Literature DB >> 24223228

Utility of host delivered RNAi of two FMRF amide like peptides, flp-14 and flp-18, for the management of root knot nematode, Meloidogyne incognita.

Pradeep Kumar Papolu1, Nagavara Prasad Gantasala, Divya Kamaraju, Prakash Banakar, Rohini Sreevathsa, Uma Rao.   

Abstract

Root knot nematode, Meloidogyne incognita, is an obligate sedentary endoparasite that infects a large number of crop species and causes substantial yield losses. Non-chemical based control strategies for these nematodes are gaining importance. In the present study, we have demonstrated the significance of two FMRFamide like peptide genes (flp-14 and flp-18) for infection and development of resistance to M. incognita through host-derived RNAi. The study demonstrated both in vitro and in planta validation of RNAi-induced silencing of the two genes cloned from J2 stage of M. incognita. In vitro silencing of both the genes interfered with nematode migration towards the host roots and subsequent invasion into the roots. Transgenic tobacco lines were developed with RNAi constructs of flp-14 and flp-18 and evaluated against M. incognita. The transformed plants did not show any visible phenotypic variations suggesting the absence of any off-target effects. Bioefficacy studies with deliberate challenging of M. incognita resulted in 50-80% reduction in infection and multiplication confirming the silencing effect. We have provided evidence for in vitro and in planta silencing of the genes by expression analysis using qRT-PCR. Thus the identified genes and the strategy can be used as a potential tool for the control of M. incognita. This is the first ever report that has revealed the utility of host delivered RNAi of flps to control M. incognita. The strategy can also be extended to other crops and nematodes.

Entities:  

Mesh:

Substances:

Year:  2013        PMID: 24223228      PMCID: PMC3819290          DOI: 10.1371/journal.pone.0080603

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Plant-parasitic nematodes are responsible for global agricultural losses amounting to an estimated $157 billion annually [1]. Root knot nematodes (Meloidogyne species) are the most economically important group of plant parasitic nematodes (PPNs) worldwide, attacking nearly every food and fiber crop grown [2]. The potential host range of these obligate, sedentary endoparasites encompasses more than 3000 plant species [3]. M. incognita, representing the most widespread species, is found in every country in which the lowest temperature is more than 3°C and is therefore possibly the most damaging crop pathogen in the world [4]. Chemical nematicides have been discontinued due to their detrimental environmental effects and other alternative management approaches are not sufficient demanding an urgent need to design novel management strategies. Since transgenic technology has offered potential new avenues for crop improvement programs, it could be useful for designing nematode resistant crops. FMRFamide (Phe-Met-Arg-Phe) is a neuropeptide from a broad family of FMRFamide-related peptides (FaRPs) all sharing an -RFamide sequence at their C-terminus. FMRFamide like peptides (FLPs) belong to FaRPs comprising the largest family of neuropeptides in nematodes. Most of the structural information of FLPs has been generated from Caenorhabditis elegans and the functional data of FLPs comes from the nematode physiological model, Ascaris suum. The studies on FLPs in A. suum indicate that their vital responsibility for the modulation of nerve and muscle activity in a concentration dependent and reversible manner [5,6]. They are responsible for modulating pharyngeal muscle activity in A. suum [7]. Similarly, FLPs are also accountable for multiple responses in the ovijector musculature ranging from transient excitation to persistent or transient inhibition [8,9]. Therefore, these peptides and their associated processes are considered as potential control targets for parasitic helminths [10-12]. As in the case of A. suum, presence of FMRFamide-like immunoreactivity has also been demonstrated in the nervous system of PPNs, Globodera pallida and G. rostochiensis [13]. Recently it has been reported that flp-32 in G. pallida was responsible for the modulation of locomotory behavior and putatively interacted with at least one novel G-protein coupled receptor [14]. FLPs are shown to be present in different parasitic nematodes having similar structural homologues and functions. Consequently, disruption of these activities in PPNs represents an attractive novel control strategy as it would interrupt the worm’s ability to hatch, migrate through the soil to reach the host, feed on the host tissue and also to mate. So far, 19 FLPs have been identified in M. incognita based on conserved FMRFamide domain analysis of the ESTs and the whole genome sequence by comparative genomics [1], out of which six have transcriptional confirmation (flp-1, 7, 12, 14, 16, 18 – NCBI GenBank database). MSA (Multiple Sequence alignment) of these six confirmed flp genes showed low nucleotide sequence level conservation among them although they share a common RF-amide sequence at C-terminus. Their uniqueness could therefore be harvested at developing sequence specific knockout module by dsRNA method to avoid off target effects. Further, accurate physiological roles of only few of the FLPs are known in C. elegans and A. suum. However, major information on these FLPs is lacking in M. incognita probably due to their small size and obligate relationship with the host which limits the use of standard physiological techniques. Nevertheless, silencing of flp-14 and flp-18 in M. incognita has been reported to interrupt the migration of worms in response to the root exudates [15,16]. In view of this, we have selected these two genes with no sequence similarity between them in the present study. RNA interference (RNAi), the conserved phenomenon of gene silencing mediated by double-stranded RNA (dsRNA), represents a promising molecular tool with potential applications in both the functional genomics and control of PPNs. The ability to specifically knock down a selected mRNA transcript allows the investigation of gene function and interaction, in addition to the validation of putative control of targets through loss of function phenotype analysis. The study of gene function through RNAi is well documented for many PPNs including G. pallida and M. incognita [3,17-23]. In addition to these reverse-genetics applications, in planta RNAi has shown potential as a method of PPN control with several published accounts of such an approach in both cyst and root knot nematodes [14,22,24-28]. The present paper deals with the unequivocal utility of host delivered RNAi of the two flp genes, flp-14 and flp-18 and their effect on M. incognita.

Materials and Methods

Nematodes

A pure culture of Indian isolate of M. incognita was maintained on a susceptible egg plant variety Pusa purple long under green house conditions. Nematode infected plants were harvested at appropriate intervals to collect feeding females (FF) and egg masses. These egg masses were used for hatching the infective second stage juveniles (J2s); additionally eggs were also collected separately.

Cloning and sequencing of flp-14, flp-18 of M. incognita

Total RNA was extracted from J2s using NucleoSpin total RNA Kit (Macherey-Nagel, Germany). Extracted RNA was assessed for quality and quantity using Nanodrop ND-1000 spectrophotometer (Thermo Scientific) and Agilent 2100 Bioanalyzer with RNA 6000 nanokit (Agilent Technologies). RNA with an RNA integrity number (RIN) of 8.0 was used for cDNA synthesis. Further, 300 ng of the RNA sample was reverse transcribed to cDNA using cDNA synthesis Kit (Superscript VILO, Invitrogen). A 284 bp and 407 bp region of flp-14 and flp-18 (GenBank: AY907829, AY729022) respectively were amplified separately from the cDNA using the primers as given in table 1.
Table 1

Primers used for PCR amplification of flp-14 and flp-18.

