Literature DB >> 24312333

Enhanced reliability and accuracy for field deployable bioforensic detection and discrimination of Xylella fastidiosa subsp. pauca, causal agent of citrus variegated chlorosis using razor ex technology and TaqMan quantitative PCR.

Ping Ouyang1, Mohammad Arif, Jacqueline Fletcher, Ulrich Melcher, Francisco Manuel Ochoa Corona.   

Abstract

A reliable, accurate and rapid multigene-based assay combining real time quantitative PCR (qPCR) and a Razor Ex BioDetection System (Razor Ex) was validated for detection of Xylella fastidiosa subsp. pauca (Xfp, a xylem-limited bacterium that causes citrus variegated chlorosis [CVC]). CVC, which is exotic to the United States, has spread through South and Central America and could significantly impact U.S. citrus if it arrives. A method for early, accurate and sensitive detection of Xfp in plant tissues is needed by plant health officials for inspection of products from quarantined locations, and by extension specialists for detection, identification and management of disease outbreaks and reservoir hosts. Two sets of specific PCR primers and probes, targeting Xfp genes for fimbrillin and the periplasmic iron-binding protein were designed. A third pair of primers targeting the conserved cobalamin synthesis protein gene was designed to detect all possible X. fastidiosa (Xf) strains. All three primer sets detected as little as 1 fg of plasmid DNA carrying X. fastidiosa target sequences and genomic DNA of Xfp at as little as 1 - 10 fg. The use of Razor Ex facilitates a rapid (about 30 min) in-field assay capability for detection of all Xf strains, and for specific detection of Xfp. Combined use of three primer sets targeting different genes increased the assay accuracy and broadened the range of detection. To our knowledge, this is the first report of a field-deployable rapid and reliable bioforensic detection and discrimination method for a bacterial phytopathogen based on multigene targets.

Entities:  

Mesh:

Substances:

Year:  2013        PMID: 24312333      PMCID: PMC3843690          DOI: 10.1371/journal.pone.0081647

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Xylella fastidiosa (Xf), a xylem limited plant pathogen, causes a large number of diseases including plum leaf scald, phony peach, pear leaf scald, alfalfa dwarf, and leaf scorch of coffee, almond, elm, sycamore, oak, maple, mulberry, and oleander, but the two most economically important are Pierce’s disease of grapevines and citrus variegated chlorosis (CVC) [1,2]. Of four subspecies, only X. fastidiosa subsp. pauca (Xfp) does not occur in the United States [3]. Xfp, categorized as a select agent until 2012, causes CVC and coffee leaf scorch (CLS). In the early 1990s, the world’s largest citrus producer, Brazil, endured an outbreak of CVC that caused serious crop losses. After this outbreak, Brazilian researchers determined the complete genomic sequence of the CVC strain (9a5c) of Xfp [2,4], making it the first plant pathogenic bacterium to be completely sequenced [5,6]. According to Mansfield et al. [7] the pathogen ranked eighth among the 10 most important plant pathogenic bacteria, based on scientific and/or economic importance. Leaves of Xfp-infected citrus trees develop chlorotic spots on leaves and produce small, hard and juiceless fruits that lack commercial value, probably due to blockage of delivery of water and nutrients by aggregation of the bacteria as well as by the xanthan-like gum that the bacteria produce [8]. Citrus is produced in tropical and subtropical climates where the relatively high temperature and moisture are favorable for production. These same climatic conditions are also very advantageous for xylophagous sharpshooter leafhoppers and spittlebugs, which are important vectors of Xfp [9-15]. Xfp is considered a threat to the citrus industry in the U. S., and the U.S. Department of Agriculture (USDA) listed it as a quarantine select agent and considered it a high consequence pathogen. Timely diagnosis of CVC in the field is a challenge since it takes twelve months to develop the symptoms after the infection [16]. In vitro culture of all strains of X. fastidiosa is labor intensive and time consuming [17]. Thus, rapid discrimination of Xfp from other X. fastidiosa strains is essential for protecting the citrus industry. As an exotic microorganism with a high risk profile, we chose Xfp for the development of an enhanced detection method. Whether this pathogen were to be introduced naturally (weather, insect vector, birds etc.), unintentionally (trade, travel, etc.), or intentionally, rapid pathogen detection and disease diagnostic assays will be critical during the initial outbreak delimitation, as well as during follow-on implementation of management activities, when decision making will require specific, accurate and rapid identification of the pathogen. PCR based techniques are generally more sensitive than immunological methods and have high specificity and powerful discriminatory capabilities. Real-time qPCR offers greater sensitivity and speed compared to endpoint PCR for the detection of target DNA [18,19]. In field settings, however, plant pathogen detection can be challenging, since thermocyclers have limited sample capacity and require electrical power. The use of a portable, battery-operated real-time qPCR platform for in-field molecular testing allows minimally trained operators to test plant and environmental samples in the absence of laboratory facilities and conditions normally required, including electricity, centrifuges, liquid nitrogen, water baths, incubators and hazardous chemicals. Several portable instruments developed for this purpose include the Smart Cycler (Cepheid, Sunnyvale, CA), the LightCycler (Roche Applied Science, Indianapolis, IN), the Razor Ex Biodetection System (Razor Ex; Idaho Technology Inc.), and the Bio-Seeq instrument (Smiths Detection, Edgewood, MD). In 2002, Schaad et al. used the Smart Cycler system to detect X. fastidiosa in sap from asymptomatic grapevines in two hours [20]. The Smart Cycler also has been applied in the identification of Phytophthora ramorum, which causes sudden oak death [21], and the Aphthovirus that causes foot-and-mouth disease [22]. The Razor Ex was designed originally to allow first responders and front line military operations to identify biological threat organisms on-site. The Razor Ex system offers ready-to-use, freeze-dried reagent pouches, barcode-based PCR cycling program upload and Bluetooth capabilities for wireless data transmission. Due to fast cycling parameters, Razor Ex takes about only 30-40 minutes compared to a traditional PCR using the ABI 7300/7500 thermocycler (Applied Biosystems, Foster City, CA) that takes about 100 minutes. A Razor Ex based method also detected influenza A viruses near the patient’s location and with sensitivity and specificity similar to those of the ABI 7300 [23-25]. Developing an assay for a select agent presents further challenges. We here report the development of such an assay for a pathogen that was on the select agent list during the course of development of the assay and should thus serve as a model for developing such future field detection procedures for regulated organisms. Specifically, field deployable, rapid TaqMan qPCR and Razor Ex protocols for reliable, sensitive, and accurate detection of X. fastidiosa and Xfp based on three discriminatory genome segments. This detection system will enhance investigative capability for ecological, agriculture and/ or biosecurity and microbial forensics.

