a single mosquito was used as a template in a 25 μl PCR reaction containing Taq DNA polymerase buffer, 0.2 mM dNTP and 10 pmol of each primer. The PCR conditions were 94°C for 5 min and then 35 cycles of (94°C for 30 s, 54°C for 30 s and 72°C for 30 s) with a final 5 min extension at 72°C. Fifteen microlitres of PCR product were digested with 5U of AluI restriction enzyme (Promega) in a final volume of 25 μl. The PCR fragments were fractionated on a 2% agarose gel stained with ethidium bromide and visualized under UV light.
Statistical analysis and data interpretation
The resistance status of mosquito samples was determined according to the CDC Criteria [13,15]. The susceptibility thresholds at the diagnostic time of 30 minutes for both organophosphates and carbamates are:Mortality rate = 100%: the population is fully susceptibleMortality rate < 100%: the population is considered resistant to the tested insecticides.Abbott’s formula was not used in this study for the correction of mortality rates in test-bottles because the mortality rates in all controls was always less than 5% [16].To compare the status of insecticide resistance, Fisher’s exact test was carried out to determine if there was any significant difference between mortality rates of populations of An. gambiae s.s. of districts using Statistica 6.0. Allelic frequencies of G119S mutation were analysed using the version 1.2 of Genepop [17]. To assess if the mutation frequencies were identical across populations, the test of genotypic differentiation was performed [18].
Ethical approval
This study was approved by the Ministry of Health and the Center for Entomological Research of Cotonou.
Results
Susceptibility of An. gambiae s.l. populations to fenitrothion and bendiocarb
Kisumu strain (control) confirmed its susceptibility status with 100% mortality as a reference strain. All female mosquitoes of Anopheles gambiae Kisumu, which were exposed to CDC bottles treated with fenitrothion 50 μg/bottle and bendiocarb 12.5 μg/bottle showed a total mortality with no survivors after 30 minutes of exposure. This result represents a susceptibility threshold time or diagnostic time as defined by CDC protocol (Table 1).
Table 1
Mortality of from the districts of Malanville, Kandi Tanguieta, and Seme-Kpodji after 2 hours exposure to fenitrothion (50 μg/bottle) and bendiocarb (12.5 μg/bottle)
Localities
Insecticides
Number tested
% Mortality
Resistance status
Kisumu (Control)
Fenitrothion
33
100
S
Bendiocarb
26
100
S
Malanville
Fenitrothion
14
57.14
R
Bendiocarb
48
97.91
S
Kandi
Fenitrothion
50
100
S
Bendiocarb
42
100
S
Tanguieta
Fenitrothion
116
76.72
R
Bendiocarb
76
78.94
R
Seme
Fenitrothion
78
100
S
Bendiocarb
85
100
S
Mortality of from the districts of Malanville, Kandi Tanguieta, and Seme-Kpodji after 2 hours exposure to fenitrothion (50 μg/bottle) and bendiocarb (12.5 μg/bottle)A percentage mortality of 57.14% of An. gambiae from Malanville and 76.72% of An. gambiae from Tanguieta were recorded after 30 minutes of exposure to CDC bottles treated with fenitrothion. These mortalities below the CDC protocol threshold indicate that populations of An. gambiae from Malanville and Tanguieta were resistant to fenitrothion. Following exposure of An. gambiae from Kandi and Seme populations to CDC fenitrothion treated bottles, 100% mortality was recorded on both strains suggesting a complete susceptibility of these populations to the OP fenitrothion (Table 1).Regarding An. gambiae from Tanguieta site, a mortality of 78.94% was recorded after exposure to CDC bottles treated with bendiocarb showing an indication of resistance of this population of mosquitoes to bendiocarb. On the one hand An. gambiae from Malanville showed 97.91% mortality after 30 minutes of exposure to bendiocarb which is suggestive of its resistance to this product whereas An. gambiae from both Kandi and Seme on the other hand gave 100% mortality indicating a total susceptibility to this carbamate (Table 1).