Name Accession Sequence (5’ --- 3’) Length (bp)    Tm (° C)
flp-14 F AY907829 AACGCAAATACTCGTGCTTTCT 28460
flp-14 R TATGCAGCCATCTAACAATTCCT
flp-18 F AY729022 CGATGAAAGACCAAAACGTG 40760
flp-18 R ACGATGATGGAAAGGAATGG
The two PCR products were cloned separately into pGEM-T easy cloning vector (Promega) using standard protocol. Freshly prepared competent cells of Escherichia coli DH5α were transformed with the recombinant plasmids. Positive clones were selected by blue white colony screening and colony PCR. Plasmids were extracted from recombinant colonies and confirmed by restriction digestion with EcoRI. The positive clones were custom sequenced by ABI SOLiD sequencing system [29].

Differential expression of flp-14, flp-18 in developmental stages of M. incognita using qRT-PCR

RNA was extracted from three different stages (eggs, J2s, females) of M. incognita and cDNA was prepared by using 300 ng of RNA. Quantitative Real-time (qRT-PCR) was performed using SYBR Green I technology in realplex2 thermal cycler (Eppendorf). A master mix for each of the samples was prepared by mixing SYBR Green I, blue dye, ROX passive reference and stabilizers and PCR Core Reagents (Eurogentec). In this study, 18S rRNA was used as an internal reference gene; 1.5 ng of cDNA and 750 nM each of the specific primers were added in a final volume of 10 µl (Table 2). The amplification reactions were carried out at a hot start of 95° C for 5 min, followed by 40 cycles of 95° C for 15 s and 60° C for 1 min in a qPCR high profile non skirted white 96-well plate (Eurogentec). Specificity of amplification was assessed by disassociation or melt curve analysis at 60-95° C after 40 cycles. Three biological replicates and three technical replicates were used for each of the samples. The mean ct values were taken for calculating the fold change (2-ΔΔCT) [30].
Table 2

Real-time PCR primers used for expression analysis.

Name Sequence (5’ --- 3’) Length (bp) Tm (° C)
flp-14 RT F GCGAGTCCATGTGTAGCAGCTAAT 11760
flp-14 RT R GGGAGATGAAGAACGTTTACTACTTTGCC
flp-18 RT F AGGATGACTTATTGCGCCAGGA 18560
flp-18 RT R TTCCTTTACCGAATCTGAGCACGC
18SrRNA Tobacco RT F CGCGCGCTACACTGATGTATTCAA 17260
18SrRNA Tobacco RT R TACAAAGGGCAGGGACGTAGTCAA
18SrRNAM.incognita RT F TCAACGTGCTTGTCCTACCCTGAA 15560
18SrRNAM.incognita RT R TGTGTACAAAGGGCAGGGACGTAA

Preparation of dsRNA

The flp-14, flp-18 and GFP gene fragments were PCR amplified from respective pGEM-T clones using M13 primers. Gel purified PCR products were used as template for synthesizing sense and antisense strands of all the three genes using T7 and Sp6 transcription kits (Ambion). dsRNA was synthesized by mixing the two ssRNAs and incubating at 65° C for 5-10 min followed by 37° C for 30 min; confirmed on 1% agarose gel and stored at -20° C until further use. dsRNA of an unrelated green fluorescent protein (GFP) of 750 bp cloned in pGEM-T vector was synthesized to be used as a negative control.

In vitro RNAi of flp-14 and flp-18

Freshly hatched J2s were collected and used for dsRNA uptake studies as described [17]. About 15,000 freshly hatched J2s were soaked in 100 µl of RNAi soaking solution containing 3 µg dsRNA along with 50 mM Octopamine and incubated for 24 h in dark on a slowly rotating vertical platform at room temperature. In control samples, the J2s were incubated in the same solution without dsRNA. In order to demonstrate target specific silencing, worms were also soaked in dsRNA of GFP. After 24 h the nematodes were washed thrice in sterile spring water by gently inverting the tubes for resuspension of the worms followed by a brief centrifugation for collection of worms. The nematodes were examined under the microscope for mobility, normal behavior and used for further experimental studies. The concentration of the worms was adjusted as 20 worms per 10 µl of water. We performed an attraction and migration assay on pluronic gel for determining the effect of gene silencing [31]. For this, 1000 J2s were placed in the middle of a 2 inch diameter petriplates; 5 ml of 23% pluronic gel F-127 was added and the plates were rotated gently. This helped in mixing of the worms with the gel and uniform spreading of both the gel and worms all over the plate. Following this, five day old tomato seedling (variety Pusa Ruby) was placed on the gel in a corner and the plates were incubated at room temperature for the gel to solidify. Migration of J2s was monitored at 4 and 8 h. At 24 h, infected roots were stained with acid fuchsin to observe the number of J2s that had penetrated into the roots [32]. At this interval, nematodes around the roots were also counted. Six replicates were taken for each of the treatments. Data were analyzed by one-way ANOVA and CRD test for significance followed by Duncan’s multiple-comparison test with significance level at P<0.05 and P<0.01 using SAS software (version 9.3). In order to analyze the expression of target genes in the dsRNA-treated nematodes, total RNA was extracted from worms treated with target dsRNA, dsRNA of unrelated control (GFP) and control (worms soaked in water). cDNA synthesis and qRT-PCR analysis was performed as mentioned above. Three biological and three technical replicates were taken for each of the samples. 18S rRNA was used as a reference gene. Fold change was calculated using 2-ΔΔCT, expressed as percentage and student t test was performed.

Development of RNAi constructs of flp14 and flp18 for in planta validation

The pK7GWIWG2(I) vector (RNAi GATEWAY ready) [33] was obtained from VIB Department of Plant Systems Biology, Ghent University, Belgium ( .be/ gateway/). Partial sequences of flp-14, flp-18 (284bp, 353bp) were initially amplified from pGEM-T clones and cloned separately into the entry vector (pDONR 221). Primer details are given in table 3. These gene fragments were subsequently cloned into GATEWAY ready pK7GWIWG2 (I) RNAi vector in sense and antisense orientation intervening with an intron by GATEWAY recombination based cloning (Invitrogen) (Figure S1). These RNAi constructs were transformed to E. coli (DH5α) cells and colony PCR was performed using three different sets of primers (gene specific forward and reverse; CaMV 35S promoter forward and attB2 reverse; CaMV 35S terminator forward and attB2 reverse; nptII forward and reverse primers) to confirm the orientation of the target gene. The PCR products were sequenced and BLAST analysis was done to ensure that PCR reaction specifically amplified the target genes. Further, Agrobacterium tumefaciens strain LBA4404 was transformed with the recombinant constructs by electroporation and used for validation studies in Nicotiana tabacum.
Table 3

Primers used for cloning of flp-14 and flp-18 in RNAi vector and analysis of transgenic tobacco plants.

