| Literature DB >> 24294095 |
Jan Klimaszewski1, Marie-Josee Morency, Philippe Labrie, Armand Séguin, David Langor, Timothy Work, Caroline Bourdon, Evelyne Thiffault, David Paré, Alfred F Newton, Margaret K Thayer.
Abstract
Experimental research on beetle responses to removal of logging residues following clearcut harvesting in the boreal balsam fir forest of Quebec revealed several abundant rove beetle (Staphylinidae) species potentially important for long-term monitoring. To understand the trophic affiliations of these species in forest ecosystems, it was necessary to analyze their gut contents. We used microscopic and molecular (DNA) methods to identify the gut contents of the following rove beetles: Atheta capsularis Klimaszewski, Atheta klagesi Bernhauer, Oxypoda grandipennis (Casey), Bryophacis smetanai Campbell, Ischnosoma longicorne (Mäklin), Mycetoporus montanus Luze, Tachinus frigidus Erichson, Tachinus fumipennis (Say), Tachinus quebecensis Robert, and Pseudopsis subulata Herman. We found no apparent arthropod fragments within the guts; however, a number of fungi were identified by DNA sequences, including filamentous fungi and budding yeasts [Ascomycota: Candida derodonti Suh & Blackwell (accession number FJ623605), Candida mesenterica (Geiger) Diddens & Lodder (accession number FM178362), Candida railenensis Ramirez and Gonzáles (accession number JX455763), Candida sophie-reginae Ramirez & González (accession number HQ652073), Candida sp. (accession number AY498864), Pichia delftensis Beech (accession number AY923246), Pichia membranifaciens Hansen (accession number JQ26345), Pichia misumaiensis Y. Sasaki and Tak. Yoshida ex Kurtzman 2000 (accession number U73581), Pichia sp. (accession number AM261630), Cladosporium sp. (accession number KF367501), Acremoniumpsammosporum W. Gams (accession number GU566287), Alternaria sp. (accession number GU584946), Aspergillus versicolor Bubak (accession number AJ937750), and Aspergillusamstelodami (L. Mangin) Thom and Church (accession number HQ728257)]. In addition, two species of bacteria [Bradyrhizobium japonicum (Kirchner) Jordan (accession number BA000040) and Serratia marcescens Bizio accession number CP003942] were found in the guts. These results not only provide evidence of the consumer-resource relations of these beetles but also clarify the relationship between rove beetles, woody debris and fungi. Predominance of yeast-feeding by abundant rove beetles suggests that it may play an important role in their dietary requirements.Entities:
Keywords: Ascomycota; Basidiomycota; Canada; Coleoptera; Rove beetles; Staphylinidae; bacteria; boreal forest; diet; fungivory; gut analysis; mycophagy; saproxylic; trophic relationship
Year: 2013 PMID: 24294095 PMCID: PMC3837482 DOI: 10.3897/zookeys.353.5991
Source DB: PubMed Journal: Zookeys ISSN: 1313-2970 Impact factor: 1.546
Figures 2–7.Body images of rove beetles in dorsal view: 2 Klimaszewski 3 Bernhauer 4 (Casey) 5 Campbell 6 (Mäklin) [previously cited as synonymous Campbell] 7 Luze [previously cited as synonymous Hatch].
Figures 8–11.Body images of rove beetles in dorsal view: 8 Erichson 9 (Say) 10 Robert 11 Herman.
Primers used in this study.
| Primer name | Primer sequence, 5’-3’ | Primer source study |
|---|---|---|
| ITS9mun | TGTACACACCGCCCGTCG | |
| ITS5 | GGAAGTAAAAGTCGTAACAAGG | |
| ITS4 | TCCTCCGCTTATTGATATGC |
Figure 1.Map of ribosomal RNA genes and ITS regions.
Figures 12–15.Images of hindgut content of the following rove beetle species: 12–13 Klimaszewski 14–15 Bernhauer.
Figures 16–19.Images of hindgut content of the following rove beetle species: 16 (Casey) 17–18 Campbell 19 (Mäklin).
Figures 20–23.Images of hindgut content of the following rove beetle species: 20 (Mäklin) 21–22 Luze 23 Erichson.
Figures 28–31.Images of hindgut content of the following rove beetle species: 28–30 (Say) 31 Robert.
Figures 32–35.Images of hindgut content of the following rove beetle species: 32–33 Robert 34–35 Herman.
Figures 24–27.Images of hindgut content of the following rove beetle species: 24–26 Erichson 27 (Say).
Distribution of yeast and spores in different rove beetle species from microscopical observation. Subfamilies are: A, Aleocharinae; P, Pseudopsinae; T, Tachyporinae.
| Rove beetle species | Spore Type | |||||||
|---|---|---|---|---|---|---|---|---|
| Yeast | 1 | 2 | 3 | 4 | 5 | 6 | 7 | |
| × | ||||||||
| × | ||||||||
| × | ||||||||
| × | × | |||||||
| × | × | |||||||
| × | × | |||||||
| × | × | × | × | |||||
| × | × | × | × | |||||
| × | × | |||||||
| × | ||||||||
Number and identity of genetic sequences extracted from the gut contents of 10 species of Staphylinidae. Accession numbers in brackets follow species name in the first column.
| Specific taxon | Total | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| 2 | 2 | ||||||||||
| 1 | 1 | ||||||||||
| 1 | 1 | ||||||||||
| 1 | 1 | ||||||||||
| 1 | 1 | 16 | 18 | ||||||||
| 12 | 8 | 12 | 14 | 5 | 9 | 4 | 20 | 8 | 92 | ||
| 1 | 1 | ||||||||||
| 1 | 1 | ||||||||||
| 1 | 1 | ||||||||||
| 1 | 1 | ||||||||||
| 1 | 2 | 1 | 4 | ||||||||
| 1 | 1 | ||||||||||
| 1 | 1 | ||||||||||
| 1 | 1 | ||||||||||
| 1 | 1 | ||||||||||
| 1 | 1 | ||||||||||
| 1 | 1 | ||||||||||
| Uncultured fungus clone 50-p12-A5 ( | 2 | 5 | 7 | ||||||||
| Ten species from this study | 6 | 8 | 1 | 5 | 10 | 7 | 37 | ||||
| 1 | 2 | 3 | |||||||||
| 4 | 1 | 1 | 2 | 16 | 24 | ||||||
| 4 | 3 | 1 | 2 | 1 | 1 | 3 | 0 | 0 | 8 | 23 | |
| 19 | 20 | 21 | 22 | 19 | 22 | 25 | 22 | 20 | 33 | 223 |
a Sequences with 86 to 90% sequence similarity.
b Sequences with 78 to 85% sequence similarity.
Hyperlinks for microorganism identification.
| NCBI Taxonomy Browser | MycoBank | |
|---|---|---|