Engineering spatial patterning in mammalian cells, employing entirely genetically encoded components, requires solving several problems. These include how to code secreted activator or inhibitor molecules and how to send concentration-dependent signals to neighboring cells, to control gene expression. The Madin-Darby Canine Kidney (MDCK) cell line is a potential engineering scaffold as it forms hollow spheres (cysts) in 3D culture and tubulates in response to extracellular hepatocyte growth factor (HGF). We first aimed to graft a synthetic patterning system onto single developing MDCK cysts. We therefore developed a new localized transfection method to engineer distinct sender and receiver regions. A stable reporter line enabled reversible EGFP activation by HGF and modulation by a secreted repressor (a truncated HGF variant, NK4). By expanding the scale to wide fields of cysts, we generated morphogen diffusion gradients, controlling reporter gene expression. Together, these components provide a toolkit for engineering cell-cell communication networks in 3D cell culture.
Engineering spatial patterning in mammalian cells, employing entirely genetically encoded components, requires solving several problems. These include how to code secreted activator or inhibitor molecules and how to send concentration-dependent signals to neighboring cells, to control gene expression. The Madin-Darby Canine Kidney (MDCK) cell line is a potential engineering scaffold as it forms hollow spheres (cysts) in 3D culture and tubulates in response to extracellular hepatocyte growth factor (HGF). We first aimed to graft a synthetic patterning system onto single developing MDCK cysts. We therefore developed a new localized transfection method to engineer distinct sender and receiver regions. A stable reporter line enabled reversible EGFP activation by HGF and modulation by a secreted repressor (a truncated HGF variant, NK4). By expanding the scale to wide fields of cysts, we generated morphogen diffusion gradients, controlling reporter gene expression. Together, these components provide a toolkit for engineering cell-cell communication networks in 3D cell culture.
A main aim of synthetic biology is to design
and build biological
systems to perform desired functions in a predictable manner.[1−3] Within this framework, one area of study is spatial pattern formation:
several artificial gene networks have been inspired by biological
patterning systems. For example, synthetic stripe patterns have been
engineered in transcription-translation reactions in vitro,[4] over bacterial cell lawns,[5] and over fields of mammalian cells.[6]Many of these studies have explored a central
paradigm in embryonic
developmental patterning: the French Flag model of stripe formation.[7] In the model, different genes are expressed in
a concentration-dependent manner from a spatial chemical gradient
formed by a diffusing signal or morphogen. Our ability to engineer
spatial morphogen gradients—and ultimately artificial patterning
systems—is only now developing. In this study, we wished to
add to the synthetic biology toolbox for building such systems.Bacteria are the most commonly used chassis for building and studying
artificial gene networks because of their robustness[8] and general ease-of-use. For example, a synthetic bacterial
system was recently developed that employed quorum-sensing machinery
to make fluorescent stripe or band patterns, as a function of gradients
of diffusible molecules.[5] The system used
genetically encoded enzymes to produce acyl homoserine lactone molecules
(AHLs) that were secreted from sender cells, resulting in concentration-dependent
gene expression in nearby receiver cells. Reflecting their importance,
several groups have focused on engineering similar cell–cell
communication modules[5,9−13] and band-forming systems,[14] primarily in bacteria but also in yeast.[15] Indeed, engineering patterning in 2-dimensional (2D) bacterial systems
is developing rapidly; recent examples include highly intricate fractal
patterns that emerge from the effects of physical interactions.[16,17] Despite these advances, there is a need to develop more patterning
and cell–cell communication tools in mammalian systems.Mammalian models to make patterning systems have been explored
far less than their microbial counterparts. Indeed, as a whole, eukaryotic
synthetic biology[18,19] has fewer developed examples
of network engineering. These include the rational design of memory
in eukaryotic cells,[20] a tunable oscillator,[21] a nitric oxide sender–receiver system,[22] and a recent mammalian band-forming network.[6] The latter study was the first example of a syntheticmammalian morphogen gradient readout system and deployed chemical
gradients of tetracycline, which were detected by engineered gene
networks in Chinese Hamster Ovary cells, so as to generate different
GFP outputs at low, middle, or high tetracycline concentrations. This
resulted in single GFP stripes over 2D fields of cells.In this
study, we wished to develop similar mammalian gradient
readout systems but using only genetically encoded components that
could be delivered entirely as DNA. The main reason was to enable
the engineering of stripe-forming networks that require both positive
and negative feedback; this cannot be achieved if the diffusing morphogen