Name Sequence (5’ --- 3’) Length (bp) Tm (° C)
GV flp-14 F GGGGACAAGTTTGTACAAAAAAGCAGGCTAACGCAAATACTCGTGCTTTCT 34260
GV flp-14 R GGGGACCACTTTGTACAAGAAAGCTGGGTATGCAGCCATCTAACAATTCCT
GV flp-18 F GGGGACAAGTTTGTACAAAAAAGCAGGCTGACTCTTTGGAAACGTTCACTT 41160
GV flp-18 R GGGGACCACTTTGTACAAGAAAGCTGGGTGATGATGGAAAAGGAATGGCTA
CaMV35S Promoter TCCTTCGCAAGACCCTTC
CaMV35S Terminator CCTTATCTGGGAACTACTCACAC
attB1 GGGGACAAGTTTGTACAAAAAAGCAGGCT
attB2 GGGGACCACTTTGTACAAGAAAGCTGGGT
nptII F CAA TCG GCTGCTCTCATGCCG 75060
nptII R AGGCGATAGAAG GCGATGCGC

Plant material and growth conditions

Seeds of tobacco variety, Petite Hawana, were surface sterilized with 70% alcohol for 2 min and washed with sterile distilled water; subsequently, they were treated with 0.1% HgCl2for 10 min and washed with sterile distilled water to remove the sterilant. Later the seeds were germinated on half strength MS medium with 1.5% sucrose and 0.7% agar (pH 5.8). The seedlings were maintained in 16 hours light and 8 hours dark.

In planta RNAi of flp-14, flp-18 of M. incognita using tobacco

Leaf explants of 1cm2 cut from young tobacco leaves were used for Agrobacterium mediated transformation. Explants were kept in pre-cultivation medium for 3 days (MS+ 0.1mg L-1 NAA + 2 mg L-1 BAP). Subsequently, they were infected with Agrobacterium (LBA4404) harboring the respective RNAi constructs for 5 min. Later, the leaf explants were blotted dry on sterile tissue paper and co-cultivated for 2 days on co-cultivation media (MS+ 0.1mg L-1 NAA + 2 mg L-1 BAP). Subsequently, they were incubated on selection medium (MS+ 0.1 mg L-1 NAA + 2 mg L-1 BAP + 100 mg L-1 kanamycin+ 250 mg L-1 cefotaxime). After 30 days, shoots produced from the explants were sub cultured at 10-15 days interval into fresh selection medium. The elongated shoots were further transferred to rooting media (1/2 MS + 100 mg L-1 kanamycin+ 250 mg L-1 cefotaxime). The resulting plants with well established roots were hardened and transferred to National Phytotron Facility of IARI, New Delhi for further growth and production of T0 seeds.

Molecular analysis of the primary transgenics

DNA extraction and PCR confirmation of T0 plants

Genomic DNA was extracted from the fresh leaves of all the primary transgenic events using Nucleospin Plant II DNA extraction kit (Macherey-Nagel). Preliminary evaluation of the flp-14, flp-18 transformants at the molecular level was carried out by PCR analysis using different sets of primers (gene specific forward and reverse; CaMV 35S promoter forward and attB2 reverse; CaMV 35S terminator forward and attB2 reverse; nptII forward and reverse primers) (Table 3). The PCR products were resolved on 1.2% agarose gel.

Genomic southern analysis

To confirm the T-DNA integration, DNA (15 µg) from the PCR positive plants was digested with SacI that cuts once in the T-DNA. Digested DNA was resolved on 0.8% agarose gel and then transferred onto a nitrocellulose membrane (BioRad Zeta probe). For probing, 284 bp and 353 bp fragments of flp-14, flp-18 genes respectively were used. The DNA fragments were labeled with α[32P]-dCTP by mega prime DNA labeling kit (Amersham Pharmacia Biotech) and hybridization was carried out at 65° C for 18 h. The membranes were later washed at 65° C with 3× SSC and 0.1% SDS, followed by 0.5× SSC and 0.1% SDS, for 30 min each. They were finally washed with 0.1× SSC and 0.1% SDS for 30 min [34], exposed to Fujifilm (Kodak) for 36 hr and developed.

Molecular analysis of T1 plants

T0 seeds of plants of both the genes were germinated on MS+100 mg L-1 kanamycin and shoots were transferred to ½ MS medium along with 0.25 mg L-1 GA3 (Duchefa) and 100 mgL-1 kanamycin. Plants with optimum growth of shoots and roots were then transferred to 150 ml pots filled with autoclaved soil and soilrite in the ratio of 3:1. These plants were kept in the growth chamber (Labtech) at 27° C, 70% RH, 16h light and 8h dark for 10-15 days. DNA was extracted from the fresh leaves of these plants as explained above and was analyzed by PCR using different sets of primers as in the case of T0 plants (Table 3). PCR confirmed T1 plants of different events were further subjected to real-time PCR and bioefficacy analysis. qRT-PCR analysis was carried out using primers specific to the target genes and 18S rRNA (reference gene) as stated above (in vitro RNAi of flp-14, flp-18). ΔCT values were later calculated by determining the difference between the ct mean of the target gene and the reference gene for obtaining the average ΔCT values. Representative samples of T1 plants expressing dsRNA of flp-18 were also confirmed by northern analysis for the presence of both dsRNA and siRNA. For this, total RNA was extracted from the leaves using NucleoSpin total RNA Kit (Macherey-Nagel) while, that of siRNA was extracted using NucleoSpin small RNA Kit (Macherey-Nagel). Both the total RNA and siRNA were resolved on 30% denaturing PAGE gel and then transferred onto a nitrocellulose membrane (BioRad Zeta probe). For probing, 353 bp fragment of flp-18 gene was used. The DNA fragment was labeled with α[32P]-dCTP by mega prime DNA labeling kit (Amersham Pharmacia Biotech) and hybridization was carried out at 42° C for 18 h. The membranes were later washed at 65° C with 3× SSC and 0.1% SDS, followed by 0.5× SSC and 0.1% SDS, for 30 min each. They were finally washed with 0.1× SSC and 0.1% SDS for 30 min [34], exposed to Fujifilm (Kodak) for 36 hr and developed.

Efficacy studies of T1 plants expressing dsRNA of flp-14, flp-18 against M. incognita

The roots of 15 days old transgenic plants kept in growth chamber were inoculated with approximately 300 freshly hatched J2s. The nematode inoculated plants were grown at 27° C, 70% relative humidity, 16h light and 8h dark for 30 days to complete the lifecycle. After 30 days, the roots were washed free of soil and total number of galls, females, egg masses and eggs per egg mass were counted for each plant. These were compared with the wild type plants which were also inoculated and grown under similar conditions. Six replicates were used in the study. The observations were made for all the replicates separately and subjected to analysis of variance (one-way ANOVA). Observations were reported as significant or non-significant using the CRD test, followed by Duncan’s multiple-comparison test with significance level at P<0.05 and P< 0.01 using SAS software (version 9.3).

Expression analysis of the target gene in the nematode extracted from transgenic plants

Mature females were extracted from both the wild type and transgenic plants and then analyzed by qRT- PCR to assess flp-14 and flp-18 transcript accumulation. To determine target specific silencing effect, expression of flp-18 was analyzed in the females collected from transgenic plants expressing dsRNA of flp-14 and vice versa. 18S rRNA was used as reference gene. Six biological and three technical replicates for flp-14 and flp-18 were taken for the study. Fold change was calculated using 2-ΔΔCT, expressed as percentage and student t test was performed.

