Literature DB >> 24204936

Molecular evidence for Lessepsian invasion of soritids (larger symbiont bearing benthic foraminifera).

Gily Merkado1, Maria Holzmann, Laure Apothéloz-Perret-Gentil, Jan Pawlowski, Uri Abdu, Ahuva Almogi-Labin, Orit Hyams-Kaphzan, Anna Bakhrat, Sigal Abramovich.   

Abstract

The Mediterranean Sea is considered as one of the hotspots of marine bioinvasions, largely due to the influx of tropical species migrating through the Suez Canal, so-called Lessepsian migrants. Several cases of Lessepsian migration have been documented recently, however, little is known about the ecological characteristics of the migrating species and their aptitude to colonize the new areas. This study focused on Red Sea soritids, larger symbiont-bearing benthic foraminifera (LBF) that are indicative of tropical and subtropical environments and were recently found in the Israeli coast of the Eastern Mediterranean. We combined molecular phylogenetic analyses of soritids and their algal symbionts as well as network analysis of Sorites orbiculus Forskål to compare populations from the Gulf of Elat (northern Red Sea) and from a known hotspot in Shikmona (northern Israel) that consists of a single population of S. orbiculus. Our phylogenetic analyses show that all specimens found in Shikmona are genetically identical to a population of S. orbiculus living on a similar shallow water pebbles habitat in the Gulf of Elat. Our analyses also show that the symbionts found in Shikmona and Elat soritids belong to the Symbiodinium clade F5, which is common in the Red Sea and also present in the Indian Ocean and Caribbean Sea. Our study therefore provides the first genetic and ecological evidences that indicate that modern population of soritids found on the Mediterranean coast of Israel is probably Lessepsian, and is less likely the descendant of a native ancient Mediterranean species.

Entities:  

Mesh:

Year:  2013        PMID: 24204936      PMCID: PMC3812231          DOI: 10.1371/journal.pone.0077725

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction: The Lessepsian Invasion

In the last few decades, we have been witnessing a dramatic and rapid change in the composition of the marine biota of the eastern Mediterranean due to invasion of alien species [1]–[3]. The majority of the invasive species are tropical, of Indo-Pacific origin, which migrated from the Red Sea to the Mediterranean through the Suez Canal. These organisms, called Lessepsian migrants constitute a growing component of the biodiversity in the Eastern Mediterranean Sea. There are three main factors that promote this Lessepsian invasion phenomenon. First, the opening of the Suez Canal in 1869 that created an artificial connection between the Mediterranean and the Indo-Pacific realm via the Red Sea (Figure 1). Second the ongoing warming of sea surface temperatures in the last decades [4], [5]. This process enables tropical species to survive, mostly in the Eastern Mediterranean basin, with a potential to spread also to the western basin with the continuation of the warming trend. Third, the damming of the Nile River in 1965 by the high Aswan Dam in Egypt. The dam has blocked nutrients from discharging into the Eastern Mediterranean and created hyper-oligotrophic conditions there, suitable for many tropical species [6]–[8]. Until now more than 500 alien species have been reported, and many more are being discovered each year, making the Mediterranean a hotspot of marine bioinvasions [1], [3], [9]. The ecological, environmental and economic aspects of this phenomenon have received a great scientific interest in past few years (see discussion in [10]; www.ciesm.org/atlas).
Figure 1

The two study localities in the Gulf of Elat, northern Red Sea represent different environments: Halophila stipulacea seagrass meadows at Tur Yam, and the shallow water environment with pebbles in front of the IUI station.

In the Mediterranean, living specimens were studied from a known hotspot of soritids in Shikmona, Haifa. The longshore current dictates the anticlockwise distribution of the Lessepsian invaders.

The two study localities in the Gulf of Elat, northern Red Sea represent different environments: Halophila stipulacea seagrass meadows at Tur Yam, and the shallow water environment with pebbles in front of the IUI station.

In the Mediterranean, living specimens were studied from a known hotspot of soritids in Shikmona, Haifa. The longshore current dictates the anticlockwise distribution of the Lessepsian invaders. The Lessepsian invaders have a significant impact on the species composition and the ecosystem in the receiving environment. Studies have shown that the invasive population can outcompete the indigenous population, and become dominant in a certain habitat (see examples in [11]). Other studies showed that the appearance of a new species might change the foraging patterns of certain species, due to the introduction of new prey [10], [12]. Introduction of new species to the Mediterranean, such as the jellyfish Rhopilema nomadica had a major impact on the fisheries, tourism and coastal installations [11]. Among the Lessepsian invaders, are larger symbiont-bearing benthic foraminiferal species (LBF) that often serve as sensitive marine bioindicators of ecological stress [13], [14]. LBF defines a group with shell size generally larger than 2 mm in diameter that are typical to warm and shallow oligotrophic tropical and subtropical oceans [13], [15]. Species of this group are known to respond to rising temperatures over a certain level in a similar way as corals, by losing their endosymbionts in a phenomenon known as bleaching [16], [17]. The tempo and scale of their invasion from the Red Sea into the Eastern Mediterranean provides a unique opportunity to evaluate the processes and mechanism that promotes tropical invasion of coral reef associated organisms. In this study, we used Red Sea soritids (LBF) that have recently invaded the Eastern Mediterranean as a model system for unique characterization of the ongoing Lessepsian invasion. Soritids are larger benthic miliolids that inhabit recent tropical and subtropical oligotrophic water, and are characterized by a large porcelaneous discoidal test and dinoflagellate symbionts belonging to the Symbiodinium species complex. In this study, we combined molecular phylogenetic analysis of the soritids and their algal symbionts to compare their populations from the Gulf of Elat, northern Red Sea and from the Mediterranean locality off Shikmona. Our data provide the first evidence on the source of the living populations of soritids in the Eastern Mediterranean coast.