is chemically synthesized, as with a tetracycline morphogen.[6] Certain gradient-readout networks[23] (French-flag type) and all reaction-diffusion
patterning systems (Turing- or Gierer–Meinhardt-type)[24,25] require feedback connections. Our long-term goal is to make stand-alone
genetic programs, such as French-flag or Turing systems, that will
execute and form patterns when engineered into cells.When considering
this type of engineering problem, we quickly realized
that we lack a lot of tools to engineer many types of patterning gene
network. For instance, the 3-node activator-inhibitor networks for
gradient-detection band-forming systems have been explored exhaustively
in a computational atlas,[23] but we lacked
the tools to make even the simplest activator-inhibitor diffusion
systems in mammalian cells. We therefore decided to expand the repertoire
of parts for such engineering and, in doing so, we chose a new cell
chassis. We selected a cell line, which already had elements of a
’developmental’ program: the Madin–Darby canine
kidney (MDCK) cell line spontaneously forms hollow multicellular spheres
in 3D collagen culture. We reasoned that we might be able to to graft
spatial patterning networks on top of the MDCK cyst scaffold, to generate
synthetic morphogen gradients, incorporating diffusing activation
and inhibition interactions. Conveniently, MDCK cells are known to
activate certain genes in response to an extracellular protein: hepatocyte
growth factor (HGF), which could be used as a diffusing extracellular
activator. A trunctated form of HGF (NK4) represses HGF-signaling[26] and could be used as a diffusing inhibitor in
our system.A short-term aim was simply to explore whether we
could make sender–receiver
gene expression regions on single cysts. The idea was to show whether
one region of a cyst could express and secrete a functional, diffusible
activator or inhibitor molecule (HGF or NK4) and thus control gene
expression of a fluorescent reporter on a distal region of the same
cyst. We envisaged this kind of system to be a prototype for a synthetic
developmental pattern on a single cyst, where more complicated patterns
might eventually be built-up, layer by layer.A longer-term
aim was to develop tools for spatial patterning network
engineering, including the eventual design of artificial French-flag
or Turing patterns, as mentioned above. In this study, we therefore
developed a toolkit of components and methods to deliver them locally
in 3D culture, to make functional sender–receiver interactions,
for both activator and inhibitor signaling.In 2D culture, MDCK
cells form polarized epithelial monolayers,
with apical, basal, and lateral cell membrane surfaces. By contrast,
when single MDCK cells are seeded in a collagen type I matrix, each
cell grows to form a polarized spherical monolayer enclosing a fluid-filled
lumen.[27] After 6 days’ growth, the
resulting cysts are hollow spheres of ∼200 cells (∼50
μm diameter)(Figure 1a).
Figure 1
Localized transfection
method for 3D MDCK culture. (a) MDCK cells
seeded into collagen grow into hollow spherical cysts (∼200
cells) over a period of 6 days. (b) Schematic view showing two collagen
layers in a 35 mm diameter dish. A second layer, comprising collagen
mixed with the seeding cells, allows cysts to develop at the interface
between the layers. The top layer is peeled away to allow transfection
of one face of the cysts. A new collagen layer is then poured on top.
(c) A typical MDCK cyst, locally transfected with EGFP under a constitutive
CMV promoter. (d) Local transfection with HGF under a CMV promoter,
followed by an internal ribosome entry site (IRES) and the EGFP gene.
A schematic view (below) shows the transfected region (green) secreting
functional HGF, which diffuses around the cyst to induce tubulation.
Phase contrast light microscopy images are superimposed with the GFP
fluorescence channel. Scale bars: 50 μm.
Localized transfection
method for 3D MDCK culture. (a) MDCK cells
seeded into collagen grow into hollow spherical cysts (∼200
cells) over a period of 6 days. (b) Schematic view showing two collagen
layers in a 35 mm diameter dish. A second layer, comprising collagen
mixed with the seeding cells, allows cysts to develop at the interface
between the layers. The top layer is peeled away to allow transfection
of one face of the cysts. A new collagen layer is then poured on top.
(c) A typical MDCK cyst, locally transfected with EGFP under a constitutive
CMV promoter. (d) Local transfection with HGF under a CMV promoter,
followed by an internal ribosome entry site (IRES) and the EGFP gene.
A schematic view (below) shows the transfected region (green) secreting
functional HGF, which diffuses around the cyst to induce tubulation.
Phase contrast light microscopy images are superimposed with the GFP
fluorescence channel. Scale bars: 50 μm.Hepatocyte growth factor (HGF) binds the extracellular c-Met
receptor
tyrosine kinase on cysts,[28] ultimately
inducing branching hollow tubules, and differential gene regulation.[29−31] This led us to hypothesize that HGF could be used as a synthetic
morphogen signaling molecule.As our aim was to use DNA-encoded
components, we first tested HGF
gene expression by transient transfection. Whereas we could get ∼60%
DNA transfection efficiency with lipofectamine in standard 2D MDCK
culture and <1% with PCR-coated beads[32] (Supporting Information Figure S1), we
were initially unable to see transfection in collagen 3D culture.