Materials and Methods

Ethics statement

All samples included in the exclusivity and inclusivity panels of this research were used with permission from concerned persons, scientists and diagnosticians who provided these samples. This research did not involve endangered or protected species.

Sources of inclusivity and exclusivity panels

Infected plants from which genomic DNA was extracted for use in the inclusivity and/or exclusivity panels are shown in Table 1. Microbes included in the exclusivity panel are presented in Table 2. Members of the plant exclusivity panel, including Medicago sativa, Arabidopsis thaliana, Hordeum vulgare, Zea mays, Gossypium hirsutum, Lens culinaris, Avena sativa, Petroselinum crispum, Arachis hypogaea, Solanum tuberosum, Secale cereale, Sorghum bicolor, Glycine max, Helianthus annuus, Nicotiana tabacum, Lycopersicon esculentum and Triticum aestivum, were grown in a BSL-2 greenhouse at the Noble Research Center, Oklahoma State University, Stillwater, OK. Other members of the plant exclusivity panel, including Vitis aestivalis, Prunus persica, Carya illinoinensis, were obtained from the Cimarron Valley Research Station, Perkins, OK; Nephrolepis exaltata was collected from an indoor garden at Oklahoma State University; Citrus sinensis and Rosa species were obtained from F. M. Ochoa-Corona, Oklahoma State University. Foliar tissues of each plant species were used for DNA isolation except C. sinensis from which rind was used. Jiffy soil mix (Ferry Morse Seed Co., Fulton, KY) was also included in exclusivity panel.
Table 1

DNA sources used for validation of Xylella fastidiosa and Xylella fastidiosa subsp. pauca specific primer and probe sets.

Sample code Acronym of target pathogen Host plant/insect Origin Source Ct values with specific primer and probe sets
Xf.CVC.fim1(SD) Xf.CVC.pib4(SD) Xf.csp6(SD)
Xf_k Xf Grape Texas, USAB. Bextine, UT Tyler, TX--22.9(0.12)
Xf_g Xf Grape Texas, USAB. Bextine, UT Tyler, TX--30.4(0.25)
TX PD1 Xf GrapeTexas, USAB. Bextine, UT Tyler, TX--25.06(0.26)
TX PD2 Xf GrapeTexas, USAB. Bextine, UT Tyler, TX--21.22(0.06)
F12 Xff SharpshooterTexas, USAB. Bextine, UT Tyler, TX--32.29(0.28)
F15 Xff SharpshooterTexas, USAB. Bextine, UT Tyler, TX--28.56(0.24)
M1 Xfm SharpshooterTexas, USAB. Bextine, UT Tyler, TX--36.64(0.68)
M2 Xfm SharpshooterTexas, USAB. Bextine, UT Tyler, TX--35.13(1.08)
200901617 Xf Grape Oklahoma, USA J. Olsen, PDIDL, OSU, OK--22.5(0.02)
20092259 Xf Grape Oklahoma, USAJ. Olsen, PDIDL, OSU, OK--29.7(0.06)
200901779 Xf Grape Oklahoma, USAJ. Olsen, PDIDL, OSU, OK- -21.0(0.06)
200902412 Xf Grape Oklahoma, USAJ. Olsen, PDIDL, OSU, OK- -22.50(0.07)
200902348 Xf Grape Oklahoma, USAJ. Olsen, PDIDL, OSU, OK- -30.97(0.31)
201101794 Xf Grape Oklahoma, USAJ. Olsen, PDIDL, OSU, OK- -29.0(0.26)
200901990 Xf Grape Oklahoma, USAJ. Olsen, PDIDL, OSU, OK- -33.72(0.33)
C178 xf Grape Oklahoma, USAJ. Olsen, PDIDL, OSU, OK- -19.6(0.17)
200901994 Xf Grape Oklahoma, USAJ. Olsen, PDIDL, OSU, OK--21.4(0.04)
200902414 Xf Grape Oklahoma, USAJ. Olsen, PDIDL, OSU, OK--27.2(0.07)
C121D Xf Oak Oklahoma, USAJ. Olsen, PDIDL, OSU, OK--17.0(0.16)
C85D Xf Oak Oklahoma, USAJ. Olsen, PDIDL, OSU, OK--18.97(0.19)
C177D Xf Elm Oklahoma, USAJ. Olsen, PDIDL, OSU, OK--25.1(0.11)
C88D Xf Elm Oklahoma, USAJ. Olsen, PDIDL, OSU, OK--28.94(0.34)
C173D Xf Mulberry Oklahoma, USAJ. Olsen, PDIDL, OSU, OK--21.52(0.18)
C83D Xf Mulberry Oklahoma, USAJ. Olsen, PDIDL, OSU, OK--19.24(0.17)
Temecula* Xft GrapeCalifornia, USAATCC, Manassas, VA--13.6(0.31)
CVC50024* Xfp CitrusBrazilD. Luster, USDA-ARS, FDWSRU, Fort Detrick, MD 18.8(0) 20.2(0.03) 16.6(0.02)
CVC50031* Xfp CitrusBrazilD. Luster, USDA-ARS, FDWSRU, Fort Detrick, MD18.5(0.06) 22.2(0.1) 18.6(0.07)

Genomic DNA from pure culture; FDWSRU = Foreign Diseases and Weeds Research Unit; PDIDL = Plant Disease Diagnostic Laboratory; ATCC = American Type Culture Collection; OSU = Oklahoma State University; SD = replicates Ct standard deviation; - = no amplification (negative); Xf = Xylella fastidiosa; Xfp = Xylella fastidiosa subsp. pauca; Xft = Xylella fastidiosa Temecula; Xfm = Xylella fastidiosa subsp. multiplex; Xff = Xylella fastidiosa subsp. fastidiosa.

Table 2

Members of microbial panel used for validation of primer and probe sets Xf.CVC.fim1, Xf.CVC.pib4 and Xf.Csp6 specific for Xylella fastidiosa subsp. pauca and Xylella fastidiosa in general.