Results

Cloning and differential expression of flp-14, flp-18 of M. incognita

Cloning, sequencing and blast analysis of 284 bp and 353 bp (Figures S2A & S2B) of the coding sequences of flp-14 and flp-18 amplified from the cDNA of M. incognita revealed 100% similarity to the already reported sequences. Simultaneously, comparative expression of both the target genes by qRT-PCR in eggs, J2s and feeding females was carried out to analyze the spatial expression of both the genes. It was observed that the expression of both the genes was highest in J2s followed by eggs and females (Figure 1A & 1B). Relative fold expression of flp-14 and flp-18 was reduced by about 170 and 130 times respectively in the females when compared to the J2s. However, expression of both the genes in the eggs had not reduced as much as in females. In eggs, there was a reduction of about 13 times for flp-14 and 7 times for flp-18 compared to the J2 stage.
Figure 1

Relative fold change in the expression of target genes in different developmental stages of Meloidogyne incognita.

(A) flp-14 (B) flp-18. 18S rRNA was used as a reference gene and fold change was calculated by using 2-ΔΔCT method. Error bars show +SD among the biological replicates.

Relative fold change in the expression of target genes in different developmental stages of Meloidogyne incognita.

(A) flp-14 (B) flp-18. 18S rRNA was used as a reference gene and fold change was calculated by using 2-ΔΔCT method. Error bars show +SD among the biological replicates.

In vitro RNAi by dsRNA soaking

Initially, the effect of the cloned gene fragments on M. incognita was assessed by soaking in dsRNA of both the genes. As a first proof, silencing of the target genes, flp-14 and flp-18 was confirmed by qRT-PCR using cDNA obtained from the dsRNA soaked and control J2s. The transcript level was reduced in the dsRNA soaked J2s compared to the control worms (Figure 2). Silencing of flp-14 resulted in about 40% transcript reduction while for flp-18, it was about 82%. In the present study, target specific silencing could be established using appropriate controls. Firstly, neither of the target genes were silenced in the GFP silenced worms (Figure 2). This was further substantiated by the absence of any adverse effect on flp-18 in the flp-14 silenced worms and vice versa (Figure 2). Expression level of reference gene, 18S rRNA, was equal in both the treated and untreated nematodes. The stability of expression was confirmed in two biological replicates; each of which had three technical replications. This confirmed the production of siRNA leading to the silencing of the target genes.
Figure 2

Effect of in vitro RNAi on transcript abundance of flp-14 and flp-18 in Meloidogyne incognita J2s.

Expression was quantified to demonstrate target specific silencing in the nematodes. 18S rRNA was used as reference gene and fold change was calculated by using 2-ΔΔCT method. The fold change values were transformed to personate values. Error bars show +SD among the biological replicates. **P<0.01.

Effect of in vitro RNAi on transcript abundance of flp-14 and flp-18 in Meloidogyne incognita J2s.

Expression was quantified to demonstrate target specific silencing in the nematodes. 18S rRNA was used as reference gene and fold change was calculated by using 2-ΔΔCT method. The fold change values were transformed to personate values. Error bars show +SD among the biological replicates. **P<0.01. Subsequently, the phenotypic effect of gene silencing in terms of attraction and migration towards the host was assessed by an in vitro bioassay on pluronic gel. Corroborating with the expression analysis, the assay indicated reduced number of J2s reaching the roots. Silencing of both the target genes had a negative impact on the attraction and migration of the J2s and it was evident as early as 2 h and continued further even at 4 h (Figure 3A). The number of J2s reaching the roots reduced significantly at all the three intervals and by 24 h, most of the J2s reaching the roots had penetrated in both the treated and control worms (Figure 3B & 3C). In fact, the number of worms in the control was so high that the roots had to be dissected out to count the total number of J2s that had penetrated by 24 hrs while in treated worms, they could be counted without dissection (Figure 3D). Though the number of J2s migrating towards the roots were less in flp-14 treated worms compared to flp-18, penetration was more in case of J2s silenced for flp-14. This indicated that silencing of flp-18 was more effective than flp-14 in reducing the penetration (Figure 3B). However, both the genes were validated in planta for the efficacy against M. incognita. This kind of adverse effect on nematode migration was not noticed when the worms were soaked in dsRNA of GFP confirming the target specific silencing and their negative effects on the nematode behavior.
Figure 3

Effect of in vitro RNAi on nematode attraction and penetration.

(A) Nematode attraction to tomato roots at different time intervals (B) Penetration into tomato roots at 24 h (C) Percentage reduction in nematode penetration in tomato roots due to RNAi compared to control (D) Stained nematodes in the infected tomato roots (i) Roots inoculated with J2s soaked in water (control) (ii) Roots inoculated with J2s soaked in dsRNA of GFP (Unrelated control) (iii) Roots inoculated with J2s soaked in dsRNA of flp-14 (iv) Roots inoculated with J2s soaked in dsRNA of flp-18. Error bars show mean +SD of the number of J2s that could be seen within 0.5 cm diameter around or inside the root. Significant differences are marked with different alphabets, CRD test (* P<0.05 and ** P< 0.01).

Effect of in vitro RNAi on nematode attraction and penetration.

(A) Nematode attraction to tomato roots at different time intervals (B) Penetration into tomato roots at 24 h (C) Percentage reduction in nematode penetration in tomato roots due to RNAi compared to control (D) Stained nematodes in the infected tomato roots (i) Roots inoculated with J2s soaked in water (control) (ii) Roots inoculated with J2s soaked in dsRNA of GFP (Unrelated control) (iii) Roots inoculated with J2s soaked in dsRNA of flp-14 (iv) Roots inoculated with J2s soaked in dsRNA of flp-18. Error bars show mean +SD of the number of J2s that could be seen within 0.5 cm diameter around or inside the root. Significant differences are marked with different alphabets, CRD test (* P<0.05 and ** P< 0.01).

Validation studies of the RNAi vectors of flp-14 and flp-18 in tobacco using Agrobacterium tumefaciens

A very well standardized leaf-based regeneration system in tobacco was used to validate the efficacy of the hair pin RNAi constructs of flp-14 and flp-18. The regenerated tobacco plants (T0 plants) containing the RNAi vectors of flp-14 and flp-18, that could grow and establish on the selection medium containing 100 mg L-1 kanamycin were used for integration, expression and efficacy studies.

Analysis of the plants for T-DNA integration

Initially, 50 T0 plants each harbouring the dsRNA for flp-14 and flp-18 respectively were tested for the integration of T-DNA by PCR analysis. Analysis with different sets of primers amplifying the gene specific region, sense and the antisense region as well as the selectable markers demonstrated the amplification of the expected fragments in the transgenics with both flp-14 and flp-18 (Figure S3). This indicated the integration of the T-DNA in 40 out of 50 selected plants. In order to confirm the integration pattern of the T-DNA, 8 events of flp-14 and 12 events of flp-18 were subjected to genomic southern analysis. Genomic DNA of all the T0 plants when digested with SacI and probed with 284 and 353 bp fragments of the flp-14 and flp-18 genes respectively, revealed integration of the T-DNA in most of the events. There was no hybridization signal in the wild type plants used as negative control (Figure 4A & 4B). In the plants harbouring the hair pin RNAi vector for flp-14, all the plants showed single copy integration pattern (Figure 4A) demonstrating a clear integration of the T-DNA. Other set of plants harbouring RNAi vector of flp-18 demonstrated a varied integration pattern in plants incorporating single and multiple copies of T-DNA (Figure 4B).
Figure 4

Genomic Southern analysis of the T0 transgenic events of tobacco harboring dsRNA of flp-14 and flp-18.