To overcome this issue, we developed a new localized transfection
method for MDCK cysts, by growing the cysts in between two layers
of collagen (Figure 1b). The top layer was
peeled away with fine tweezers to reveal accessible portions of the
cysts for transfection. Consequently, a CMV-EGFP reporter could be
delivered to one face of a cyst with high efficiency: 72 ± 7%
s.d. of cysts were locally transfected (142 cysts total; 3 independent
experiments)(Figure 1c). Within these transfected
cysts, as determined by confocal microscopy, the transfection efficiency
was estimated to be 22 ± 11% s.d. (73 cysts; 3 independent experiments).A bicistronic construct expressing both HGF and EGFP could also
be locally transfected and resulted in cyst tubulation (Figure 1d). This demonstrated that HGF DNA could be locally
delivered, expressed as protein, and secreted in a functional form,
at levels sufficient to exert a morphogenic effect on nearby receiver
cells.To build a synthetic gene network where cells would secrete
HGF
to change gene expression in neighboring cells, it was first necessary
to engineer an HGF-dependent reporter. HGF activates c-Met signaling
pathways, altering the expression of many genes, including matrix
metalloproteinases (MMPs). For example, HGF activates the MMP-1 promoter.[33] Based on this, we designed an MMP-1 promoter
construct driving a destabilized d2EGFP[34] (Supporting Information S1).We
generated stable cell lines with MMP-1-d2EGFP and examined the
response of cysts to HGF in 3D cell culture. Qualitatively, the fluorescence
increased markedly over 16 h of HGF-exposure (Figure 2a–h; Supporting Information Movie
S1). Not all cells in this isogenic cell line turned green
in response to uniform HGF, because of biological variability in individual
cell responses within cysts. We observed this variability throughout
our experiments, and the effect is not to be confused with the localized
transfections, where only some cells contain the gene constructs (e.g.,
Figure 1). Tubulation can also be seen in Figure 2; although this phenotypic output is the natural
result of HGF signaling, it was not the focus of our study per se. Rather, we concentrated on fluorescent outputs which
are more easily quantified. In fact, to reduce potential interference
with downstream engineered networks, it is possible that the tubulation
response could be eliminated with shRNAs.[35]
Figure 2
Engineering
an HGF-responsive reporter cell line. HGF induces green
fluorescence and tubulation in MDCK-MMP-1-d2EGFP cysts. (a–h)
A cyst was treated with 10 ng/mL HGF for 16 h. Images were taken every
two hours after adding HGF. Note the low basal fluorescence in MDCK
cysts in 3D culture (panel a). A typical cyst is shown and can also
be seen in timelapse (Supporting Information Movie
S1). Scale bars, 50 μm.
Engineering
an HGF-responsive reporter cell line. HGF induces green
fluorescence and tubulation in MDCK-MMP-1-d2EGFP cysts. (a–h)
A cyst was treated with 10 ng/mL HGF for 16 h. Images were taken every
two hours after adding HGF. Note the low basal fluorescence in MDCK
cysts in 3D culture (panel a). A typical cyst is shown and can also
be seen in timelapse (Supporting Information Movie
S1). Scale bars, 50 μm.To quantify HGF induction, we analyzed timelapse microscopy
images
of cysts in collagen. We found that the fold-induction of GFP with
different HGF concentrations was highly reproducible (Figure 3a). Thus, we were able to fit an HGF-GFP dose-reponse
curve (Figure 3b). HGF had an effective concentration
for 50% GFP activation (EC50) of ∼17 ng/mL and a
maximum response of ∼4-fold (Supporting
Information S1). HGF-GFP induction was also verified at the
RNA level with quantitative real time PCR (qRT-PCR): 17 ng/mL HGF
(50 ng in a 3 mL well) induced GFP about 4-fold (Figure 3c). Above this HGF concentration, the cysts tend
to dissociate (scatter) into single cells, and so, we avoided such
conditions in subsequent experiments.
Figure 3
HGF and NK4 dose–responses in the
MDCK:MMP-1-d2EGFP stable
cell line. (a) HGF response over 24 h for 5 HGF concentrations. The
relative GFP response is calculated by normalizing to the fluorescence
from 0 ng/mL HGF samples (all data: mean of 4 experiments). (b) Maximum
responses reached in 24 h as function of HGF concentration. These
allow an estimation of maximum EGFP response (Rmax = ∼4-fold), the effective concentration for 50%
induction (EC50 = 17 ng/mL), and a Hill coefficient for
activation (n = 1.2). (c) qRT-PCR of EGFP RNA with
17 ng/mL HGF (mean of 3 experiments; comparison to two housekeeping
genes, GAPDH and UB). (d) NK4 repression of 17 ng/mL HGF. Maximal
GFP responses (relative to 0 ng/mL HGF samples) over a 24 h period
are plotted as a function of NK4 concentration. The NK4 concentration
for 50% inhibition of an Rmax GFP signal
can also be calculated (IC50 = 38 ng/mL). For all calculations
see Supporting Information S1.