MicrobesSpecific primers and probes
Source
Xf.CVC.fim1Xf.CVC.pib4Xf.Csp6
Burkholderia cepacia (ATCC 25416)---ATCC, Manassas, VA
Pseudomonas syringae pv. syringae (ATCC 33291)---ATCC, Manassas, VA
Escherichia coli (1472)---S. Gilliland, OSU, Stillwater, OK
Pseudomonas fluorescens (ATCC 13525)---ATCC, Manassas, VA
Pseudomonas syringae pv. phaseolicola (1448a)---C. Bender, OSU, Stillwater, OK
Phytophthora capsici ---S. M. Marek, OSU, Stillwater, OK
Xanthomonas vesicatoria (ATCC 35937)---ATCC, Manassas, VA
Ralstonia solanacearum (ATCC 11696)---ATCC, Manassas, VA
Erwinia tracheiphila ---B. Bruton, USDA-ARS, Lane, OK
Xanthomonas citri subsp. Citri (Xcc A 306)---N. Jalan, UF, Lake Alfred, FL
Xanthomonas citri subsp. Citri (Xcc Aw 12879)---N. Jalan, UF, Lake Alfred, FL
Xanthomonas citri subsp. Citri (Xcc A 270)---N. Jalan, UF, Lake Alfred, FL
Xanthomonas axonopodis pv.citrumela (acm FL1)---N. Jalan, UF, Lake Alfred, FL
Phymatotrichopsis omnivora*---F. M. Ochoa-Corona, OSU, Stillwater, OK
Pythium aphanidermatum ---C. Garzon, OSU, Stillwater, OK
Non-template control (water)---Ambion, Austin, TX
Positive control**+++Generated in NIMFFAB laboratory through TOPO-TA cloning of target sequence

- = No amplification (negative); + = amplification (positive); *DNA from alfalfa infected with P. omnivora; **plasmid DNA carrying the target gene sequence; ATCC = American Type Culture Collection; OSU = Oklahoma State University; UF = University of Florida

Genomic DNA from pure culture; FDWSRU = Foreign Diseases and Weeds Research Unit; PDIDL = Plant Disease Diagnostic Laboratory; ATCC = American Type Culture Collection; OSU = Oklahoma State University; SD = replicates Ct standard deviation; - = no amplification (negative); Xf = Xylella fastidiosa; Xfp = Xylella fastidiosa subsp. pauca; Xft = Xylella fastidiosa Temecula; Xfm = Xylella fastidiosa subsp. multiplex; Xff = Xylella fastidiosa subsp. fastidiosa. - = No amplification (negative); + = amplification (positive); *DNA from alfalfa infected with P. omnivora; **plasmid DNA carrying the target gene sequence; ATCC = American Type Culture Collection; OSU = Oklahoma State University; UF = University of Florida

DNA isolation from plants and microbes

Genomic DNAs of X. fastidiosa and infected plant/insect samples were obtained from the American Type Culture Collection (Manassas, VA) and from governmental and university laboratories (Table 1). Genomic DNA from plants was extracted using a DNeasy Plant Mini Kit (Qiagen, Valencia, CA) and bacterial DNA (Table 2) was extracted using the Qiagen DNeasy Blood & Tissue Kit (Qiagen) following the manufacturer’s instructions. Crude DNA from sharpshooters (Homalodisca vitripennis) was isolated using prepGEM™ (ZyGEM Corporation Ltd, Hamilton, New Zealand) following the manufacturer’s protocol. The concentrations of total genomic DNAs were determined using a NanoDrop v.2000 spectrophotometer (Thermo Fisher Scientific Inc., Worcester, MA). For field application, isolation of X. fastidiosa DNA from infected plant samples (grape and oak; two samples each) to be tested with the Razor Ex was done using the Dynabeads-based modified method developed for the fungus P. omnivora [25] using Dynabeads DNA Direct Universal Kit (Invitrogen, Carlsbad, CA). Briefly, 10 to 30 mg infected foliar tissues were macerated in 100 to 150 µl Tris-EDTA (TE) buffer (Promega, Madison, WI). The mixture of 40 µl of macerated supernatant and 200 µl of Dynabeads was incubated for 5 min at RT. Tubes containing this mix were placed in a magnetic rack to retain the beads while the liquid was discarded. The beads were rinsed twice with wash buffer. Manufacturer provided suspension buffer was added to suspend DNA.

Primer and probe design

The genes for fimbrillin, periplasmic iron-binding protein, and cobalamin were targeted. The first two were used for specific detection of Xfp and the third for specific detection of all strains of X. fastidiosa. Three optimal primer and probe sets were designed following the parameters described by Arif and Ochoa-Corona [26] as shown in Table 3. The complete genome of Xfp 9a5c (accession number AE003849), retrieved from the NCBI GenBank database (), was used to subtract the Xfp specific sequences using MUMmer software [27]. Two primer and probe sets, Xf.CVC.fim and Xf.CVC.pib, specific to Xfp were designed using Primer3 [28]. The cobalamin synthesis protein gene sequence (accession number CP002165) was retrieved from the GenBank database and a primer set, Xf.csp6, was designed from it to detect all strains of X. fastidiosa. The primer pair Xf.csp.6F/Xf.csp.6R and the Xf.csp.6 probe were aligned with whole genome sequences of X. fastidiosa subsp. fastidiosa GB514 (accession number CP002165), X. fastidiosa M23 (accession number CP001011), X. fastidiosa M12 (accession number CP000941), X. fastidiosa Temecula1 (accession number AE009442), and Xfp 9a5c (accession number AE0003849), all available in GenBank. Primer thermodynamics, internal structures, and self-dimer formation were examined in silico with mFold [29]. The specificity was confirmed in silico by screening the primer and probe sequences with BLASTn, available from the GenBank nucleotide database [30] (Table 3). Primers and double quencher probes-linked 5’ 6-carboxyfluorescein/ZENTM/3’ Iowa Black FQ (5’ 6-FAMTM/ZENTM/3’ IB®FQ) were synthesized by IDT (Integrated DNA Technologies, Inc., Coralville, IA).
Table 3

Specific primers and probes used for PCR amplification of Xylella fastidiosa and Xylella fastidiosa subsp. pauca.