Methods

The Study Area

The Eastern Mediterranean

The Eastern Mediterranean is defined by its extreme oligotrophy and higher salinity and temperature values: Summer sea surface temperatures (SST) reach a tropical value of 30°C with salinity as high as 39.7 [18], [19]. Over the past 44 years, an increase of >2°C has been recorded in the Eastern Mediterranean, most of which occurred since the 80’s. The rate of warming in the Mediterranean Sea, based on satellite data from 1990–2006, is 0.067°C per year, more than double the global forecasts [4], [20]. Soritids, namely Sorites orbiculus were once common in the Tethyan Mediterranean and were found in cores from Ashqelon (Southern Israel), in sediments from marine isotopic stage 9 and 8, 320-250 ka BP [21], [22]. This species was also found in Holocene cores (2 ka BP) taken from the inner harbor in Caesarea (Northern Israel) [23]. Recent soritids have been reported from various sites in the Mediterranean and have been considered as aliens [3], [8], [24], [25]. Living specimens of soritids are now found throughout the rocky environments in the region and forming a known hotspot in Shikmona (northern Israel, N32 49.450 E034 57.273), which was selected as the target area of this study. At this location specimens were collected from pebbles from abrasion platforms, at a water depth of ∼20 cm (Figures 1–2).
Figure 2

Habitat types of soritids in the Gulf of Elat and Shikmona.

A–C. Pebbles and boulders at IUI station. A. Wide view of the habitat. B–C. Closer views of the algae that cover the pebbles. Note the specimen of S. orbiculus attached to the algae and the associated LBF species. D–F. Seagrass meadows (H. stipulacea) at Tur Yam. D. Wide view of the habitat. E. A. hemprichii attached to H. stipulacea leaves. F. Specimens attached to H. stipulacea stem. G–I Beach rock environment with pebbles at Shikmona. G. Wide view of the habitat; H–I. Closer view on the living specimens of S. orbiculus attached to the pebbles.

Habitat types of soritids in the Gulf of Elat and Shikmona.

A–C. Pebbles and boulders at IUI station. A. Wide view of the habitat. B–C. Closer views of the algae that cover the pebbles. Note the specimen of S. orbiculus attached to the algae and the associated LBF species. D–F. Seagrass meadows (H. stipulacea) at Tur Yam. D. Wide view of the habitat. E. A. hemprichii attached to H. stipulacea leaves. F. Specimens attached to H. stipulacea stem. G–I Beach rock environment with pebbles at Shikmona. G. Wide view of the habitat; H–I. Closer view on the living specimens of S. orbiculus attached to the pebbles.

The Gulf of Elat

The Gulf of Elat is a morpho-tectonic branch of the Red Sea, which is a part of the Syrian African rift system. It is situated in the desert between the Sinai and the Arabian peninsulas, an area characterized by high evaporation rates due to high temperatures and dry air. There are minor seasonal fluctuations in the water temperature (20.5–27.4°C) and salinity (40.3–41.6). Dissolved oxygen values are close to 100% for the entire water column, and the gulf’s water is considered to be oligotrophic [26]. Soritids are abundantly found in the Gulf of Elat, represented by three morphospecies: Sorites orbiculus Forskål, Sorites variabilis Lacroix, and Amphisorus hemprichii Ehrenberg, genetically assigned to three phylotypes with some additional branching of S. orbiculus [27]. They occupy various habitats including seagrass and macroalgae on rocks up to 35 meters depth [26], [28]. Specimens collected for this study were taken from two stations that represent different habitats of soritids in the Gulf (Figures 1 and 2): 1. Tur Yam characterized by Halophila stipulacea seagrass meadow, south of the port of Elat (N29 31.042 E034 55.590), at a water depth of 5 meters. 2. The Interuniversity Institute of Marine Sciences in Elat (IUI) characterized by pebbles at water depths of 5 meters and less than 2 meters (N29 30.653 E034 55.454).

Specimen Collection

Living specimens of the soritids were collected from various depths along the Israeli Mediterranean coast and the Gulf of Elat, under the official approval of Israel Nature and Parks Authority (Figure 1, Table 1). The morphological distinction of the species followed the taxonomical conception of [29]. Specimens were collected alive with the substrate they lived on (seagrass or pebbles, Figure 2). In the laboratory, each specimen was examined under the binocular in order to see the algal symbionts and the pseudopods emerging from the thickened peristomal-rimmed apertures at the peripheral margin, confirming that the specimen is indeed alive. The living foraminifera were cleaned of food remains, sand and algae by a delicate brush and photographed with a digital microscope color camera (Leica, DFC290HD).
Table 1

Sampling locations, depths, habitats and abundances of live and dead Soritids that were found in the Mediterranean and Gulf of Elat.