HGF and NK4 dose–responses in the
MDCK:MMP-1-d2EGFP stable
cell line. (a) HGF response over 24 h for 5 HGF concentrations. The
relative GFP response is calculated by normalizing to the fluorescence
from 0 ng/mL HGF samples (all data: mean of 4 experiments). (b) Maximum
responses reached in 24 h as function of HGF concentration. These
allow an estimation of maximum EGFP response (Rmax = ∼4-fold), the effective concentration for 50%
induction (EC50 = 17 ng/mL), and a Hill coefficient for
activation (n = 1.2). (c) qRT-PCR of EGFP RNA with
17 ng/mL HGF (mean of 3 experiments; comparison to two housekeeping
genes, GAPDH and UB). (d) NK4 repression of 17 ng/mL HGF. Maximal
GFP responses (relative to 0 ng/mL HGF samples) over a 24 h period
are plotted as a function of NK4 concentration. The NK4 concentration
for 50% inhibition of an Rmax GFP signal
can also be calculated (IC50 = 38 ng/mL). For all calculations
see Supporting Information S1.It should be noted that we also tested the cell
line in 2D culture
and found a slightly lower maximum induction up to ∼1.7-fold
(Supporting Information Figure S2). Since
MDCK cells in 2D culture tend to be highly motile and give lower signal
to background, we focused on the 3D system. Overall, having established
the conditions for reporter activation, the next step was to see if
we could control the system with a repressor.NK4 is a syntheticHGF fragment, composed of the N-terminal 447
amino acids, including four kringle domains.[26] NK4 binds to c-Met but does not induce receptor dimerization and
activation. In fact, NK4 inhibits the mitogenic, motogenic, and morphogenic
activities of HGF and is the most complete HGF antagonist described.[26] Thus, NK4 was the ideal candidate for adding
a repressor function to our HGF-induced MMP-1-d2EGFP cyst system.To quantitate NK4 repression, we used the same microscopy approach
as for assaying HGF induction. We tested increasing concentrations
of NK4, versus the reporter cell line with 17 ng/mL HGF (Figure 3d). We were thus able to estimate the effective
NK4 concentration for 50% inhibition (IC50): 38 ng/mL (Supporting Information S1). Furthermore, 350
ng/mL of NK4 repressed the system fully, so that GFP was undetectable
above background (Supporting Information Figure
S3). NK4 is therefore a suitable repressor for our synthetic
system.To build dynamic systems that respond to changing conditions,
it
is necessary that reporter induction be reversible. In principle,
system reversibility could be influenced by several processes including
the degradation of HGF inducer, the shut-down of signaling to the
pMMP-1 promoter, or the degradation of expressed GFP. We therefore
designed experiments to test whether the system was reversible at
any of these levels.First, we measured the half-life of the
destabilized d2EGFP[34] in MDCK cysts using
a bleach-chase approach[36] (Figure 4a). The GFP
half-life (T1/2 = 9.2 h) is longer than
the two hours reported in other cells but does confirm protein turnover.
We compared this result to measuring GFP half-life using a standard
cycloheximide treatment.[37] We thus obtained T1/2 = 2.9 h (Figure 4b), which is closer to the 2 h half-life reported in the literature.[34] Cycloheximide inhibits protein biosynthesis
and is toxic to the cell, compared with the less invasive bleach-chase
method. The two methods may therefore represent upper and lower bounds
for d2EGFP protein degradation under varying conditions of cell metabolism.
It may be possible that cycloheximide stimulates protein decay machinery
as a response to the shock of ribosome inhibition, decreasing apparent
half-lives. Notably, the bleach-chase method is said to compare well
to the gold standard of radioactive pulse chase to measure half-lives,[37] and both methods are less invasive than cycloheximide
treatment. Further studies to elucidate differences between these
methods would be desirable in the future.
Figure 4
Reversibility of HGF
induction of MDCK:MMP-1-d2EGFP reporter cysts.
(a) Measuring the half-life of d2EGFP in cysts with bleach-chase.[36] Fluorescence after bleaching (red) converges
to the nonbleached profile (blue) with exponential dynamics, revealing
the protein removal rate by calculating the slope of a linear fit
between the difference of bleached and unbleached samples, on a semilog
plot (below). Data are from 68 cysts (unbleached) and 43 cysts (bleached).
α = 0.075 h–1 ± 0.003; R2 = 0.97; T1/2 = 9.24 h. (b)
d2EGFP half-life measurement after inducing cysts with 8.3 ng/mL HGF
for 15 h and then blocking protein synthesis with 6.6 μg/mL
cycloheximide. T1/2 = 2.9 h (mean of 3
experiments). (c) Reversibility of induction after adding 8.3 ng/mL
HGF, from T = 0–24 h, and either washing (green)
or leaving unwashed (red). Quantification is from microscopy between T = 30–50 h (mean of 3 experiments). (d) NK4 represses
HGF-induced fluorescence even when NK4 is added 2 or 4 h after HGF
(mean of 3 experiments). All error bars: 1 s.e.m.
Reversibility of HGF
induction of MDCK:MMP-1-d2EGFP reporter cysts.
(a) Measuring the half-life of d2EGFP in cysts with bleach-chase.[36] Fluorescence after bleaching (red) converges
to the nonbleached profile (blue) with exponential dynamics, revealing
the protein removal rate by calculating the slope of a linear fit
between the difference of bleached and unbleached samples, on a semilog
plot (below). Data are from 68 cysts (unbleached) and 43 cysts (bleached).
α = 0.075 h–1 ± 0.003; R2 = 0.97; T1/2 = 9.24 h. (b)
d2EGFP half-life measurement after inducing cysts with 8.3 ng/mL HGF
for 15 h and then blocking protein synthesis with 6.6 μg/mL
cycloheximide. T1/2 = 2.9 h (mean of 3
experiments). (c) Reversibility of induction after adding 8.3 ng/mL
HGF, from T = 0–24 h, and either washing (green)
or leaving unwashed (red). Quantification is from microscopy between T = 30–50 h (mean of 3 experiments). (d) NK4 represses
HGF-induced fluorescence even when NK4 is added 2 or 4 h after HGF
(mean of 3 experiments). All error bars: 1 s.e.m.We next tested the effect of adding and washing away HGF. Washed samples (Figure 4c) should
comprise the decay of cell signaling and d2EGFP expression, after
HGF removal (apparent T1/2 = 10.8 h).