Primer and probe nameAcronym of target pathogenPrimer/probe sequence (5’-3’)Targeted gene Amplicon size (bp)G + C% *ΔG NCBI BLASTn E-value
Xf.CVC.fim1F Xfp TGACCTGGATATGTATTACGAACCT Fimbrillin109400.92e-04
Xf.CVC.fim1R TAGACGCACGGTGGTTTTGT 501.00.067
Xf.CVC.fim1P TGGTGTTTGAGGGAGGGCATCTGT 540.97e-04
Xf.CVC.pib4F Xfp CATTCAAGGTTCCAACGACTT Periplasmic iron-binding protein81430.90.025
Xf.CVC.pib4R GGTCACTTTAGTTCCAGGATGC 500.20.006
Xf.CVC.pib4P CATGTTTGCTTTGGTGATTGCTGATT 380.96e-05
Xf.Csp6F Xf CCCATTACGCTTCAACCATT Cobalamin synthesis protein93450.20.067
Xf.Csp6R CCCAATCCATACGACTTGCT 500.60.067
Xf.Csp6P GGTGTGATTCGCAGCAAGGGC 620.80.025

ΔG value from plot calculated by mFOLD at 60°C; Xf = Xylella fastidiosa; Xfp = Xylella fastidiosa subsp. pauca

ΔG value from plot calculated by mFOLD at 60°C; Xf = Xylella fastidiosa; Xfp = Xylella fastidiosa subsp. pauca

PCR and qPCR amplification

Preliminary PCR assays were carried out in an Eppendorf thermal cycler (Eppendorf, Hauppauge, NY) using 20 μl reaction mixtures containing 10 μl GoTaq Green Master Mix (Promega), 1 μl of each forward and reverse primer from working stock of 5 µM, 1 μl of template DNA, and 7 μl nuclease free water. The cycling parameters consisted of 35 cycles as follows: Initial denaturation for 3 min at 94 °C followed by denaturation at 94 °C for 20 s, annealing at 56 °C for 30 s, extension 72 °C for 30 s, and final extension at 72 °C for 3 min. Plasmid DNA containing the target fragment and nuclease free water (non-template) were used as positive and negative controls, respectively, in each PCR amplification. Amplified PCR products were electrophoresed in a 1.5 % agarose gel in 1X TAE buffer, and amplicon sizes were estimated using 1kb plus ladders (Invitrogen). The qPCR assays were performed in a Rotor-Gene 6000 thermocycler (Corbett Research, Sydney, Australia) and the results were analyzed using the Rotor-Gene 6000 series software 1.7 (Built 87). qPCR assays were carried out in 20 μl reaction mixtures containing 10 μl of Platinum qPCR SuperMix-UDG (Invitrogen), 0.8 μl from working stock of 5 µM of each forward and reverse primer, 0.8 μl probe from working stock of 5 µM, 0.3 mg per ml (0.12 μl) BSA (Invitrogen), 1 μl of template DNA, and 6.48 μl of nuclease free water. Rotor-Gene qPCR cycling conditions were: two initial holds, each for 2 min at 50 °C and 95 °C, followed by 40 cycles at 95 °C for 15 s and 60 °C for 1 min. A minimum of three dilutions of plasmid DNA (positive control; carrying the target gene sequence) were used to generate a standard curve and negative (non-template; water) controls were included in each round of qPCR amplification. Each reaction with each member of inclusivity and exclusivity panel was performed in three replicates (same reaction mixture in three tubes) using each primer and probe set.

Razor Ex amplification

Amplification with each primer set was carried out in 150 μl reaction mixtures containing 75 μl of Platinum® Quantitative PCR SuperMix-UDG, 6.0 μl of each forward (biotinylated) and reverse primer from working stock of 5 µM, 6.0 μl probe from working stock of 5 µM, 4 μl (infected plant DNA) or 1 μl (pathogen genomic DNA) of template and nuclease free water to make up the volume. Positive (plasmid DNA; carrying the target gene sequence) and negative (non-template; water) controls were included in each Razor Ex amplification. Short cycling parameters included one initial hold for 2 min at 50°C, a first cycle at 94°C for 4 min and 60°C for 15 sec followed by 54 cycles at 91°C for 3 sec and 60°C for 15 sec. The PCR cycling program was uploaded using a barcode (Figure 1). The assays were performed in a Razor Ex BioDetection System.
Figure 1

Bar code generated to upload the fast PCR cycling program for detection of Xylella fastidiosa and Xylella fastidiosa subsp. pauca in Razor Ex BioDetection system.

Real time qPCR sensitivity assays

The detection limits of all three primer and probe sets was determine by performing four sensitivity assays with each set of primer and probe in the Rotor-Gene 6000 thermocycler. Ten-fold serial dilution of plasmid or genomic DNA (Xfp) was used at 10 ng to 1 fg per reaction. For each spiked or mixed assay, 1 µl (per reaction) of rind extract (1 ml of TE buffer was used to macerate healthy orange rind and clarified by a 2 min centrifugation at 14,000 rpm; the supernatant was used) was added into serially diluted Xfp genomic DNA. A sensitivity assay spiked with sharpshooter DNA was performed by adding 1 µl (10 ng/µl) crude DNA of sharpshooter into serially diluted Xfp genomic DNA. Each reaction was performed in three replicates.

Positive controls

Positive controls carrying target gene segments of Xfp and Xf were generated for each primer set targeting three different genes. The amplicons generated using endpoint PCR were eluted from the agarose gel using Quantum Prep Freeze 'N Squeeze Spin Columns (Bio-Rad, Hercules, CA) and inserted into a plasmid pCR2.1-TOPO vector (TOPO-TA Cloning kit; Invitrogen). QIAprep Spin Miniprep Kit (Qiagen) was used to purify plasmid DNA carrying the target sequence from overnight bacterial cultures for each primer set. Specific PCR amplicons for each target gene from isolated plasmid DNAs were sequenced by the Oklahoma State University Recombinant DNA/Protein Resource Facility using M13F and M13R primers. BLASTn tool of NCBI was used to check amplicons sequences against the GenBank nucleotide database.

Results

The two primer sets specific for Xfp and the primer set for general detection of X. fastidiosa as well as all respective probes met the desired 100% query coverage and 100% identity after an alignment using BLASTn in the GenBank nucleotide database (Table 3). All primers and probes had ΔG ≤ 1.0 at 60°C (Table 3). To maximize signal and minimize background, the double-quenched probes contained a 5’ FAM fluorophore, a 3’ IBFQ quencher, and an internal ZEN quencher.