Station/Sampling yearCoordinatesWaterDepth (m)Habitat
Live specimensGulf of ElatTur Yam (2011–2012)1 N29 31.04 E34 55.595 Halophila stipulacea sea grass
IUI (2011–2012)1 N29 30.65 E34 55.452Pebbles and rocks
IUI (2011–2012)1 N29 30.65 E34 55.455Pebbles and rocks
MediterraneanShikmona (2011–2012) 1 Soritids hotspotN32 49.45 E34 57.270.2Pebbles and rocks, abrasion platform
Recently dead specimensMediterraneanAkhziv (1999)2, 3 N33 04.15 E35 06.493–30Carbonate rich-substrate (rocky or sandy) with macroalgae
Akhziv (1998)2 N33 03.30 E35 04.2341.5Carbonate rich-substrate with macroalgae
Dado, Haifa (1996)2 N32 47.03 E34 55.5225Sandy
Dor (1998)2 N32 36 30 E34 54 1715Sandy
Herzeliyya (1998)2 N32 08 09 E34 46 269Sandy
Shikmona (2003–2004) 4 N32 49.34 E34 57.151–1.5Macroalgae: Cystoseira sp.
Fossil recordMediterraneanAshqelon (2000)3, 5, Borehole K20N31 63.10 E34 50.7769.5–84.5 mbslCarbonate rich-substrate (rocky or sandy) with macroalgae
Ashqelon (2000)3, 5, Borehole K38N31 62.53 E34 49.3683.4–90.4 mbslCarbonate rich-substrate (rocky or sandy) with macroalgae
Caesarea (1994)6, Core CN32 30.06 E34 53.28+0.86 to −2.29 mbslSandy substrate probably with vegetation

m bsl = meters below sea level.

This study;

Hyams et al., 2002;

Lazar, 2007;

Gruber et al., 2007;

Avital, 2002;

Toueg, 1996.

m bsl = meters below sea level. This study; Hyams et al., 2002; Lazar, 2007; Gruber et al., 2007; Avital, 2002; Toueg, 1996. We also reexamined the morphology of dead soritids specimens that were collected from recent sediments along the Israeli Mediterranean shelf in previous studies [6], [22], [30] in order to estimate whether a morphological variation can be detected between recent and fossil soritids (Table 1).

DNA Extraction, Amplification and Sequencing

The DNA was extracted from single specimens using guanidinium buffer as described in [31]. Part of the test was kept for the morphological documentation using a Scanning Electron Microscope (SEM). For each genetic type, multiple specimens were sequenced. A fragment of the SSU rDNA (∼800 bp) was amplified by semi nested PCR in two overlapping fragments. For the first PCR 1 µl of the purified DNA was used in a total volume of 50 µl, with primers s14F3-NewB (Table 2). Thermal cycles used were: 30 seconds at 98°C, 5 seconds at 98°C, 20 seconds at 60°C and 30 seconds at 72°C. This cycle was repeated 35 times. The last cycle was followed by 5 minutes at 72°C for final elongation. For the second PCR, 1 µl of the first PCR product was used in a volume of 50 µl with primers s14F1-NewB (Table 2) and the same thermal cycles as the first PCR.
Table 2

PCR primers used for amplification and reamplification of soritid SSU genes and Symbiodinium ITS and LSU genes.

NameSequenceForwardReverseAmplificationReamplification
14F35′acgca(ac)gtgtgaaacttgXX
14F15′aagggcaccacaagaacgcXX
New B5′tgccttgttcgacttctcXXX
S-Dino5′cgctcctaccgattgagtgaXX
L05′gctatcctgag(ag)gaaacttcgXX
ITS-Dino5′gtgaattgcagaactccXX
The amplified products were purified from gel and ligated into a pJET1.2 Plasmid using clone JET PCR cloning kit. Ligation mix was transformated into DH5α competent bacteria. Plasmids were extracted by Qiagen MiniPrep kit. For each specimen at least two clones were sequenced in order to look for variability within the specimen. DNA amplification and reamplification of symbionts followed the same protocol as used for the PCR of soritid rRNA genes, primers are given in Table 2. A fragment of about 1100 bp comprising 5.8S rDNA, ITS2 and partial LSU rDNA was obtained for dinoflagellate symbionts of different host extractions (Table 3). The amplified PCR products were purified using High Pure PCR Purification Kit (Roche Diagnostics), cloned with the TOPO TA Cloning Kit (Invitrogen) following the manufacturer’s instructions and transformed into competent Escherichia coli. Up to three Symbiodinium clones were sequenced for each host specimen. Sequencing reactions were performed using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) and analyzed on a 3130XL Genetic Analyzer (Applied Biosystems). The new sequences reported in this paper were deposited in the EMBL/GenBank database and their accession numbers are listed in Tables 3 and 4.
Table 3

Details on symbiont sequences obtained in this study.

Host speciesHost isolateSampling localityNr. of sequenced clonesSymbiont typeSymbiont accession nr.
A. hemprichii 1363Elat2F5HF582847, HF582848
A. hemprichii 12985IUI, Elat3F5HF582823, HF582832, HF582833
A. hemprichii 12986IUI, Elat2F2, F5HF582801, HF582821
S. orbiculus 29Shikmona3F5HF582834, HF582835, HF582836
S. orbiculus 55Shikmona3F5HF582837, HF582838, HF582839
S. orbiculus 65Shikmona2F5HF582840, HF582841
S. orbiculus 70Shikmona3F5HF582822, HF582830, HF582831
S. orbiculus 71Shikmona1F5HF582842
S. orbiculus 72Shikmona1F5HF582843
S. orbiculus 73Shikmona,3F5HF582844, HF582845, HF582846
S. orbiculus 206Safaga, Red Sea3F2HF582798, HF582799, HF582800
S. orbiculus 1283Elat2F5HF582849, HF582850
S. orbiculus 1284Elat3F5HF582851, HF582852, HF582853
S. orbiculus 13461Tur Yam, Elat2F5HF582820, HF582824
S. orbiculus 13464Tur Yam, Elat3F5HF582825, HF582826, HF582827
S. orbiculus 13467Tur Yam, Elat2F5HF582828, HF582829
S. variabilis 1275Elat2F2HF582805, HF582808
S. variabilis 12979IUI, Elat3F2HF582809, HF582810, HF582811
S. variabilis 12981IUI, Elat1F2HF582812
S. variabilis 12982IUI, Elat1F2HF582813
S. variabilis 13473IUI, Elat2F2HF582814, HF582815
S. variabilis 13478IUI, Elat3F2HF582816, HF582817, HF582818
S. variabilis 13479IUI, Elat3F2HF582802, HF582803, HF582804
S. variabilis 13480IUI, Elat2F2HF582806, HF582807,
S. variabilis 13481IUI, Elat1F2HF582819
Table 4