Since this HGF removal result corresponds closely to the measured
upper bound of the half-life of d2EGFP (bleach-chase), we can conclude
that signaling switches-off rapidly once HGF is gone and that GFP
protein degradation is the main limiting process in system reversibility.We further tested whether HGF itself degraded in long-term incubation
(Figure 4c). The Unwashed sample
should comprise the intrinsic decay of HGF, cell signaling and d2EGFP
expression (apparent T1/2 = 21.2 h). Since
cell signaling and d2EGFP degrade much faster, the majority of this
slow decline is likely to be from HGF degradation. Overall, signal
switch-off is a combination of HGF half-life, pathway signaling decay,
and GFP half-life; these factors will all have to be considered when
modeling outputs in downstream network engineering studies.Finally, we tested whether NK4 could repress activation even after
HGF was allowed to activate the system for a defined period, such
as 2 or 4 h. The result was that NK4 could indeed block activation
even after a sustained exposure to HGF (Figure 4d). In summary, the reporter system is reversible at various levels,
which is useful for building dynamic synthetic networks.Having
established that the MDCK:MMP-1-d2EGFP cell line formed
cysts that could respond reversibly to recombinant HGF, we next combined
this with the localized transfection technique (Figure 1b) to see whether locally delivered DNA (encoding HGF) could
send signals to neighboring cells, within the same cyst. We therefore
constructed a bicistronic CMV-promoter expression construct, with
red fluorescent reporters for marking transfection (mCherry or dsRed,
as indicated, depending on the FACS or microscopy applications). The
HGF coding sequence was expressed via an internal ribosome entry site
(IRES). The pCMV-mCherry-IRES-HGF plasmid could be locally transfected
to form red patches on single cysts (Figure 5). These mCherry-expressing cells also secreted functional HGF, as
determined by the nearby induction of green fluorescence (via MMP-1-d2EGFP)
and tubulation (Figure 5h,j; Supporting Information Movie S2, S3). Secreted HGF could also
be detected in the cell culture medium by ELISA, up to ∼0.5
ng/mL (Supporting Information Figure S4).
Figure 5
Localized sender–receiver patterns in single MDCK cysts.
The MDCK-MMP-1-d2EGFP reporter cyst is locally transfected with pCMV-mCherry-IRES-HGF
(red region). The red region secretes HGF which diffuses extracellularly
to induce distal GFP expression and tubule formation. (a–h)
Images taken from 6 h after transfection, at 2 h intervals. A typical
cyst is shown and can also be seen in timelapse (Supporting Information Movie S2). (i, j) An independent example
of the same setup at 6 h (i) and 14 h (j); this cyst goes on to tubulate
after 14 h (Supporting Information Movie S3). (k) Locally transfecting MDCK wt cysts with CMV-EGFP-IRES-HGF
activator (green) or mCherry-IRES-NK4 (red), or both together (yellow).
Images taken after 24 h. Cotransfecting NK4 blocks HGF-induced tubulation.
Scale bars, 50 μm.
Localized sender–receiver patterns in single MDCK cysts.
The MDCK-MMP-1-d2EGFP reporter cyst is locally transfected with pCMV-mCherry-IRES-HGF
(red region). The red region secretes HGF which diffuses extracellularly
to induce distal GFP expression and tubule formation. (a–h)
Images taken from 6 h after transfection, at 2 h intervals. A typical
cyst is shown and can also be seen in timelapse (Supporting Information Movie S2). (i, j) An independent example
of the same setup at 6 h (i) and 14 h (j); this cyst goes on to tubulate
after 14 h (Supporting Information Movie S3). (k) Locally transfecting MDCK wt cysts with CMV-EGFP-IRES-HGF
activator (green) or mCherry-IRES-NK4 (red), or both together (yellow).
Images taken after 24 h. Cotransfecting NK4 blocks HGF-induced tubulation.
Scale bars, 50 μm.The induction of green cells around the red source region
was a
first step toward our aim of a synthetic ‘developmental’
program. The next step was to see if we could control this process
with a repressor. We therefore transiently transfected HGF and NK4
constructs together and achieved a repression of HGF signaling (Figure 5k). Repression was stable over 24 h, although we
did not perform any observations after this time point. Overall, this
shows that secreted NK4 can be produced at sufficient concentrations
to block secreted HGF.Having explored HGF and NK4 activities
on single cysts, we moved
to larger fields containing hundreds of cysts, on 35 mm culture plates.
Our motivation was to set up a system employing larger spatial scales
for diffusion-gradient based patterning. The fields were made with
the same 2-layer method as before (Figure 1b), but 3 mm diameter glass beads or 2 mm diameter microcapillaries
were used to mold or gouge out ‘wells’ in the collagen.
The aim was to visualize the diffusion of activator, in the presence
or absence of inhibitor, by adding sender cells to the wells.To visualize cell fields, we used an automated wide-field inverted
fluorescence microscopy system. Using low magnification settings,
we took multiple overlapping regions of the collagen gel culture (e.g.,
750 × 600 μm), using the custom software and scripting
tools of the microscope. Phase contrast microscopy allowed us to focus
automatically on the cyst plane. The images were then aligned and
stitched together to make a large image (e.g., 13.6 mm ×1.7 mm;
Figure 6a).