Real time qPCR protocol validation

All three primer and probe sets (Table 3) were designed to perform in endpoint PCR, qPCR, and the field-deployable Razor Ex. Primer and probe specificity was tested against a plant exclusivity panel (described above) and near-neighbor microbial panel (Table 2), and broad range detection of primer/probe set Xf.csp6 was tested against an inclusivity panel (Table 1) of X. fastidiosa genomic DNA from purified Xf isolates and infected plants and sharpshooters. Genomic DNA of only two Xfp isolates was available, for use in the inclusivity panel for primer and probe sets, Xf.CVC.fim1 and Xf.CVC.pib4, because Xfp was classified as a select agent at the time of these experiments. The primer and probe sets Xf.CVC.fim1, Xf.CVC.pib4 and Xf.csp6 showed no cross reactivity with any member of the exclusivity panel, and generated the expected 109, 81 and 93 bp PCR amplicons, respectively. The primer/probe sets Xf.CVC.fim1, and Xf.CVC.pib4 amplified only from Xfp while set Xf.csp6 amplified all X. fastidiosa (Table 1). To further confirm the specificity, the amplified products were cloned, sequenced, and assessed using BLASTn against the GenBank database. All the sequences showed highest similarity with the corresponding pathogen. Twenty symptomatic plants, three genomic DNAs from Xfp and X. fastidiosa Temecula, and four sharpshooters infected with X. fastidiosa subsp. multiplex and X. fastidiosa subsp. fastidiosa tested positive with primer/probe set Xf.csp6, while only Xfp isolates were positive using primer/probe sets Xf.CVC.fim1 and Xf.CVC.pib4 (Table 1).

qPCR sensitivity and spiked assays

Primer sets Xf.CVC.fim1, Xf.CVC.pib4, and Xf.csp6 detected as little as 1 fg of plasmid DNA carrying X. fastidiosa target sequences at cycle threshold (Ct) values of 27.92, 30.19 and 29.55, respectively (Table 4; Figure 2). Almost identical Ct values, ranging from 8.37 to 9.73, were obtained from 10 ng of plasmid DNA. The obtained linear graphs and standard curve values for each primer-probe set used to amplify corresponding positive control, suggest optimal reaction efficiency (Table 4; Figure 2). The detection limit of primer-probe set Xf.CVC.fim1 reached as little as 1 fg; (Table 4; Figure 3) compared to those of primer and probe sets Xf.CVC.pib4 and Xf.csp6 that detected as little as 10 fg with Xfp genomic DNA (Table 4; Figure 3). A small difference in sensitivity and a variation among the replicates at lower concentration (especially at 10 fg and below) of genomic DNA was observed when a Xfp genomic DNA sample was mixed separately with extracts of orange rind and a crude sharpshooter DNA preparation (Table 4; Figure 3). Primer and probe set Xf.CVC.fim1 was able to detect down to 1 fg of genomic DNA of Xfp (CVC50031) mixed with extracts of orange rind and crude sharpshooter DNA but showed a variation in Ct values among the replicates (Figure 3). To comparing standard graphs generated for all the three primer and probe sets, a manual normalized fluorescence value of 0.2 was used. Generated standard graph values suggested that orange rind extract and crude sharpshooter DNA have little or no inhibitory effect on qPCR sensitivity when the spiked and non-spiked sensitivity assays were performed using all three primer/probe sets (Table 4).
Table 4

Average Ct values of sensitivity and spiked assays using primer/probe sets Xf.CVC.fim1, Xf.CVC.pib4 and Xf.csp6.

Template conc. per reaction*Number of genomic DNA copiesPlasmid DNA
Genomic DNA
Genomic DNA spiked with rind extract
Genomic DNA spiked with crude sharpshooter DNA
Xf.CVC.Xf.CVC.Xf.csp6Xf.CVC.Xf.CVC.Xf.csp6Xf.CVC.Xf.CVC.Xf.csp6Xf.CVC.Xf.CVC.Xf.csp6
fim1pib4fim1pib4fim1pib4fim1pib4
R2 --0.9910.9990.9980.9960.9940.9970.9960.9850.9800.9980.9910.991
Y ---2.9-2.92-3.04-3.39-3.17-3.49-3.48-3.40-3.8-3.31-3.14-3.39
Ex --1.211.21.130.971.070.940.940.970.831.011.080.97
Ct(SD) values^ 10 ng3.46x106 8.37(0.06) 9.73(0.08) 8.41(0.02) 12.43(0.23) 16.03(0.27) 14.84(0.08) 12.91(0.36) 15.51(0.13) 14.52(0.12) 11.79(0.28) 15.49(0.10) 14.85(0.14)
1 ng3.46x105 9.98(0.02) 12.83(0.02) 11.16(0.07) 16.06(0.04) 19.82(0.35) 18.15(0.12) 16.53(0.09) 18.98(0.27) 17.98(0.12) 15.12(0.09) 18.94(0.09) 18.29(0.25)
100 pg3.46x104 12.17(0.02) 15.35(0.06) 13.56(0.08) 18.78(0.69) 23.39(0.18) 21.56(0.35) 20.06(0.04) 22.84(0.37) 21.40(0.17) 18.67(0.10) 22.4(0.37) 21.71(0.30)
10 pg3.46x103 15.07(0.03) 18.22(0.04) 16.77(0.06) 22.95(0.42) 26.43(0.21) 25.07(0.21) 23.68(0.26) 27.2(0.66) 26.62(0.93) 21.88(0.12) 25.38(0.17) 25.30(0.81)
1 pg3.46x102 18.48(0.15) 21.32(0.15) 20.02(0.03) 26.16(0.32) 29.23(0.35) 28.41(0.10) 27.24(0.01) 30.16(1.20) 31.67(0.71) 25.49(0.28) 29.17(0.38) 29.37(0.25)
100 fg3.46x101 21.55(0.03) 24.19(0.09) 22.92(0.13) 29.02(0.53) 32.43(0.16) 31.69(0.11) 31.13(0.25) 31.84(0.28) 33.57(0.25) 28.54(0.21) 31.90(0.16) 31.77(0.29)
10 fg 3.46x10°25.00(0.14) 27.39(0.04) 26.42(0.09) 33.19(0.43) 35.22(0.88) 36.06(0.78) 34.21(0.79) 36.24(0.71) 36.17(0.29) 31.59(013) 33.92(1.07) 34.97(1.37)
1 fg3.46x10-1 27.92(0.11) 30.20(0.33) 29.55(0.14) 36.53(0.90) NANA36.47(0.81) NANA34.89(1.02)$ NANA
NTC-NANANANANANANANANANANANA

*Number of copies were calculated according to the 2.679 Mb genome size of Xylella fastidiosa subsp. pauca (9a5c; GenBank accession number AE003849) using online calculator (); ^average Ct (threshold cycle) value of three replicates; mean of only two replicates; SD = standard deviation; NA = no amplification, R2= linear correlation; Ct = cycle threshold; Ex = reaction efficiency; Y = slop; NTC = non template control (water). Plasmid DNA concentration includes the total mass of plasmid DNA containing the target gene sequence of the corresponding primer/probe set. Plant-spiked assays with rind extract contain 1 µl of rind extract per reaction H. vitripennis-spiked assays contain 10 ng crude sharpshooter DNA per reaction.