(A) Southern analysis to confirm the integration of flp-14 gene. Lanes - M: Lambda HindIII digest, 1: Undigested wild type tobacco DNA, 2: Digested wild type tobacco DNA, 3-10: DNA samples from T0 transgenic tobacco events: 3- 133.1, 4-96.1, 5-44.2, 6-92.1, 7-52.1, 8-82.3, 9-95.3, 10-11.2 (B) Southern analysis to confirm the integration of flp-18 gene. Lanes - M: Lambda Hind III digest, 1: Undigested wild type tobacco DNA, 2: Digested wild type tobacco DNA, 3-14: DNA samples from T0 transgenic tobacco events: 3- A.22, 4-A.6, 5-A.30, 6-A.31, 7-A.36, 8-A.37, 9-A.38, 10-A.39, 11-A.43, 12-A.45, 13-A.49, 14-A.55.

Genomic Southern analysis of the T0 transgenic events of tobacco harboring dsRNA of flp-14 and flp-18.

(A) Southern analysis to confirm the integration of flp-14 gene. Lanes - M: Lambda HindIII digest, 1: Undigested wild type tobacco DNA, 2: Digested wild type tobacco DNA, 3-10: DNA samples from T0 transgenic tobacco events: 3- 133.1, 4-96.1, 5-44.2, 6-92.1, 7-52.1, 8-82.3, 9-95.3, 10-11.2 (B) Southern analysis to confirm the integration of flp-18 gene. Lanes - M: Lambda Hind III digest, 1: Undigested wild type tobacco DNA, 2: Digested wild type tobacco DNA, 3-14: DNA samples from T0 transgenic tobacco events: 3- A.22, 4-A.6, 5-A.30, 6-A.31, 7-A.36, 8-A.37, 9-A.38, 10-A.39, 11-A.43, 12-A.45, 13-A.49, 14-A.55. Based on the integration studies, 3 events harbouring flp-14 (44.2, 82.3 and 92.1) and 6 events harbouring flp-18 (A-6, A-30, A-36, A-38, A-39, A-45) were used for expression and efficacy analysis in the subsequent generation. The seeds of the selected plants were germinated and the T1 plants were maintained in the growth chamber for studies on expression and efficacy. However, as a preliminary proof of the inheritance of the T-DNA in the progeny of the selected events, PCR analysis was carried out in randomly selected T1 plants using primers for the amplification of the flp-14, flp-18 gene specific region, sense and antisense regions and the selectable marker (Figure S4). It was observed that all the progeny plants showed the amplification of the expected fragments confirming the stable integration and inheritance of the T-DNA.

Validation of the progeny of the selected events for expression and efficacy of flp-14 and flp-18

qRT-PCR analysis of the selected events was carried out to validate the expression of dsRNA transcript and its accumulation. Expression of the flp-14 and flp-18 dsRNA was confirmed in the progeny of the selected events. Six well established plants from each of the selected events were used for transcript analysis. It was observed that all the plants showed an increase in the transcript accumulation of flp-14 when compared to the wild type (Figure 5A). However, there was variation amongst the lines that were chosen for the study and the average expression was higher in the event 44.2 compared to the other two events. Similarly, six well established and healthy plants belonging to each of the flp-18 events evaluated were considered for expression analysis (Figure 5B). The event A-38 showed the highest expression of flp-18 gene and the event A-39 showed the least. Additionally, as a key component of host-delivered RNAi, expression of dsRNA of flp-18 was further established by Northern analysis in six transgenic plants comprising two plants for each of the three independent events which showed the presence of dsRNA in all the plants analyzed (Figure 6 A). Likewise, siRNA of flp-18 could also be detected in the two representative samples (Figure 6B) confirming the possibility of host-delivered RNAi.
Figure 5

qRT-PCR analysis of T1 plants.

Expression analysis of T1 transgenic tobacco plants (A) flp-14 (B) flp-18. 18S rRNA was used as a reference gene and ΔCT values were calculated using the difference in the ct mean of the target gene and reference gene. Error bars show +SD among the biological replicates.

Figure 6

Confirmation of dsRNA and siRNA of flp-18 in T1 plants by Northern analysis.

(A) Northern blot for dsRNA; Lanes -NC: Negative control (Wild type tobacco plant), RNA samples from T1 transgenic tobacco events 1- A.6, 2- A.30, 3- A.38, 4- A.39, 5- A.45, 6 - A.43, PC: Positive control (Gene specific PCR product). (B) Northern blot for siRNA, Lanes 1&2: flp-18 T1 tobacco events (A.45 & A.38), NC: Negative control (Wild type tobacco plant), PC: Positive control (Gene specific PCR product).

qRT-PCR analysis of T1 plants.

Expression analysis of T1 transgenic tobacco plants (A) flp-14 (B) flp-18. 18S rRNA was used as a reference gene and ΔCT values were calculated using the difference in the ct mean of the target gene and reference gene. Error bars show +SD among the biological replicates.

Confirmation of dsRNA and siRNA of flp-18 in T1 plants by Northern analysis.

(A) Northern blot for dsRNA; Lanes -NC: Negative control (Wild type tobacco plant), RNA samples from T1 transgenic tobacco events 1- A.6, 2- A.30, 3- A.38, 4- A.39, 5- A.45, 6 - A.43, PC: Positive control (Gene specific PCR product). (B) Northern blot for siRNA, Lanes 1&2: flp-18 T1 tobacco events (A.45 & A.38), NC: Negative control (Wild type tobacco plant), PC: Positive control (Gene specific PCR product).

Bioefficacy of T1 tobacco lines against M. incognita

Nematode bioassays were performed in order to study the resistance offered against M. incognita by inoculating freshly hatched J2s on T1 generation plants that were confirmed for the flp-14/flp-18 integration and expression of dsRNA. The plants were harvested 30 days after inoculation and observations were recorded on various parameters to determine the effect of host delivered RNAi on nematode infection, development and reproduction. T1 plants of the three selected independent events were screened in case of flp-14 and the nematode infection was scored in terms of number of galls, females, egg masses and eggs per egg mass produced in each plant. Similarly, in case of transgenics for silencing the flp-18 gene, T1 plants of six independent events were evaluated (Figure 7). It was quite evident that host delivered RNAi silencing of both the target genes resulted in reduced root galling due to the nematode infection and there was an increased root growth in the transgenics compared to the wild type plants. Silencing of both the genes generally reduced the nematode infection as indicated by reduction in the number of galls (Figures 8A & 9A). Correspondingly, there was a reduction in number of females and the percentage reduction ranged between 50 - 103 % in flp-14 RNAi plants compared to the wild type plants. Interestingly, not all the females in these roots could reproduce since the percentage reduction of egg masses ranged from 28 to 57% which indicated that only 50% of the females could reproduce (Figure 8B). Likewise, silencing of flp-14 reduced the fecundity of the nematodes as percentage reduction in number of eggs per egg mass ranged from 47 - 50 % (Figure 8B). Similarly, silencing of flp-18 also exhibited such adverse effects on the nematode infection, development and reproduction (Figure 9A & 9B). Five out of the six events evaluated showed a reduction of 43 to 59 % in the total number of galls in the transgenic plants compared to the wild type. The reduction in number of females that developed per plant ranged from 15 to 50 %; reduction in fecundity reduced between 44-58%. While, that of eggs per egg mass was reduced between 29 and 69 percent. However, plants of one of the events (A39) expressing flp-18 dsRNA were not effective in reducing the number of females and on the contrary more females were produced when compared to the wild type control plants. Surprisingly, the number of egg masses and the eggs per egg mass reduced even in this event resulting in 53% reduction in multiplication factor (MF) as compared to the wild type control roots. Finally, the nematode MF reflecting the overall ability of the nematode to be a successful parasite was reduced by about 67 to 86 % due to the silencing of flp-14 while the reduction due to silencing of flp-18 was 53 to 82%.
Figure 7