Figure 6
Sender cell regions produce gradients
of HGF-induced and NK4-repressed
fluorescence in collagen matrices containing MDCK-MMP-1-d2EGFP receiver
cysts. (a) A widefield view of the receiver region next to a well
(not shown) containing 21 000 MDCK sender cells (transfected
with CMV-HGF-IRES-dsRED and sorted by FACS for dsRED). The composite
image is stitched from multiple 752 × 599 mm images and shows
the fluorescence and tubulation of the cysts at time point 16.5 h,
with close-up views in the insets below. Timelapse data were thus
collected and used to obtain the diffusion gradient response profile
over time (right). Average intensity values at particular spatial
points (black dots) were used to fit the diffusion model shown by
the color axis surface profile (see Supporting
Information for diffusion constant calculations). (b) Quantification
of NK4 repression of HGF-induced GFP gradients from mixtures of transfected
HEK293T sender cells added to single sender wells (HEK293T were used
because of high transfection efficiency). Sender cells expressed CMV-HGF-IRES-DsRed
plus CMV-NK4-CBD-IRES-DsRed. Fluorescence images were quantified with
ImageJ (Radial profile plugin). (c) Interaction of an HGF gradient
with an NK4 gradient. Sender wells were created approximately 9 mm
apart and the indicated amounts of purified HGF or NK4 were added
at opposite ends, allowing diffusion over a field of reporter cysts,
while taking timelapse GFP fluorescent images (images shown: 18.5
h). The images were quantitated (right; see Supporting
Information) to obtain response profiles over time, showing
that NK4 restricts the HGF-induced fluorescent gradient.
Sender cell regions produce gradients
of HGF-induced and NK4-repressed
fluorescence in collagen matrices containing MDCK-MMP-1-d2EGFP receiver
cysts. (a) A widefield view of the receiver region next to a well
(not shown) containing 21 000 MDCK sender cells (transfected
with CMV-HGF-IRES-dsRED and sorted by FACS for dsRED). The composite
image is stitched from multiple 752 × 599 mm images and shows
the fluorescence and tubulation of the cysts at time point 16.5 h,
with close-up views in the insets below. Timelapse data were thus
collected and used to obtain the diffusion gradient response profile
over time (right). Average intensity values at particular spatial
points (black dots) were used to fit the diffusion model shown by
the color axis surface profile (see Supporting
Information for diffusion constant calculations). (b) Quantification
of NK4 repression of HGF-induced GFP gradients from mixtures of transfected
HEK293T sender cells added to single sender wells (HEK293T were used
because of high transfection efficiency). Sender cells expressed CMV-HGF-IRES-DsRed
plus CMV-NK4-CBD-IRES-DsRed. Fluorescence images were quantified with
ImageJ (Radial profile plugin). (c) Interaction of an HGF gradient
with an NK4 gradient. Sender wells were created approximately 9 mm
apart and the indicated amounts of purified HGF or NK4 were added
at opposite ends, allowing diffusion over a field of reporter cysts,
while taking timelapse GFP fluorescent images (images shown: 18.5
h). The images were quantitated (right; see Supporting
Information) to obtain response profiles over time, showing
that NK4 restricts the HGF-induced fluorescent gradient.Using a region of HGF-secreting MDCK sender cells
resulted in gradients
of GFP expression over a field of receiver cysts (Figure 6a). Tubulation could be seen to occur along the
diffusion gradient (Figure 6a; insets). We
quantified and visualized the gradients of reporter gene output using
timelapse series of data (Figure 6a; right; Supporting Information S1). Thus, we calculated
an effective diffusion constant for HGF by fitting a diffusion model
onto the observed gradients (Supporting Information
S1; Figure S5). The value we obtained of 3.1 × 10–3 mm2/min is similar to another published
estimate of HGF diffusion in collagen.[38]Next, we looked at the effects of NK4 repression on the HGF
signaling
gradient, by producing different amounts of HGF and NK4 from the same
sender well (Figure 6b). HEK293T sender cells
were transfected with plasmids expressing CMV-HGF-IRES-DsRed plus
CMV-NK4-CBD-IRES-DsRed (HEK293T were used here rather than MDCK because
of their high transfection efficiency). We found that NK4 repression
modulated the observed gradients, according to the dose of repressor
cells (Figure 6b).Finally, we explored
whether a gradient of HGF-induced GFP expression
in receiver cysts could be modulated by a gradient of NK4 repressor.