Figure 2

Standard graph showing 10-fold serial dilutions of plasmid DNA (carrying the target gene sequence of corresponding primer set) using primer and probe sets.

Xf.CVC.fim1 (A), Xf.CVC.pib4 (B), and Xf.csp6 (C). R2 = linear correlation; Ex = reaction efficiency; Y = slope.

Figure 3

Standard curves and graphs generated using 10-fold diluted genomic DNA and genomic DNA mixed with orange rind extract or insect crude DNA.

A1/A2, A3/A4 & A5/A6: Graphs/standard curve generated using primer and probe set Xf.CVC.fim1 with genomic DNA, genomic DNA mixed with orange rind extract and genomic DNA mixed with insect crude DNA, respectively; B1/B2, B3/B4 & B5/B6: Graphs/standard curve generated using primer/ probe set Xf.CVC.pib4 with genomic DNA, genomic DNA mixed with orange rind extract and genomic DNA mixed with insect crude DNA, respectively; C1/C2, C3/C4 & C5/C6: Graphs/standard curve generated using primer/ probe set Xf.csp6 with genomic DNA, genomic DNA mixed with orange rind extract and genomic DNA mixed with insect crude DNA, respectively.

*Number of copies were calculated according to the 2.679 Mb genome size of Xylella fastidiosa subsp. pauca (9a5c; GenBank accession number AE003849) using online calculator (); ^average Ct (threshold cycle) value of three replicates; mean of only two replicates; SD = standard deviation; NA = no amplification, R2= linear correlation; Ct = cycle threshold; Ex = reaction efficiency; Y = slop; NTC = non template control (water). Plasmid DNA concentration includes the total mass of plasmid DNA containing the target gene sequence of the corresponding primer/probe set. Plant-spiked assays with rind extract contain 1 µl of rind extract per reaction H. vitripennis-spiked assays contain 10 ng crude sharpshooter DNA per reaction.

Standard graph showing 10-fold serial dilutions of plasmid DNA (carrying the target gene sequence of corresponding primer set) using primer and probe sets.

Xf.CVC.fim1 (A), Xf.CVC.pib4 (B), and Xf.csp6 (C). R2 = linear correlation; Ex = reaction efficiency; Y = slope.

Standard curves and graphs generated using 10-fold diluted genomic DNA and genomic DNA mixed with orange rind extract or insect crude DNA.

A1/A2, A3/A4 & A5/A6: Graphs/standard curve generated using primer and probe set Xf.CVC.fim1 with genomic DNA, genomic DNA mixed with orange rind extract and genomic DNA mixed with insect crude DNA, respectively; B1/B2, B3/B4 & B5/B6: Graphs/standard curve generated using primer/ probe set Xf.CVC.pib4 with genomic DNA, genomic DNA mixed with orange rind extract and genomic DNA mixed with insect crude DNA, respectively; C1/C2, C3/C4 & C5/C6: Graphs/standard curve generated using primer/ probe set Xf.csp6 with genomic DNA, genomic DNA mixed with orange rind extract and genomic DNA mixed with insect crude DNA, respectively.

Razor Ex BioDetection System

Empty pouches filled with TaqMan qPCR reagents were used in place of the freeze-dried reagent pouches provided by the manufacturer. Only primer/probe set Xf.csp6 was used to detect X. fastidiosa from infected plant samples with the Razor Ex system. The Primer sets, Xf.CVC.fim1 and Xf.CVC.pib4 were not tested with samples infected with Xfp due to the categorization of Xfp as select agent in the USA at the time this research was conducted. However, all three primer and probe sets were tested using genomic Xfp DNA (isolate CVC50031) using the Razor Ex system and all were positive (Figure 4) with estimated Ct values of 24 (Xf.CVC.fim1), 24 (Xf.CVC.pib4) and 20 (Xf.csp6). All four infected plant samples (from grape and oak) were positive for X. fastidiosa using primer and probe set Xf.Csp6 (Figure 5) with estimated Ct values from 33-35. The reactions were performed in only one or two replicates due to the limited number of well slots (only 12) in the Razor Ex pouch. Razor Ex amplification and template DNA preparation results were reproducible. The entire protocol, from DNA extraction to final detection, takes approximately 30 min with no need for laboratory equipment.
Figure 4

Razor Ex BioDetection system graph obtained after amplification of plasmid DNA (carrying the target gene sequence of corresponding primer set) and Xylella fastidiosa subsp. pauca genomic DNA (CVC50031) using primer and probe sets Xf.CVC.fim1, Xf.CVC.pib4 and Xf.csp6.

A1, B1 and C1 are positive controls with estimated Ct values of 23, 26 and 20 for primer/probe sets Xf.CVC.fim1, Xf.CVC.pib4 and Xf.csp6, respectively. X. fastidiosa genomic DNA tested in two replicates with primer/probe sets Xf.CVC.fim1 (A2 & A3), Xf.CVC.pib4 (B2 & B3) and Xf.csp6 (C2 & C3) with estimated Ct value of 24, 24 and 20, respectively. N shows the non-template controls (water) for each primer/probe set.

Figure 5

Graph from the Razor Ex BioDetection system after amplification of plasmid DNA (carrying the target gene sequence of corresponding primer set) and Xylella fastidiosa infected grape and oak plant samples (two samples for each plant), using the primer and probe set Xf.csp6.

A: positive controls; estimated Ct value 24; B: X. fastidiosa infected grape (sample G1 and G2) and oak (sample O1 and O2) genomic DNA; estimated Ct values 33-35; N: non-template control (water). Each reaction was performed in two replicates.

Razor Ex BioDetection system graph obtained after amplification of plasmid DNA (carrying the target gene sequence of corresponding primer set) and Xylella fastidiosa subsp. pauca genomic DNA (CVC50031) using primer and probe sets Xf.CVC.fim1, Xf.CVC.pib4 and Xf.csp6.

A1, B1 and C1 are positive controls with estimated Ct values of 23, 26 and 20 for primer/probe sets Xf.CVC.fim1, Xf.CVC.pib4 and Xf.csp6, respectively. X. fastidiosa genomic DNA tested in two replicates with primer/probe sets Xf.CVC.fim1 (A2 & A3), Xf.CVC.pib4 (B2 & B3) and Xf.csp6 (C2 & C3) with estimated Ct value of 24, 24 and 20, respectively. N shows the non-template controls (water) for each primer/probe set.