Bioefficacy analysis of the T1 tobacco events against Meloidogyne incognita.

Intensity of galling in the roots of T1 tobacco plants expressing (A) flp-14 (B) flp-18 (C) Wild type.

Figure 8

Effect of host delivered RNAi of flp-14 on infection and reproduction of Meloidogyne incognita.

(A) Infection and reproduction of Meloidogyne incognita (B) Percentage reduction in nematode infection and reproduction on transgenics compared to the wild type plants. Error bars show mean +SD. Significant differences are marked with different alphabets, CRD test (* P<0.05 and ** P<0.01).

Figure 9

Effect of host delivered RNAi of flp-18 on infection and reproduction of Meloidogyne incognita.

(A) Reduction in infection and reproduction of Meloidogyne incognita due to silencing of flp-18 (B) Percentage reduction in infection and reproduction of M. incognita on transgenics compared to wild type plants. Error bars show mean +SD. Significant differences are marked with different alphabets, CRD test (* P<0.05 and ** P<0.01).

Bioefficacy analysis of the T1 tobacco events against Meloidogyne incognita.

Intensity of galling in the roots of T1 tobacco plants expressing (A) flp-14 (B) flp-18 (C) Wild type.

Effect of host delivered RNAi of flp-14 on infection and reproduction of Meloidogyne incognita.

(A) Infection and reproduction of Meloidogyne incognita (B) Percentage reduction in nematode infection and reproduction on transgenics compared to the wild type plants. Error bars show mean +SD. Significant differences are marked with different alphabets, CRD test (* P<0.05 and ** P<0.01).

Effect of host delivered RNAi of flp-18 on infection and reproduction of Meloidogyne incognita.

(A) Reduction in infection and reproduction of Meloidogyne incognita due to silencing of flp-18 (B) Percentage reduction in infection and reproduction of M. incognita on transgenics compared to wild type plants. Error bars show mean +SD. Significant differences are marked with different alphabets, CRD test (* P<0.05 and ** P<0.01). An interesting corroboration with the bioefficacy was observed by qRT-PCR quantification of flp-14 and flp-18 genes (Figure 10A & 10B) in the females extracted from the transgenic tobacco plants harboring the respective genes. The observation showed down regulation of the target genes suggesting effective host delivered RNAi in the transgenic plants. Target specific host delivered gene silencing could also be established as in case of in vitro RNAi silencing. No reduction in the quantification of flp-18 transcript was observed in the females extracted from the transgenic plants expressing dsRNA of flp-14 and vice versa confirming the target specific gene silencing by in planta.
Figure 10

Percent reduction in the relative transcript levels due to target gene silencing in the females of M. incogntia feeding on the transgenic plants.

(A) Decrease in mRNA abundance in M. incogntia females extracted from (A) flp-14 (B) flp-18 transgenic tobacco lines. Expression was quantified to demonstrate the target specific gene silencing in the nematodes through host delivered RNAi of flp-14 and flp-18. 18S rRNA was used as a reference gene and fold change was calculated by using 2-ΔΔCT method. Fold change values were transformed to personate values. Error bars show +SD among the biological replicates. ** P<0.01.

Percent reduction in the relative transcript levels due to target gene silencing in the females of M. incogntia feeding on the transgenic plants.

(A) Decrease in mRNA abundance in M. incogntia females extracted from (A) flp-14 (B) flp-18 transgenic tobacco lines. Expression was quantified to demonstrate the target specific gene silencing in the nematodes through host delivered RNAi of flp-14 and flp-18. 18S rRNA was used as a reference gene and fold change was calculated by using 2-ΔΔCT method. Fold change values were transformed to personate values. Error bars show +SD among the biological replicates. ** P<0.01.