Details on soritid sequences obtained in this study and published data.

SpeciesIsolateSampling localitySamplingdepth (m)HabitatNr. of sequenced clonesAccession nr.Haplotype
Amphisorus hemprichii 12987IUI, Elat5Pebbles2HF582900, HF582903
Amphisorus hemprichii 12985IUI, Elat5Pebbles1HF582901
Amphisorus hemprichii 12986IUI, Elat5Pebbles1HF582902
Amphisorus hemprichii 26Tur Yam, Elat5Seagrass1HF582904
Amphisorus hemprichii 92Tur Yam, Elat5Seagrass1HF582905
Amphisorus hemprichii 87Tur Yam, Elat5Seagrass3HF582906, HF582907, HF582908
Amphisorus hemprichii 1305Tabanot identifiednot identified1AJ278052
Amphisorus hemprichii 1366Elatnot identifiednot identified1AJ278048
Amphisorus hemprichii 1361Elatnot identifiednot identified1AJ404315
Amphisorus hemprichii 1363Tabanot identifiednot identified1AJ278049
Amphisorus kudakajimaensis 1635Guamnot identifiednot identified1AJ404316
Amphisorus kudakajimaensis 1636Guamnot identifiednot identified1AJ278050
Amphisorus kudakajimaensis 337Japan: Sesokonot identifiednot identified1AJ278051
Marginopora vertebralis 500Australia: Lizard Islandnot identifiednot identified1AJ278058
Marginopora vertebralis 478Australia: Lizard Islandnot identifiednot identified1AJ278060
Marginopora vertebralis 499Australia: Lizard Islandnot identifiednot identified1AJ404312
Marginopora vertebralis 1610Guamnot identifiednot identified1AJ278059
Marginopora vertebralis 1686Guamnot identifiednot identified1AJ278062
Marginopora vertebralis 1645Guamnot identifiednot identified1AJ278061
Parasorites sp.1634Guamnot identifiednot identified1AJ404305
Sorites orbiculus 13464Tur Yam, Elat5Seagrass2HF582855, HF582856H2
Sorites orbiculus 13467Tur Yam, Elat5Seagrass1HF582857H2
Sorites orbiculus 13461Tur Yam, Elat5Seagrass1HF582858H2
Sorites orbiculus 29Shikmona0.2Pebbles3HF582859, HF582864, HF582865H1
Sorites orbiculus 55Shikmona0.2Pebbles3HF582860, HF582862 HF582866H1
Sorites orbiculus 85IUI, Elat2Pebbles2HF582861 HF582879H1
Sorites orbiculus 65Shikmona0.2Pebbles3HF582863 HF582867, HF582868H1
Sorites orbiculus 70Shikmona0.2Pebbles1HF582869H1
Sorites orbiculus 71Shikmona0.2Pebbles3HF582870 HF582871 HF582880H1
Sorites orbiculus 72Shikmona0.2Pebbles1HF582872H1
Sorites orbiculus 73Shikmona0.2Pebbles1HF582873H1
Sorites orbiculus 76Shikmona0.2Pebbles2HF582874 HF582875H1
Sorites orbiculus 80IUI, Elat2Pebbles2HF582876 HF582881H1
Sorites orbiculus 81IUI, Elat2Pebbles2HF582877 HF582882H1
Sorites orbiculus 84IUI, Elat2Pebbles2HF582878 HF582885H1
Sorites orbiculus 82IUI, Elat2Pebbles1HF582883H1
Sorites orbiculus 83IUI, Elat2Pebbles1HF582884H1
Sorites orbiculus 1678Guamnot identifiednot identified1AJ278055H4
Sorites orbiculus 1629Guamnot identifiednot identified1AJ278053H3
Sorites orbiculus 751aUSA: Florida Keysnot identifiednot identified1AJ278056H3
Sorites orbiculus 1282Elatnot identifiednot identified1AJ278057H1
Sorites orbiculus 1305Tabanot identifiednot identified1AJ404310H2
Sorites sp.1591aGuamnot identifiednot identified1AJ278054
Sorites sp.489Australia:Lizard Islandnot identifiednot identified1AJ404309
Sorites sp.1368Elatnot identifiednot identified1AJ404311
Sorites sp.836Florida Keysnot identifiednot identified1AJ404308
Sorites variabilis 12982IUI, Elat5Pebbles2HF582887 HF582888
Sorites variabilis 13472IUI, Elat5Pebbles1HF582889
Sorites variabilis 13480IUI, Elat5Pebbles2HF582890 HF582896
Sorites variabilis 13478IUI, Elat5Pebbles1HF582891
Sorites variabilis 13479IUI, Elat5Pebbles1HF582892
Sorites variabilis 13481IUI, Elat5Pebbles1HF582893
Sorites variabilis 13477IUI, Elat5Pebbles1HF582894
Sorites variabilis 13473IUI, Elat5Pebbles1HF582895
Sorites variabilis 12979IUI, Elat5Pebbles3HF582897, HF582886 HF582898
Sorites variabilis 12981IUI, Elat5Pebbles1HF582899
Sorites variabilis 1333Elatnot identifiednot identified1AJ404313