Graph from the Razor Ex BioDetection system after amplification of plasmid DNA (carrying the target gene sequence of corresponding primer set) and Xylella fastidiosa infected grape and oak plant samples (two samples for each plant), using the primer and probe set Xf.csp6.

A: positive controls; estimated Ct value 24; B: X. fastidiosa infected grape (sample G1 and G2) and oak (sample O1 and O2) genomic DNA; estimated Ct values 33-35; N: non-template control (water). Each reaction was performed in two replicates.

Discussion

Xfp CVC is a threat to the U.S. citrus industry. We developed and validated a field deployable, reliable and sensitive Razor Ex and qPCR assays for detection between Xfp and X. fastidiosa, using three primer and probe sets targeting the genes encoding fimbrillin, periplasmic iron-binding protein, and cobalamin. In biosecurity, quarantine and microbial forensics, assay specificity, accuracy and reliability are critical. The use of a multigene format maximizes reliability, specificity and broad range detection and minimizes the chances of false negative and positive results because each targeted gene-segment serves as an internal control for the other targeted gene-segments [25]. Two primer and probe sets specific for Xfp, selected after in silico evaluation, targeted genes encoding fimbrillin and a periplasmic iron-binding protein, and one set specific to all X. fastidiosa strains targeted the cobalamin synthesis gene. The three primer and probe sets were highly specific for their targets, and there was no cross reactivity with any other species in the exclusivity panels, which included important crops, vegetables, flowers, grasses, fruit trees and near neighbor microorganisms (Table 2). Primer and probe set Xf.csp6 detected twenty symptomatic X. fastidiosa-infected grape, oak, elm and mulberry plant samples collected from Texas and Oklahoma that did not carry the Xfp strain but were presumptively infected with Xfp closely related species, X. fastidiosa subsp. multiplex (causing agent of scorch disease in peach, almond and oaks) and X. fastidiosa subsp. fastidiosa (causing almond leaf scorch and Pierce’s disease of grapes) [3], while primer/probe sets Xf.CVC.fim1 and Xf.CVC.pib4 showed no reaction with these samples (Table 1). The primer-probe sets Xf.CVC.fim1 and Xf.CVC.pib4 detected the Xfp isolates as expected. Xylella fatidiosa Temecula was also not amplified using the Xf.CVC.fim1 and Xf.CVC.pib4 primer and probe set but amplified using primer and probe set Xf.csp6 (Table 1). Primer and probe sets Xf.CVC.fim1, Xf.CVC.pib4 and Xf.csp6 showed high sensitivity and efficiency, detecting as little as 1 fg of plasmid DNA and 1 fg (Xf.CVC.fim1) to 10 fg (Xf.CVC.pib4 and Xf.csp6) of Xfp genomic DNA. When genomic DNA from Xfp was mixed with extracts of orange rind and sharpshooter crude DNA, primer and probe set Xf.CVC.fim1 showed slight variation in their replicates, but only at ≤10 fg, indicating that orange rind and sharpshooter crude DNA cause little or no inhibition of qPCR sensitivity. Arif et al. [25], working with cotton leaf and soil extracts in PCR reactions containing genomic DNA of Phymatotrichopsis omnivora, also observed small differences among Ct values. However, they also indicated low reaction efficiency of 0.69 and 0.76 when primer set PoRPB2-2 was tested against P. omnivora genomic DNA spiked with cotton and soil extracts, respectively. Due to restrictions in the availability of Xfp infected plant samples, only the primer and probe set Xf.csp6, was tested with infected plant samples for pathogen detection using the Razor Ex. However, all three primer-probe sets were tested and validated with Xfp genomic DNA using the Razor Ex for on-field application. Compared to other on-site PCR instruments, the Razor Ex can be more easily transported because of its compact size and light weight (11 lb compared to the SmartCycler 74 lb) and was specifically designed for very rapid thermocycling. To perform the assays with these rapid cycling conditions and regular TaqMan reagents is not possible using traditional qPCR machines. The PCR cycling parameters can be loaded through barcodes (Figure 1) to operate the Razor EX means that the assay can also be used by other end users through direct scan from this publication. Commercially available Razor Ex pouches contain lyophilized PCR reagents to minimize contamination and circumvent cold storage. Because one aim of this research was to develop primers useful in different formats, we introduced commercially available TaqMan PCR components into empty pouches with disposable syringes. The entire assay required about 30 minutes, including approximately 10 minutes for sample preparation (DNA extraction) and 20 to 25 minutes for final detection. For further confirmation of the results for microbial forensics application, the biotinylated forward primer was used in Razor Ex to capture the amplified fragment using streptavidin magnetic beads, if required. Arif et al. [25] has demonstrated that biotinylated primer has no adverse effect on PCR amplification and sensitivity. The detection performances of the Razor Ex system and standard real-time qPCR technology (ABI 7300) were compared for specific detection of the causal agents of anthrax, brucellosis, tularemia, and plague [23] as well as influenza A viruses [24]. In our hands, the Razor Ex detected P. omnivora [25], High plains virus [31], Xfp and Xf with high assay specificity. The system generates reliable results and can be applied to phyto-sanitary diagnosis, in-field pathogen detection, and other applications in biosecurity and microbial forensics. Our results provide the framework for future development and validation of similar assays for other bacterial plant pathogens of high consequence.
  22 in total

1.  Basic local alignment search tool.

Authors:  S F Altschul; W Gish; W Miller; E W Myers; D J Lipman
Journal:  J Mol Biol       Date:  1990-10-05       Impact factor: 5.469

Review 2.  Top 10 plant pathogenic bacteria in molecular plant pathology.

Authors:  John Mansfield; Stephane Genin; Shimpei Magori; Vitaly Citovsky; Malinee Sriariyanum; Pamela Ronald; Max Dow; Valérie Verdier; Steven V Beer; Marcos A Machado; Ian Toth; George Salmond; Gary D Foster
Journal:  Mol Plant Pathol       Date:  2012-06-05       Impact factor: 5.663

Review 3.  Living in two worlds: the plant and insect lifestyles of Xylella fastidiosa.

Authors:  Subhadeep Chatterjee; Rodrigo P P Almeida; Steven Lindow
Journal:  Annu Rev Phytopathol       Date:  2008       Impact factor: 13.078

4.  Comparative assessment of 5' A/T-rich overhang sequences with optimal and sub-optimal primers to increase PCR yields and sensitivity.