Discussion

Neuropeptides, particularly FLPs, are associated with probably all physiological systems in nematodes that include sensory systems, feeding, locomotion and reproduction essential for successful parasitism. Therefore, interference of neuropeptides or FLPs can lead to disruption of multiple functions. In view of this, they could be potential targets for crop improvement against nematodes. The existing information on neurobiology of C. elegans and A.suum is very valuable to identify the suitable flp genes for the control of economically important species of root knot nematodes, M. incognita [10,35]. To date, 19 flp genes have been reported in M. incognita [1]. In this direction, focus of the present study was mainly on the validation of two flp genes, flp-14 and flp-18 for M. incognita parasitism through host-delivered RNAi in tobacco. The expression pattern of the genes in three developmental stages demonstrated importance of the target genes in both eggs and infective larval stages. Further, the emphasis was to demonstrate the utility of the cloned genes as suitable targets for in vitro and host-derived RNAi. An unrelated gene, GFP, was used as a negative control to prove the target specific gene silencing during in vitro evaluation. In vitro RNAi of a nematode gene could provide validation for host delivered RNAi of that gene. It has been well established in G. pallida [17], G. rostochiensis [36], Heterodera schactii [37], H. glycines [17,38-41], M. incognita [19,21,22,24,42], M. javanica [43,44] and Pratylechus spp [45]. In the present study, in vitro RNAi of both flp-14 and flp-18 revealed silencing that was adequately supported by penetration assays and expression analysis. Silencing of flp-14 reduced the migration as well as the penetration of M. incogntia J2s. This could be corroborated by transcript quantification that revealed 40% less expression in flp-14 silenced J2s compared to the control worms. Localization of flp-14 in M. incognita indicated its expression in the four SMB-like neurons posterior to the central nerve ring [46]. In C. elegans the SMBs connect indirectly with amphid (sensory) and motor neurons suggesting their role in locomotion and sensory perception. This supports the reduced migration and penetration observed in our study as flp-14 silencing could have interfered with the sensory perception which in turn affected the respective motor function in the dsRNA soaked worms. Similar effects were observed when flp-14 was silenced in G. pallida by soaking in dsRNA for 24 h [18]. Correspondingly, silencing of flp-18 resulted in 84 % transcript knock down in the treated J2s when compared to the control worms. No effect on flp-14 was observed due to the silencing of flp-18 and vice versa indicating target specific gene silencing which was also supported by the absence of any such effects in the GFP silenced worms. Knockdown of flp-18 resulted in reduced migration and penetration of the treated J2s when compared to the control worms reflecting the physiological effect. Earlier reports also showed reduced migration of J2s due to the silencing of flp-18 in M. incognita [15]. Similar effects were also observed in G. pallida when flp-18 was silenced resulting in almost complete inhibition of migratory behavior after 24 hr incubation in dsRNA [18]. Flp-18 is expressed in the neurons that synapse directly onto the pharyngeal muscles and thereby control their action [47]. Localization studies in C. elegans using flp-18 reporter gene constructs revealed its expression in the specific interneurons AVA, AIY and RIG, the motor neuron RIM and pharyngeal neurons M2 and M3 [48]. The AIY neurons are postsynaptic to olfactory, gustatory and thermosensory neurons [49]. Flp-18 mutants in C. elegans were defective in chemosensation, foraging, dauer formation, fat accumulation and also exhibited decreased oxygen consumption [50]. AIY neurons also regulate another food related behavior called local search. When wild type animals are removed from food, they explore a local area, where food is expected, by repeatedly reversing and turning. After about 15 min of food withdrawal, animals switch to exploring larger areas, by inhibiting reversals and turns. Animals lacking the AIY interneurons continue reversing and turning even an hour after removal from food [51-53]. Further release of flp-18 from AIY neurons regulates odor responses, foraging ability and fat metabolism. Since M2 and M3 synapse directly onto the pharyngeal muscle [47], they are responsible for modulation of pharyngeal activity. Ablation of M3 and two other neurons in the larvae of C. elegans lead to changes in feeding behavior and a decline in growth rate [54,55]. Based on these observations and understanding about the flp-18 functions, the observed reduction in migration and penetration could be attributed to the knock down effect of flp-18. The observed phenotypic effects in the plant root growth coupled with the reduction in the nematode infection could be attributed to the reduction in transcripts of flp-14 and flp-18 due to the uptake of dsRNA by the nematodes. Therefore, in vitro RNAi demonstrated the requirement and importance of flp-14 and flp-18 for normal sensory perception and mobility. On confirming the RNAi silencing of flp-14 and flp-18 by in vitro studies, additional proof for the silencing of the two target genes and subsequent effect on the nematode was undertaken by in planta validation using a highly efficient tobacco system. Several molecular analyses demonstrated the integration and inheritance of the T-DNA harboring the dsRNA hairpin construct of both the genes independently. However, more important would be to know how efficiently the highly expressing plants would resist the attack of nematodes. Therefore, the bioefficacy studies would be of prime importance. Stringent observations of the challenged plants did not show any phenotypic variations indicating the focused effect of the RNAi. The selected transgenic plants showed remarkable protection against the nematodes as there was significant reduction in number of galls, females, egg masses etc. indicating the efficacy of the RNAi silencing that interrupted the sensory perception and motor functions. These observations corroborated with the expression analysis as the plants that showed high expression could resist nematode infection better and ultimately resulted in reduced reproduction. The presence of the dsRNA and the siRNA in the transgenic plants provided the ultimate evidence for the host delivered RNAi of flp-18 that resulted in reduced nematode reproduction. The present findings are similar to the earlier report involving injection of FMRFamide related peptides of flp-14 and 15 other flps that exhibited inhibitory actions on the ovijector in A. suum [56]. These effects generally include shortening of the oviduct, consistent with circular muscle relaxation, and a cessation of contractile activity that could affect the egg laying ability of the nematodes. This could be the cause for reduced reproduction in the worms infesting the transgenic tobacco lines expressing flp-14 and flp-18 dsRNA. The response in the bioeffeicacy studies clearly corroborated with the finding of in vitro RNAi emphasizing the need of the selected genes for important functions of the nematode leading to successful parasitism. However, the response to the nematode could depend on a threshold level of transgene expression leading to effective silencing. For this, one of the flp-18 events, A-39.1 was chosen. The event showed very low expression in the qRT-PCR analysis. As supporting evidence, it was observed that the event did not demonstrate bioefficacy as comparable with the other highly expressing events and the corresponding percent reduction of the galls etc was not profound. This clearly showed the requirement of a threshold level of dsRNA expression in the host for the silencing to occur effectively. Similar observation was also seen when the extent of silencing of the gene was quantified by qRT-PCR in the nematodes extracted from the transgenic tobacco plants that were used in the bioefficacy studies. This kind of varied expression levels has not been reported in other host delivered RNAi studies. The results were quite explicit in demonstrating the possibility of host delivered RNAi of the two important FLP genes independently for the management of M. incognita on tobacco. These findings have been adequately supported by the inclusion of negative controls during both in vitro and in planta RNAi experiments. Thus, the observed phenotypic effects can be unequivocally attributed to the target specific gene silencing. Though there are many reports of utility of flps for disrupting the neuromotor function, this is the first established report of host delivered RNAi of flp-14 and flp-18 for the management of M. incognita. The study effectively substantiated that the reduction in nematode multiplication factor was due to the silencing of flp-14 and flp-18. Therefore, it reiterates that the two genes would be of immense value to reduce the initial population densities in the field which in turn could bring down the resident population pressure in the soil for the subsequent crop. This established a proof of concept for using FLP-based RNAi transgenics for the management of M. incognita. Further, it opens options for stacking more than one flp gene to disrupt different functions more efficiently so as to achieve durable management. In addition, the genes and the strategy can also be effectively extended into improvement programs of other crops where the nematode is a serious concern. Hair pin RNAi constructs of (TIF) Click here for additional data file. PCR amplification of (A) Amplification of the target genes from cDNA of Meloidogyne incognita Lanes - 1: 100 bp DNA Ladder, 2: flp-14 (284 bp), 3: flp-18 (407 bp). (B) Confirmation of the inserts in the recombinant pGEM-T vector by EcoRI digestion. Lanes - 1: 100 bp DNA Ladder, 2: Undigested plasmid, 3: flp-14 (284 bp), 4: flp-18 (407 bp). (TIF) Click here for additional data file. PCR analysis of T (A) Amplification of the target genes from T0 transgenic plants using gene specific primers. Lanes - 1: 100 bp DNA Ladder, 2-20: Primary events of flp-14 (342 bp), flp-18 (411 bp) (B) Amplification of sense strand in T0 transgenic events using primers to 35S promoter and attb2. Lanes - 1: 100 bp DNA Ladder, 2-20: Primary events of flp-14 (477 bp), flp-18 (546 bp). (C) Amplification of the antisense strand in T0 transgenic events using primers to amplify 35S terminator and attb2. Lanes - 1: 100 bp DNA Ladder, 2-20: Primary events of flp-14 (441 bp), flp-18 (510 bp). (D) Amplification of nptII gene from primary transgenic events. Lanes - 1: 100 bp DNA Ladder, 2-20: T0 events (750 bp). (TIF) Click here for additional data file. PCR analysis of T (A) Amplification of the target genes from T1 plants using gene specific primers. Lanes - 1: 100 bp DNA Ladder, 2-20: different T1 plants of flp-14 (342 bp), flp-18 (411 bp) (B) 35S promoter and the target gene fragment. Lanes - 1: 100 bp DNA Ladder, 2-20: different T1 events of flp-14 (477 bp), flp-18 (546 bp). (C) 35S terminator and target gene fragment from T1 transgenic events Lanes - 1: 100 bp DNA Ladder, 2-20: different T1 events of flp-14 (441 bp), flp-18 (510 bp). (D) nptII gene fragment. Lanes - 1: 100 bp DNA Ladder, 2-20: different T1 events (750 bp). (TIF) Click here for additional data file.
  49 in total

1.  The pharynx of Caenorhabditis elegans.

Authors:  D G Albertson; J N Thomson
Journal:  Philos Trans R Soc Lond B Biol Sci       Date:  1976-08-10       Impact factor: 6.237

Review 2.  Neuropeptide signaling systems - potential drug targets for parasite and pest control.