Sequence Analyses

The soritids sequences were automatically aligned with soritids sequences from NCBI GenBank (published by [27]) using Seaview 4.3.3. [32]. Phylogenetic analysis was based on the maximum likelihood (ML) method using PhyML3.0 program [33] under the GTR+G model based on MEGA5 [34]. The Bayesian analysis was performed with MrBayes 3.1.2 [35]. The tree was rooted on Parasorites Douville the closest sister group to Soritinae [27] (Figure 3). The analysis consisted of four simultaneous chains that were run for 1,100,000 generations, and 4400 trees were sampled, 1100 of which were discarded as burn-in. Posterior probabilities at all nodes were estimated for the remaining trees.
Figure 3

Bayesian phylogenetic tree (GTR+I+Γ) showing the phylogenetic position of 72 partial SSU 18S rDNA of soritids.

The 52 sequences obtained for this study are marked by their DNA isolate numbers. Numbers at nodes indicate (from left to right) posterior probabilities (BI) and bootstrap values (ML). The tree is rooted on Parasorites sp.

Bayesian phylogenetic tree (GTR+I+Γ) showing the phylogenetic position of 72 partial SSU 18S rDNA of soritids.

The 52 sequences obtained for this study are marked by their DNA isolate numbers. Numbers at nodes indicate (from left to right) posterior probabilities (BI) and bootstrap values (ML). The tree is rooted on Parasorites sp. Median joining network was drawn using Network software (www.fluxus-engineering.com) according to [36]. The analysis was based on all mutations (indels and substitutions) of S. orbiculus (Figure 4). In the first run all mutations were equally weighted. In the second run sites were weighted inversely proportional to their frequency in order to take account of recurrent mutations.
Figure 4

Median joining network for four haplotypes of Sorites orbiculus based on 37 sequences.

Numbers in light grey correspond to mutated positions. Circle sizes of haplotypes H1 to H4 are proportional to the number of identical sequences they contain. Each color corresponds to a different locality. Red dots indicate missing haplotypes (extinct or not sampled).

Median joining network for four haplotypes of Sorites orbiculus based on 37 sequences.

Numbers in light grey correspond to mutated positions. Circle sizes of haplotypes H1 to H4 are proportional to the number of identical sequences they contain. Each color corresponds to a different locality. Red dots indicate missing haplotypes (extinct or not sampled). The Symbiodinium sequences were aligned to an existing database using Seaview 4.3.3. [32]. Based on MEGA5 [34], a GTR+G model of evolutionary changes was selected. A phylogenetic tree was constructed using RAxML as implemented in BlackBox [37] (Figure 5). Bayesian analysis was performed with MrBayes 3.2.1 [35]. The analysis consisted of four simultaneous chains that were run for 10,000,000 generations, and 10,000 trees were sampled, 2000 of which were discarded as burn-in. Posterior probabilities at all nodes were estimated for the remaining trees.
Figure 5

Bayesian phylogenetic tree (GTR+G model) showing the phylogenetic position of 140 partial 5.8S rDNA, ITS2 and LSU rDNA sequences of Symbiodinium.

The 56 sequences obtained for this study are marked by their DNA isolate numbers. Numbers at nodes indicate (from left to right) posterior probabilities (BI) and bootstrap values (ML). The tree was rooted with Protodinium, Polarella and Pelagodinium.

Bayesian phylogenetic tree (GTR+G model) showing the phylogenetic position of 140 partial 5.8S rDNA, ITS2 and LSU rDNA sequences of Symbiodinium.

The 56 sequences obtained for this study are marked by their DNA isolate numbers. Numbers at nodes indicate (from left to right) posterior probabilities (BI) and bootstrap values (ML). The tree was rooted with Protodinium, Polarella and Pelagodinium.

Results

Habitat Characterization and Morphological Distinctions

Living specimens of A. hemprichii and S. variabilis were found only in the Gulf of Elat attached to rock pebbles at variable water depths (typically >1 m) or to Halophila leaves or stalks. Sorites variabilis mainly differs from A. hemprichii by having a much thinner test (±120 µm) and a single row of apertures. Both S. variabilis and A. hemprichii are morphologically distinguishable from S. orbiculus by the appearance of faint or no rim surrounding their apertures (Figures 6–7).
Figure 6

Specimens of Sorites orbiculus Forskål from the Gulf of Elat and the Eastern Mediterranean Israeli coast, showing the large variability of apertural shapes and arrangement among specimens and also within single specimens.