For this, we set up a collagen matrix with two sender wells, approximately
9 mm apart. Purified HGF or NK4 were added at opposite ends, allowing
diffusion over a field of reporter cysts, while taking timelapse GFP
fluorescent images (Figure 6c). By quantifying
the time series, we observed the evolution of the response (Figure 6c; right). We found that NK4 can both repress and
restrict the spread of HGF-induced gradient.Overall, the system
we have developed is reproducibly and reversibly
controlled by secreted HGF activator and NK4 repressor, both on the
scale of single cysts and in widefield views, suggesting that these
components are promising candidates for engineering synthetic patterns.In this study, we built a set of tools for linking gene expression
and secreted extracellular activator or inhibitor molecules, in the
MDCKmammalian cell line, to allow the engineering of synthetic patterns.The MDCK cell line was chosen because it has been reported to respond
with changes on gene expression to the diffusing extracellular activator
HGF[33] and to a related inhibitor, NK4.[26] Thus, the cells contained potential elements
that could be developed toward engineering spatial patterning networks,
such as French-flag-type stripes,[5,23] or reaction-diffusion
patterns.[24,25] In this pilot study, we aimed to test whether
sender cells could secrete functional activators, or inhibitors, and
thus change reporter gene expression in distal receiver cells.MDCK cells can be cultured in both 2D and 3D and we found that
that the 3D MDCK cyst system was preferable for our purposes: (i)
the cells in 3D were not motile as in 2D; (ii) reporter background
was lower in 3D (resulting in a greater signal/background ratio);
(iii) the collagen culture matrix provided a suitable environment
for controlled diffusion of HGF and NK4.Furthermore, the 3D
system allowed us to develop a localized transfection
method, employing a dual-layer collagen dish, where cysts growing
at the layer interface could be locally transfected in a bull’s
eye pattern. This technique enabled us to make a simple patterning
program: a circular red mCherry-expressing region on a cyst secreted
HGF and, over time, neighboring colorless regions began to turn EGFP
green and to tubulate. The motivation was thus to work toward building
an artificial developmental program step-by-step. (see Supporting Information Movies S1–S3).It should be noted that throughout the present study the cysts
tubulated in response to HGF. Because there are no known feedbacks
between tubulation and HGF signaling, this did not impair our downstream
efforts to engineer cell signaling and communication; in fact, the
tubulation acted as a convenient additional phenotypic output to indicate
the presence of active HGF. However, for some network engineering
applications, it could be advantageous to block tubulation, to program
cells without any change in physiology. For this purpose, Lipschutz
and colleagues have reported that an shRNA targeted to MMP-13 can
inhibit tubulogenesis.[35] In the future,
it would be interesting to see whether an HGF-GFP reporter cell line,
stably expressing this shRNA, could function without tubulation.Moving beyond patterning at the scale of single MDCK cysts, a larger
scale spatial configuration was chosen because this was more appropriate
for studying morphogen systems, where gradients and stripes are engineered
on the scale of fields of cells.[5,6] Using the larger-scale
setups, we showed that gradients of activation could be modulated
by the dosage of activator and inhibitor.Although it is outside
the scope of the current work, dowstream
experiments will test the possibility of using these components to
build simple wide-field cell–cell communication networks, involving
positive and negative feedback, such as the French-flag or Turing
systems mentioned above. To enable such dynamic network engineering,
we established here that the MMP-1-HGF fluorescence induction process
was reversible and could be repressed by the NK4 repressor. Moreover,
the components we have developed are modular and work together consistently,
in dose-dependent manners. Using these criteria, the toolkit could
be further expanded component-by-component in the future, to make
more sophisticated gene network programs based on secretion, diffusion,
activation and repression. Thus, we hope to contribute to the field
of patterning network engineering within mammaliansynthetic biology.Mammalian systems provide a diverse range of cellular machinery
for synthetic biology. First, the mammalian single plasma membrane
lends itself well to synthetic cell–cell communication applications
because it can be easily traversed by fusions with secretory protein
signal peptides. Second, a wide range of receptors and secreted signaling
factors are available as candidates for re-engineering. Third, eukaryotes
often contain many splice variants within the same gene, with different
agonist or antagonist function. The NK4 used in this study is a good
example of a truncated protein that retains only part of its original
function: receptor binding without any activation. Although bacterial
protein domains are often modular, the ease with which eukaryotic
activators can be converted into inhibitors via differing exon usage,
raises interesting questions about their potential to evolve antagonistic
or self-repressive networks.[39]Although
we are far away from building structures or organs from
the bottom-up, the stepwise approach reported here reveals that modular
network components can indeed be isolated and grafted onto existing
systems. This results in reproducible systems behavior, using both
intra- and extracellular components. In mammaliansynthetic biology,
we are still at the beginning of finding out what is possible and
what is not. Ultimately, our drive is to understand systems by building
them.
Methods
Cell Culture
MDCK cells were cultured
in MEM with 10%
FBS, 100 IU/ml penicillin, 100 mg/mL streptomycin, and 2 mM l-glutamine at 37 °C, 5% CO2.For 3D MDCK culture,[40] cells were trypsinized and resuspended to 3
× 104 cells/ml in a type I collagen solution containing
PureCol (3 mg/mL), Advanced BioMatrix 5005-B, 10× MEM, NaHCO3 (2.35 mg/mL), l-glutamine (29.2 mg/mL), and 1 M
HEPES (pH 7.6). Cells in suspension were added to wells containing
a cell-free collagen mix (polymerized previously at 37 °C) and
were incubated at 37 °C (without CO2) for 20–30 min. Two
milliliters of liquid media was added above the collagen layers and
replaced every 2–3 days. For the analysis of gene expression
diffusion patterns, cysts were seeded as described above, in a 35
mm plate containing a 2 mm diameter glass capillary, which was then
removed to make a ‘well’ for seeding sender cells.
Localized Cyst Transfection in Three-Dimensional Collagen Gel
Culture
MDCK cysts were grown (as above) in 35 mm plates.