Species of Anopheles gambiae and Ace-1 genotype
PCR revealed 100% of mosquitoes tested were Anopheles gambiae s.s. The frequencies of Ace-1R in Anopheles gambiae Kandi and Malanville were 0% and 1% respectively (Table 2).
Table 2
mutation frequency in populations issue from performing CDC bioassays tests
Localities
Number tested
Species Ag
Ace-1 mutation
RR
RS
SS
F( Ace-1 )
Kandi
48
48
0
0
48
0
Malanville
48
48
0
1
47
0.01
Ag An. gambiae s.s.
mutation frequency in populations issue from performing CDC bioassays testsAg An. gambiae s.s.
Discussion
Pyrethroid-treated bednets remain one of the major tools for malaria vector control in tropical areas. However, the spectrum of resistance to pyrethroids calls for alternative and complementary solutions. Even if they are not recommended for bednets impregnation, OPs and Carbamates should be considered as alternatives for indoor residual sprayings.The Ace-1R frequency observed in Anopheles gambiae Malanville populations (0.01) showed the need to monitor OPs and Carbamates resistance among these An. gambiae populations which were resistant to fenitrothion. The slight decrease of susceptibility obtained with Anopheles gambiae Malanville populations exposed to bendiocarb was not synonymous with resistance. A similar pattern was already observed with Anopheles gambiae Adjara and Dangbo populations exposed to bendiocarb in Ouemé department in southern Benin [19]. Our study confirmed the recent study conducted by Djègbé et al.[12] who showed that Anopheles gambiae Malanville is still susceptible to bendiocarb. However, the current study may contradict the study of Corbel et al.[20] who showed that Anopheles gambiae Malanville were resistant to carbosulfan, a carbamate, with the mortality rate of 75%. In addition, in the current study, PCR revealed that 100% of mosquitoes from Malanville tested were Anopheles gambiae s.s. Conversely, Corbel et al.[20] have shown that Anopheles arabiensis populations were also present in Malanville.In the current study, Anopheles gambiae Kandi populations were susceptible to bendiocarb whereas Djogbenou et al. [2008] (and unpublished data) have shown that Anopheles gambiae Kandi populations were resistant to carbosulfan, a carbamate, with a mortality rate of 73%. There are no previous published studies about the resistance status of An. gambiae populations from Kandi district to carbamates and OPs until a recent report by Aïkpon et al. 2013. Therefore, these populations of An. gambiae need to be monitored for insecticide resistance in this area.Two years after the fourth round (last round) of IRS with bendiocarb in Ouemé department, Anopheles gambiae Seme populations remained susceptible to bendiocarb and fenitrothion. Our study confirmed the recent study conducted by Padonou et al[21] who have demonstrated that Anopheles gambiae Seme populations were still highly susceptible to bendiocarb with a mortality rate more than 99%. The Ace-1R frequency found by these authors was 0.13 in M form of Anopheles gambiae s.s. from Seme district. However, this Ace-1R frequency needs to be monitored.Anopheles gambiae Tanguieta populations were resistant to fenitrothion and bendiocarb. Previous field survey in An. gambiae s.l. populations of South-Western Burkina Faso, where a high amount of insecticides was used in cotton growing areas, showed that ace-1R mutation was the main resistance mechanism of An. gambiae s.l. to carbamates and organophosphates [22].Although this mechanism was not investigated in Anopheles gambiae Tanguieta populations in the current study, a recent study showed that the ace-1R mutation was present in Anopheles gambiae Tanguieta populations resistant to bendiocarb in North-Western Benin [23]. These authors have reported throughout their study that there was a cross-resistance between OPs (fenitrothion) and carbamates (bendiocarb and propoxur) in Anopheles gambiae Tanguieta populations with the presence of Ace-1R at low frequency: 0.12 in S molecular form and 0.08 in M molecular form. Thus, our study confirms the study of Aïkpon et al[23]. In addition, esterases might also play a little role in Anopheles gambiae Tanguieta populations resistant to bendiocarb [24].Once again, complementary studies are needed to precisely determine which resistance mechanism leads to the decrease of mortality against bendiocarb, its current frequency and geographic distribution