1–4. Gulf of Elat: 1. Lateral view of live individual (IUI, 2 m, rocks/pebbles), digital camera, scale 500 µm; 2. Details of chambers with symbionts, digital camera, scale 100 µm; 3. Oblique apertural view (Tur Yam, 5 m, seagrass), SEM, scale 20 µm; 4. Oblique apertural face showing variation in apertural shapes from a single row of 8-shaphed aperture to two separate aperture rows, in early growth stage bordered with a thickened peristomal rim, SEM, scale 100 µm; 5–8. Shikmona (0.5–1.5 m). 5. Lateral view of live individual 0.2 m, rocks/pebbles, digital camera, scale 500 µm; 6. Detailed apertural face with pitting and two separate rows of apertures in alternating radial position and auxiliary aperture, SEM, scale 100 µm; 7. Apertural face in early growth stage with 8-shaped apertures, SEM, scale 100 µm; 8. Apertural face showing a late growth stage with separated apertures, each with complete, circular or irregularly folded peristome, Gruber et al., 2007, SEM, scale 50 µm; 9–11. Transect C-6, Caesarea (1.29 m below surface) fossil material (Toueg, 1996), SEM. 9. Lateral view, scale 500 µm; 10. Oblique profile view, scale 500 µm; 11. Detail of Fig. 10, scale 20 µm; 12–14. Borehole K-20 Ashqelon, fossil material (Avital, 2002, Lazar, 2007): 12–13. 63.95 m below top core; 12. Lateral view, digital camera, scale 1 mm; 13. Lateral view, SEM, scale 500 µm; 14. Oblique profile view showing two rows of oval apertures with peristomal rims (65.5 m below surface), SEM scale 100 µm.

Figure 7

Specimens of Sorites variabilis and Amphisorus hemprichii showing a faint rim around the apertures.

1–2. S. variabilis. 1. Lateral view of live specimen, digital camera, scale 100 µm; 2. Apertural face with faint rim around the apertures, SEM scale 50 µm; 3. Apertural face of A. hemprichii with faint rim around the apertures, SEM scale 50 µm.

Specimens of Sorites orbiculus Forskål from the Gulf of Elat and the Eastern Mediterranean Israeli coast, showing the large variability of apertural shapes and arrangement among specimens and also within single specimens.

1–4. Gulf of Elat: 1. Lateral view of live individual (IUI, 2 m, rocks/pebbles), digital camera, scale 500 µm; 2. Details of chambers with symbionts, digital camera, scale 100 µm; 3. Oblique apertural view (Tur Yam, 5 m, seagrass), SEM, scale 20 µm; 4. Oblique apertural face showing variation in apertural shapes from a single row of 8-shaphed aperture to two separate aperture rows, in early growth stage bordered with a thickened peristomal rim, SEM, scale 100 µm; 5–8. Shikmona (0.5–1.5 m). 5. Lateral view of live individual 0.2 m, rocks/pebbles, digital camera, scale 500 µm; 6. Detailed apertural face with pitting and two separate rows of apertures in alternating radial position and auxiliary aperture, SEM, scale 100 µm; 7. Apertural face in early growth stage with 8-shaped apertures, SEM, scale 100 µm; 8. Apertural face showing a late growth stage with separated apertures, each with complete, circular or irregularly folded peristome, Gruber et al., 2007, SEM, scale 50 µm; 9–11. Transect C-6, Caesarea (1.29 m below surface) fossil material (Toueg, 1996), SEM. 9. Lateral view, scale 500 µm; 10. Oblique profile view, scale 500 µm; 11. Detail of Fig. 10, scale 20 µm; 12–14. Borehole K-20 Ashqelon, fossil material (Avital, 2002, Lazar, 2007): 12–13. 63.95 m below top core; 12. Lateral view, digital camera, scale 1 mm; 13. Lateral view, SEM, scale 500 µm; 14. Oblique profile view showing two rows of oval apertures with peristomal rims (65.5 m below surface), SEM scale 100 µm.

Specimens of Sorites variabilis and Amphisorus hemprichii showing a faint rim around the apertures.

1–2. S. variabilis. 1. Lateral view of live specimen, digital camera, scale 100 µm; 2. Apertural face with faint rim around the apertures, SEM scale 50 µm; 3. Apertural face of A. hemprichii with faint rim around the apertures, SEM scale 50 µm. Sorites orbiculus was found alive in the Gulf of Elat as well as in high numbers in Shikmona. In Elat, it was found attached to rock pebbles at water depths of about 1 m or attached to H. stipulacea leaves. It is slightly thicker than S. variabilis (±160 µm) and has apertures surrounded by a distinct rim (Figure 6). Specimens of this species show a great variability in the shape and number of rows of apertures. They appear either in one or two rows, occasionally two are fused into one large, 8 shaped aperture. In some specimens auxiliary apertures are seen (Figure 6). Morphological identification of the specimens collected in Shikmona, indicated that they all belong to the species S. orbiculus (Figure 6). No morphological difference was found between specimens of S. orbiculus from different habitats (seagrass and pebbles) from the Gulf of Elat, the living specimens from Shikmona and the fossils specimens from the Mediterranean.