After 8 days, the top collagen layer was carefully peeled off with
the help of fine tweezers.[27] Cysts were
transfected with 4.5 μg plasmid DNA and 20 μL Lipofectamine
per plate, with incubation at 37 °C for 5 h. The medium was removed
and a new collagen layer added. The plate was then incubated in a
37 °C oven (in the absence of CO2) for 20–30
min. Two milliliters of fresh liquid medium was then added for 24
h further culture.
Stable Cell Lines
MDCK cells were
transfected with
Lipofectamine according to the manufacturer’s instructions.
Twenty-four hours post transfection, green FITC+ cells were enriched
with a FACSaria cell sorter, and were grown for 1 week in MEM with
a supplement of G418 (500 μg/mL; PAA Laboratories P11–012)).
The cells were again sorted by FITC signal, into individual wells
of a 96-well plate, and were grown to confluency. Cells were treated
with HGF (50 ng/mL, 24 h), and candidates with increased fluorescence
were further tested for their response to HGF, in 3D culture. The
cell line V384A2 had the strongest induction and was used in all subsequent
experiments.
Production and Quantification of NK4
HEK 293T cells
were transfected with CMV-NK4 using Effectene (Qiagen) according to
the manufacturer’s instructions. Twenty-four hours post transfection,
the MEM medium was replaced with fresh medium.After a further
24 h, the supernatant was collected and concentrated using Amicon
Ultra Centrifugal Filters (30K molecular weight cut off). NK4 in the
concentrated supernatant was quantified with a Quantikine ELISA kit
for humanHGF (R&D Systems), according to the manufacturer’s
instructions.
Microscopy Quantification
All images
shown were taken
with a Zeiss Live observer microscope system, at 10× (0.3 NA)
or 20× (0.5 NA) magnification (indicated), 37 °C and 5%
CO2. A 300 W Xenon arc bulb was used for illumination and
a 38HE filter set for acquisition. Cysts were imaged every 45 min
with an exposure of 5s. The cysts were grown as described above on
MatTek 6-well glass bottom dishes (thickness no. 1.0; glass diameter
20 mm). For the differential response experiments, at T = 0 h, medium was replaced with 1 mL of MEM, with the appropriate
HGF concentrations, to a total collagen-plus-MEM volume of 3 mL. For
the reversibility experiments, 25 ng/mL HGF was added at T = 0 h and washed 2 × 1 h with MEM and 1 × 1 h with PBS
at T = 24 h. GFP signals were collected with a 5
s exposure time and 15 ms in the phase contrast channel. Twenty images
were taken for each concentration. Images were analyzed with a custom
MATLAB script. Regulatory functions were fitted to estimate the 50%
effective or inhibitory concentrations of HGF and NK4 (EC50, IC50), maximum fold-responses, and the Hill coefficient
(n) (Supporting Information).
qRT-PCR
RNA was isolated with the Qiagen RNA mini Kit.
After 20 h of HGF induction, the top collagen layer was removed. RLT
buffer was added directly to the lower layer and immediately transferred
to a 1.5 mL polyethylene tube and processed according to the manufacturer’s
protocol. RNA was reverse transcribed with the SuperScript III first-strand
synthesis mix (Invitrogen). Primers for GFP sequence and controls
are as follows: GFP Fwd, CCTGAAGTTCATCTGCACCA; Rev, AAGTCGTGCTGCTTCATGTG;
canine Glyceraldehyde 3-phosphate dehydrogenase, GAPDH Fwd, AACATCATCCCTGCTTCCAC;
Rev, GACCACCTGGTCCTCAGTGT; Ubiquitin-specific Peptidase UB Fwd, CAGCTAGAAGATGGCCGAAC;
Rev, ACTTCTTCTTGCGGCAGTTG. The fold change was calculated using the
Pfaffl method.[41]
Wide-Field Fluorescence
Microscopy
MDCK cysts were
grown as above in 35 mm plates. A 2 mm diameter glass microcapillary
was fixed vertically in the 2-layer collagen culture to make a well.
After 8 days, the capillary was removed and transiently transfected
HEK293 sender cells were injected into the well. After 20 min settling
time, the top collagen layer was carefully peeled off with the help
of fine tweezers,[27] and a new collagen
layer added, as above.Automatic mosaic imaging of large areas
(Zeiss Cell Observer HS system: AxioObserver Z1 microscope; AxioCam
cooled CCD camera; 10×, 0.3 NA objective): overlapping fields
were imaged in fluorescence and phase contrast. The mosaic pattern
was generated and acquired using autofocusing of the transmission
channel, with custom Zeiss Visual Basic for Applications (VBA) and
Commander Module routines for the pattern generation. Large field
images were then aligned and stitched using ImageJ functions.
Authors: Archana Belle; Amos Tanay; Ledion Bitincka; Ron Shamir; Erin K O'Shea Journal: Proc Natl Acad Sci U S A Date: 2006-08-17 Impact factor: 11.205
Authors: Takayuki Sohka; Richard A Heins; Ryan M Phelan; Jennifer M Greisler; Craig A Townsend; Marc Ostermeier Journal: Proc Natl Acad Sci U S A Date: 2009-06-05 Impact factor: 11.205