Authors:  Aaron G Maule; Angela Mousley; Nikki J Marks; Tim A Day; David P Thompson; Timothy G Geary; David W Halton
Journal:  Curr Top Med Chem       Date:  2002-07       Impact factor: 3.295

3.  Nematode neuropeptides: Localization, isolation and functions.

Authors:  D J Brownlee; I Fairweather; L Holden-Dye; R J Walker
Journal:  Parasitol Today       Date:  1996-09

4.  Host-generated double stranded RNA induces RNAi in plant-parasitic nematodes and protects the host from infection.

Authors:  Bindhya Chal Yadav; Karuppannan Veluthambi; Kuppuswamy Subramaniam
Journal:  Mol Biochem Parasitol       Date:  2006-04-19       Impact factor: 1.759

5.  flp gene disruption in a parasitic nematode reveals motor dysfunction and unusual neuronal sensitivity to RNA interference.

Authors:  Michael J Kimber; Susan McKinney; Steven McMaster; Tim A Day; Colin C Fleming; Aaron G Maule
Journal:  FASEB J       Date:  2007-01-02       Impact factor: 5.191

6.  Detection of putative secreted proteins in the plant-parasitic nematode Heterodera schachtii.

Authors:  Bartel Vanholme; Makedonka Mitreva; Wim Van Criekinge; Marc Logghe; David Bird; James P McCarter; Godelieve Gheysen
Journal:  Parasitol Res       Date:  2005-12-28       Impact factor: 2.289

7.  Coordinated regulation of foraging and metabolism in C. elegans by RFamide neuropeptide signaling.

Authors:  Merav Cohen; Vincenzina Reale; Birgitta Olofsson; Andrew Knights; Peter Evans; Mario de Bono
Journal:  Cell Metab       Date:  2009-04       Impact factor: 27.287

8.  Neurons regulating the duration of forward locomotion in Caenorhabditis elegans.

Authors:  Tokumitsu Wakabayashi; Izumi Kitagawa; Ryuzo Shingai
Journal:  Neurosci Res       Date:  2004-09       Impact factor: 3.304

9.  Host-delivered RNAi: an effective strategy to silence genes in plant parasitic nematodes.

Authors:  David J Fairbairn; Antonino S Cavallaro; Margaret Bernard; Janani Mahalinga-Iyer; Michael W Graham; José R Botella
Journal:  Planta       Date:  2007-07-25       Impact factor: 4.116

10.  Silencing a candidate nematode effector gene corresponding to the tomato resistance gene Mi-1 leads to acquisition of virulence.

Authors:  Cynthia A Gleason; Qingli L Liu; Valerie M Williamson
Journal:  Mol Plant Microbe Interact       Date:  2008-05       Impact factor: 4.171

View more
  27 in total

1.  Ipomoea batatas: papain propeptide inhibits cysteine protease in main plant parasites and enhances resistance of transgenic tomato to parasites.

Authors:  Haidar Saify Nabiabad; Massoume Amini; Farzad Kianersi
Journal:  Physiol Mol Biol Plants       Date:  2019-06-05

2.  Transcriptome analysis of root-knot nematode (Meloidogyne incognita)-infected tomato (Solanum lycopersicum) roots reveals complex gene expression profiles and metabolic networks of both host and nematode during susceptible and resistance responses.

Authors:  Neha Shukla; Rachita Yadav; Pritam Kaur; Simon Rasmussen; Shailendra Goel; Manu Agarwal; Arun Jagannath; Ramneek Gupta; Amar Kumar
Journal:  Mol Plant Pathol       Date:  2017-04-24       Impact factor: 5.663

3.  A novel in vitro chemotaxis bioassay to assess the response of Meloidogyne incognita towards various test compounds.

Authors:  Tagginahalli N Shivakumara; Tushar K Dutta; Uma Rao
Journal:  J Nematol       Date:  2018       Impact factor: 1.402

4.  Host-induced silencing of Mi-msp-1 confers resistance to root-knot nematode Meloidogyne incognita in eggplant.

Authors:  Sonam Chaudhary; Tushar K Dutta; Nidhi Tyagi; Tagginahalli N Shivakumara; Pradeep K Papolu; Kapil A Chobhe; Uma Rao
Journal:  Transgenic Res       Date:  2019-04-06       Impact factor: 2.788

Review 5.  RNA interference and crop protection against biotic stresses.

Authors:  Ranjeet Kaur; Aparajita Choudhury; Sambhavana Chauhan; Arundhati Ghosh; Ruby Tiwari; Manchikatla Venkat Rajam
Journal:  Physiol Mol Biol Plants       Date:  2021-09-22

6.  Genomes of parasitic nematodes (Meloidogyne hapla, Meloidogyne incognita, Ascaris suum and Brugia malayi) have a reduced complement of small RNA interference pathway genes: knockdown can reduce host infectivity of M. incognita.

Authors:  Sadia Iqbal; John Fosu-Nyarko; Michael G K Jones
Journal:  Funct Integr Genomics       Date:  2016-04-28       Impact factor: 3.410

7.  Exogenous administration of dsRNA for the demonstration of RNAi in Maruca vitrata (lepidoptera: crambidae).

Authors:  Madhurima Chatterjee; Jyoti Yadav; Maniraj Rathinam; Abhishek Mandal; Gopal Chowdhary; Rohini Sreevathsa; Uma Rao
Journal:  3 Biotech       Date:  2021-03-27       Impact factor: 2.406

Review 8.  The FMRFamide-Like Peptide Family in Nematodes.

Authors:  Katleen Peymen; Jan Watteyne; Lotte Frooninckx; Liliane Schoofs; Isabel Beets
Journal:  Front Endocrinol (Lausanne)       Date:  2014-06-16       Impact factor: 5.555

9.  Tomato transgenic plants expressing hairpin construct of a nematode protease gene conferred enhanced resistance to root-knot nematodes.

Authors:  Tushar K Dutta; Pradeep K Papolu; Prakash Banakar; Divya Choudhary; Anil Sirohi; Uma Rao
Journal:  Front Microbiol       Date:  2015-04-01       Impact factor: 5.640

Review 10.  The status of RNAi-based transgenic research in plant nematology.

Authors:  Tushar K Dutta; Prakash Banakar; Uma Rao
Journal:  Front Microbiol       Date:  2015-01-12       Impact factor: 5.640

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.