Genetic Analysis of the Foraminifera

A fragment of the SSU rDNA, (800 basepairs) was obtained from 32 specimens of the morpho species S. orbiculus, S. variabilis and A. hemprichii collected from the different stations in the Gulf of Elat and Shikmona (Figure 3, Table 4). The obtained sequences were compared to sequences from the NCBI GenBank of 27 specimens of the three species plus Marginopora vertebralis and Parasorites sp., used as outgroup (Table 4). The phylogenetic tree constructed from these sequences shows that the soritids cluster into two main clades: S. variabilis/A. hemprichii and M. vertebralis/Sorites spp. (92% BV and 96% BV, respectively). The S. variabilis/A. hemprichii clade is divided into two distinct subclades corresponding to A. hemprichii and S. variabilis (each supported by 100% BV), that were found only in Elat. The M. vertebralis/Sorites spp. clade comprises two distinct clades M. vertebralis and S. orbiculus (97% BV and 81% BV, respectively). As the phylogenetic analyses of soritids do not show a significant support of the S. orbiculus clade we added a population genetic analysis to investigate intraspecific relationships in this species (Figure 4) as suggested for such cases by [38]. The network was drawn using all sequences (37) of S. orbiculus with a total of 28 mutated sites. Sequences present in each haplotype are reported in Table 4. Our results indicate that S. orbiculus splits into four different haplotypes. Haplotypes H1 and H3 each occur in two different localities. The haplotypes H2 and H4 are present in one locality only. Specimens of S. orbiculus from the Gulf of Elat and Shikmona split into two distinct haplotypes, each one present in a different type of habitat: shallow water pebbles (H1) and the seaweed H. stipulacea (H2). All specimens of S. orbiculus from Shikmona were found to be genetically identical to the specimens from the shallow water pebbles at Elat (H1).

Genetic Analysis of the Algal Symbionts

Congruent results are obtained by RAxML and Bayesian analyses of combined partial ITS and LSU rDNA sequences of Symbiodinium. The tree comprises 14 symbiont clades and is rooted in the free-living dinoflagellate genera Protodinium, Polarella and Pelagodinium (Figure 5). The 56 symbiont sequences of soritids from the Red and Mediterranean Seas obtained for this study are belonging either to clade F2 or F5, which are both well supported (100% BV, 1PP). All symbionts of S. variabilis belong to the F2 clade while symbionts from S. orbiculus and A. hemprichii are assigned either to the clade F2 or the clade F5. One specimen of A. hemprichii (isolate nr. 12986) hosts both types of symbionts. All symbionts from S. orbiculus collected in the Mediterranean Sea branch within the F5 clade. Clade A branches at the base of all other symbiont clades, followed by clades E, D1, D2, G3, G1, G2, H, B and C. Clade C is branching off a large group containing F2, F3 and F4 that are all sisters to F5. Most of the symbiont clades are specific to foraminifera (G1, G2, H, F2, F3, F4, C). Only two clades are present in foraminifera as well as cnidarians (D2, F5) and four symbiont types are characteristic for cnidarians (A, E, D1, G3).

Discussion: Evidence for Lessepsian Invasion of Soritids

Recent studies by Langer and colleagues [8], [13], [15] provided the most comprehensive biogeographical documentation of the expansion of larger benthic foraminifera (LBF) in the Mediterranean. In general, the abundance and species richness of LBF are increasing steadily in the Eastern Mediterranean Sea. This increase has been attributed to the hyper-oligotrophy together with the increasing temperatures that allow the LBF to settle and thrive and often take over the native fauna in many ecological niches, as documented in the shallow rocky environments of the Israeli Mediterranean inner shelf [6], [22], [30]. Some of these species have now become extremely abundant in these environments. It is assumed that the expansion of LBF in the Mediterranean is a consequence of the opening of the Suez Canal, which promoted a unidirectional invasion either by natural dispersal or by anthropogenic factors [8]. Yet, some fossil LBF species are known from subsurface Pleistocene marine sediments that were recovered from the Israeli coastal plain and inner shelf [22], [39] (Figure 6). Their occurrences imply that these species originated from a tropical Atlantic source and colonized the Eastern Mediterranean mainly during warmer glacial and warm interglacial periods [22]. This raises the question whether the recent populations of LBF observed in the studied hotspot represents reviving of native Mediterranean fauna, recent invasion from the Atlantic or a pure introduction of new Lessepsian invaders. Because the morphological variability observed within the specimens of soritids investigated in this study was found to be greatly inconsistent, making it impossible to distinguish living, dead and fossil specimens based on traditional taxonomic features (Figure 6), we tackled this question by comparing the genotypes of soritid foraminifers found in the Eastern Mediterranean and the Red Sea. Our results illustrated in the phylogenetic tree of the soritids (Figure 3) and in the network analysis (Figure 4) clearly show that the population of S. orbiculus found in Shikmona is genetically identical to one of the soritid haplotypes identified in the Gulf of Elat and therefore seems to be Lessepsian. Specifically, the Shikmona specimens are genetically identical to those of S. orbiculus collected from pebbles at very shallow water depths in the Gulf of Elat (H1, Figure 4). Our results also demonstrate that the population in Shikmona retained the same ecological/habitat preferences as in the Red Sea (Figure 2, Figure 4, Table 4). The S. orbiculus clade consists of great number of highly divergent haplotypes [27], [40], which demonstrates that the seemingly cosmopolitan distribution of this species is an artifact of morphological conservation. The observed branching between S. orbiculus from the Halophila leaves and the pebbles in IUI and Shikmona (Figure 4) indicates that genetic divergence also exists between habitats and not only between different geographic regions. The divergence between the shallow water pebbles population of IUI and Shikmona from those of Florida and Guam indicates that they are genetically separated and therefore are not directly related (Figure 4). It is further reasonable to postulate that if the population in Shikmona is a relict of a native Mediterranean source (i.e. post Messinian Atlantic origin) it should have been branched separately from the modern Red Sea population. It is important to note that not all Red Sea soritids successfully invaded the Mediterranean ([8] and compare with [29]). A distinct selectivity in the invasion process suggests that the environmental differences between the two seas act as a filter allowing only certain haplotypes to settle in the Eastern Mediterranean. This is supported by the fact that no specimens of the two morphologically distinctive species S. variabilis and A. hemprichii were found alive at the various sites along the coast of Israel or elsewhere in the Mediterranean [3]. Our combined genetic and morphological analyses revealed that these species share the morphological feature of apertures with faint rim that signifies their evolutionary branching from the lineage of S. orbiculus (Figures 3, 7). This finding indicates that the genus Sorites is polyphyletic and consequently S. variabilis should be amended as species of the genus Amphisorus. The common evolutionary history of S. variabilis and A. hemprichii implies that they may share some physiological constrains that presently limit their ability to successfully invade the Mediterranean. Previous reports show that S. orbiculus occupies the entire eastern Levantine Basin, as well as the Adriatic and Tyrrhenian seas [8], [13], [41]. Its distribution was attributed to the ability to tolerate temperatures below 14°C [13]. The very shallow depth habitats of S. orbiculus recognized in this study imply that it may also tolerate temperatures beyond the typical range of this group. Our results do not rule out the possible existence of other S. orbiculus haplotypes somewhere else in the Mediterranean, but it does prove dominance of a single invasive haplotype in the Israeli coast. The selectivity of invasive species also concerns their symbionts. All Symbiodinium from S. orbiculus collected in Shikmona belong to the F5 clade. Interestingly, the Symbiodinium phylotype F2, endemic to the Red Sea has not been found in the specimens from Shikmona. Clade F5 was also recognized from the S. orbiculus haplotype collected from the shallow water pebbles in the Gulf of Elat (Figure 5, Table 3). This clade is known to dominate in the Red Sea and also has been found in the Indian Ocean and the Caribbean Sea [40]. Its worldwide distribution may reflect easier adaptation to different environmental conditions, which certainly helps the migration to new areas.