Authors:  M Arif; F M Ochoa-Corona
Journal:  Mol Biotechnol       Date:  2013-09       Impact factor: 2.695

5.  Detection of influenza A viruses with a portable real-time PCR instrument.

Authors:  Markos Mölsä; Katja A Koskela; Esa Rönkkö; Niina Ikonen; Thedi Ziegler; Simo Nikkari
Journal:  J Virol Methods       Date:  2012-02-22       Impact factor: 2.014

6.  The genome sequence of the plant pathogen Xylella fastidiosa. The Xylella fastidiosa Consortium of the Organization for Nucleotide Sequencing and Analysis.

Authors:  A J Simpson; F C Reinach; P Arruda; F A Abreu; M Acencio; R Alvarenga; L M Alves; J E Araya; G S Baia; C S Baptista; M H Barros; E D Bonaccorsi; S Bordin; J M Bové; M R Briones; M R Bueno; A A Camargo; L E Camargo; D M Carraro; H Carrer; N B Colauto; C Colombo; F F Costa; M C Costa; C M Costa-Neto; L L Coutinho; M Cristofani; E Dias-Neto; C Docena; H El-Dorry; A P Facincani; A J Ferreira; V C Ferreira; J A Ferro; J S Fraga; S C França; M C Franco; M Frohme; L R Furlan; M Garnier; G H Goldman; M H Goldman; S L Gomes; A Gruber; P L Ho; J D Hoheisel; M L Junqueira; E L Kemper; J P Kitajima; J E Krieger; E E Kuramae; F Laigret; M R Lambais; L C Leite; E G Lemos; M V Lemos; S A Lopes; C R Lopes; J A Machado; M A Machado; A M Madeira; H M Madeira; C L Marino; M V Marques; E A Martins; E M Martins; A Y Matsukuma; C F Menck; E C Miracca; C Y Miyaki; C B Monteriro-Vitorello; D H Moon; M A Nagai; A L Nascimento; L E Netto; A Nhani; F G Nobrega; L R Nunes; M A Oliveira; M C de Oliveira; R C de Oliveira; D A Palmieri; A Paris; B R Peixoto; G A Pereira; H A Pereira; J B Pesquero; R B Quaggio; P G Roberto; V Rodrigues; A J de M Rosa; V E de Rosa; R G de Sá; R V Santelli; H E Sawasaki; A C da Silva; A M da Silva; F R da Silva; W A da Silva; J F da Silveira; M L Silvestri; W J Siqueira; A A de Souza; A P de Souza; M F Terenzi; D Truffi; S M Tsai; M H Tsuhako; H Vallada; M A Van Sluys; S Verjovski-Almeida; A L Vettore; M A Zago; M Zatz; J Meidanis; J C Setubal
Journal:  Nature       Date:  2000-07-13       Impact factor: 49.962

Review 7.  Whole-genome analysis of transporters in the plant pathogen Xylella fastidiosa.

Authors:  Joao Meidanis; Marilia D V Braga; Sergio Verjovski-Almeida
Journal:  Microbiol Mol Biol Rev       Date:  2002-06       Impact factor: 11.056

Review 8.  The biology of xylem fluid-feeding insect vectors of Xylella fastidiosa and their relation to disease epidemiology.

Authors:  Richard A Redak; Alexander H Purcell; João R S Lopes; Matthew J Blua; Russell F Mizell; Peter C Andersen
Journal:  Annu Rev Entomol       Date:  2004       Impact factor: 19.686

9.  The development of rapid real-time PCR detection system for Vibrio parahaemolyticus in raw oyster.

Authors:  J S Kim; G G Lee; J Kim; J Y Kwon; S-T Kwon
Journal:  Lett Appl Microbiol       Date:  2008-04-17       Impact factor: 2.858

Review 10.  Featured organism: pathogen special: Vibrio cholerae, Pseudomonas aeruginosa and Xylella fastidiosa.

Authors:  J Wixon
Journal:  Yeast       Date:  2000-12       Impact factor: 3.239

View more
  6 in total

1.  Array of Synthetic Oligonucleotides to Generate Unique Multi-Target Artificial Positive Controls and Molecular Probe-Based Discrimination of Liposcelis Species.

Authors:  Mohammad Arif; George Opit; Abigail Mendoza-Yerbafría; Shefali Dobhal; Zhihong Li; Zuzana Kučerová; Francisco M Ochoa-Corona
Journal:  PLoS One       Date:  2015-06-18       Impact factor: 3.240

2.  Multiple internal controls enhance reliability for PCR and real time PCR detection of Rathayibacter toxicus.

Authors:  Mohammad Arif; Grethel Y Busot; Rachel Mann; Brendan Rodoni; James P Stack
Journal:  Sci Rep       Date:  2021-04-16       Impact factor: 4.379

3.  Emergence of a New Population of Rathayibacter toxicus: An Ecologically Complex, Geographically Isolated Bacterium.

Authors:  Mohammad Arif; Grethel Y Busot; Rachel Mann; Brendan Rodoni; Sanzhen Liu; James P Stack
Journal:  PLoS One       Date:  2016-05-24       Impact factor: 3.240

4.  Genome-informed diagnostics for specific and rapid detection of Pectobacterium species using recombinase polymerase amplification coupled with a lateral flow device.

Authors:  Firas A Ahmed; Adriana Larrea-Sarmiento; Anne M Alvarez; Mohammad Arif
Journal:  Sci Rep       Date:  2018-10-29       Impact factor: 4.379

5.  Development of a genome-informed loop-mediated isothermal amplification assay for rapid and specific detection of Xanthomonas euvesicatoria.

Authors:  Adriana Larrea-Sarmiento; Upasana Dhakal; Gamze Boluk; Lilly Fatdal; Anne Alvarez; Amanda Strayer-Scherer; Mathews Paret; Jeff Jones; Daniel Jenkins; Mohammad Arif
Journal:  Sci Rep       Date:  2018-09-24       Impact factor: 4.379

6.  Anatomical and biochemical studies of Spartium junceum infected by Xylella fastidiosa subsp. multiplex ST 87.

Authors:  S Falsini; C Tani; G Sambuco; A Papini; P Faraoni; S Campigli; L Ghelardini; G Bleve; D Rizzo; M Ricciolini; I Scarpelli; L Drosera; A Gnerucci; F Peduto Hand; G Marchi; S Schiff
Journal:  Protoplasma       Date:  2021-04-15       Impact factor: 3.356

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.