in field populations of An. gambiae s.l. of Benin. This is particularly relevant for campaigns of indoor residuals spraying based on carbamate and/or organophosphate that are currently implemented by the National Malaria Control Programme in the northern part of the country after the Ouemé campaigns in South-Eastern Benin ended in 2010. Currently, the IRS strategy in progress in Atacora department is preferentially based on the use of organophosphates and carbamates and the spread of the ace-1R mutation could represent a major threat to the effectiveness of this strategy. Ace-1R mutation occured in Anopheles gambiae Tanguieta populations in Atacora department located in North-Western Benin was already found in many specimens of An. gambiae s.s. in South-Western Burkina Faso [22] and in addition to the case of Bouake in Côte d’Ivoire [7]. All these findings suggest that OP and Carbamate resistance may be widespread throughout West Africa.This wide distribution of ace-1R mutation in West Africa theoretically could result either from the spread of the single mutation or from the independent occurrence of the same or different mutations in many countries. Although the rate of mutations generating resistance genes among mosquitoes is unknown, we can consider that the migration including passive transportation of mosquitoes and gene flow play major roles in the dispersion of resistance genes between distant populations [25]. It is clear that closer collaboration between resistance experts in agriculture and public health is needed. Public health agencies can definitely benefit from the extensive experience gained by the agricultural sector in promoting integrated pest-management principles as well as disseminating simple and pragmatic guidelines for insecticide resistance management.
Conclusion
The resistant allele ace-1R confers resistance to organophosphates and carbamates compounds. This resistance potentially represents a threat to the implementation of malaria prevention programmes based on the use of insecticides. Given the importance of the vector control against malaria disease, there is an urgent need for field and laboratory monitoring of insecticide resistance. Characterization of the biochemical interactions between insecticides and resistant target sites will contribute to identifying or to designing new insecticides that should improve effectiveness of resistance management strategies against resistant Anopheles species in tropical regions. Further genetic studies need to be performed on mosquito samples to investigate Ace-1 R gene flow throughout West Africa countries including Benin country. Understanding or predicting the spread of insecticide resistance genes into mosquito populations of the An. gambiae complex will be crucial for the development of effective methods to control the main malaria vector in Africa.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
MA and NA conceived the study. GGP and RA participated in the design of the study. Entomologic data was collected by NA, VG, OO, FA and bioassays and laboratory analysis were carried out by NA, VG and OO. MA and NA participated in the analysis and interpretation of data. VG has contributed to the mapping. The manuscript was drafted by NA and MA has been involved in revision of the manuscript. All authors read and approved the final manuscript.
Authors: J Matowo; J Kitau; R Kaaya; R Kavishe; A Wright; W Kisinza; I Kleinschmidt; F Mosha; M Rowland; N Protopopoff Journal: Med Vet Entomol Date: 2014-12-24 Impact factor: 2.739
Authors: Narjis G Thawer; Jeremiah M Ngondi; Frances E Mugalura; Isaac Emmanuel; Charles D Mwalimu; Evangelia Morou; John Vontas; Natacha Protopopoff; Mark Rowland; Joshua Mutagahywa; Shabbir Lalji; Fabrizio Molteni; Mahdi M Ramsan; Ritha Willilo; Alexandra Wright; Jessica M Kafuko; Isaiah Ndong; Richard Reithinger; Stephen Masingili Magesa Journal: Parasit Vectors Date: 2015-04-22 Impact factor: 3.876
Authors: Constant A V Edi; Benjamin G Koudou; Louise Bellai; Akre M Adja; Mouhamadou Chouaibou; Bassirou Bonfoh; Sarah J E Barry; Paul C D Johnson; Pie Müller; Stefan Dongus; Eliezer K N'Goran; Hilary Ranson; David Weetman Journal: Parasit Vectors Date: 2014-11-28 Impact factor: 3.876
Authors: Jovin Kitau; Richard Oxborough; Johnson Matowo; Franklin Mosha; Stephen M Magesa; Mark Rowland Journal: Parasit Vectors Date: 2014-09-23 Impact factor: 3.876