Conclusions

Our study shows the potential of using LBF in combined genetic and morphological studies to characterize a Lessepsian invasion. It provides the first genetic and ecological evidence that the modern Eastern Mediterranean population of S. orbiculus is likely Lessepsian; it occupies very similar habitats in both regions, and keeps their original symbionts. The mechanism responsible for the migration of the S. orbiculus population from the Red Sea and its establishment in Shikmona could be due to either natural dispersal or anthropogenic factors. A further study is needed to conclude if all the Mediterranean populations of S. orbiculus originated from the same source of genotype that was identified in the present study or whether there are some areas that still contain the native fauna or other Red Sea haplotypes.
  11 in total

1.  Intraspecific gene genealogies: trees grafting into networks.

Authors: 
Journal:  Trends Ecol Evol       Date:  2001-01-01       Impact factor: 17.712

2.  MRBAYES: Bayesian inference of phylogenetic trees.

Authors:  J P Huelsenbeck; F Ronquist
Journal:  Bioinformatics       Date:  2001-08       Impact factor: 6.937

3.  Median-joining networks for inferring intraspecific phylogenies.

Authors:  H J Bandelt; P Forster; A Röhl
Journal:  Mol Biol Evol       Date:  1999-01       Impact factor: 16.240

4.  A rapid bootstrap algorithm for the RAxML Web servers.

Authors:  Alexandros Stamatakis; Paul Hoover; Jacques Rougemont
Journal:  Syst Biol       Date:  2008-10       Impact factor: 15.683

5.  SeaView version 4: A multiplatform graphical user interface for sequence alignment and phylogenetic tree building.

Authors:  Manolo Gouy; Stéphane Guindon; Olivier Gascuel
Journal:  Mol Biol Evol       Date:  2009-10-23       Impact factor: 16.240

6.  MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods.

Authors:  Koichiro Tamura; Daniel Peterson; Nicholas Peterson; Glen Stecher; Masatoshi Nei; Sudhir Kumar
Journal:  Mol Biol Evol       Date:  2011-05-04       Impact factor: 16.240

7.  The effect of thermal pollution on benthic foraminiferal assemblages in the Mediterranean shoreface adjacent to Hadera power plant (Israel).

Authors:  Ruthie Nina Arieli; Ahuva Almogi-Labin; Sigal Abramovich; Barak Herut
Journal:  Mar Pollut Bull       Date:  2011-03-21       Impact factor: 5.553

Review 8.  Climate Optimum rejuvenates the Mediterranean marine world.

Authors:  Francis D Por
Journal:  Integr Zool       Date:  2010-06       Impact factor: 2.654

9.  Molecular evidence for host-symbiont specificity in soritid foraminifera.

Authors:  Lydia Garcia-Cuetos; Xavier Pochon; Jan Pawlowski
Journal:  Protist       Date:  2005-11-02

10.  Effect of an exotic prey on the feeding pattern of a predatory snail.

Authors:  Gil Rilov; Avital Gasith; Yehuda Benayahu
Journal:  Mar Environ Res       Date:  2002       Impact factor: 3.130

View more
  2 in total

1.  Recent Invasion of the Symbiont-Bearing Foraminifera Pararotalia into the Eastern Mediterranean Facilitated by the Ongoing Warming Trend.

Authors:  Christiane Schmidt; Raphael Morard; Ahuva Almogi-Labin; Anna E Weinmann; Danna Titelboim; Sigal Abramovich; Michal Kucera
Journal:  PLoS One       Date:  2015-08-13       Impact factor: 3.240

2.  Current status (as of end of 2020) of marine alien species in Turkey.

Authors:  Melih Ertan Çinar; Murat Bilecenoğlu; M Baki Yokeş; Bilal Öztürk; Ergün Taşkin; Kerem Bakir; Alper Doğan; Şermin Açik
Journal:  PLoS One       Date:  2021-05-04       Impact factor: 3.240

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.