Literature DB >> 24174975

Identification of Target Genes Involved in the Antiproliferative Effect of Enzyme-Modified Ginseng Extract in HepG2 Hepatocarcinoma Cell.

Sung-Il Jang1, Yeon-Weol Lee, Chong-Kwan Cho, Hwa-Seung Yoo, Jun-Hyeog Jang.   

Abstract

Ginsenosides are ginseng saponins, which are the major biologically active components of Panax ginseng, often metabolized by intestinal bacteria into more effective forms. In this study, we found that the antiproliferative activity of ginseng increased after enzymatic processing of ginseng saponin (50% inhibitory concentration [IC50], >30  μ g/mL), which may be the result of the accumulation of minor saponins, such as Rh1, Rg3, compound K, and PPT constituents in ginseng saponin. Using the Agilent PrimeView Human Gene Expression Array, we found that the expression of several genes involved in apoptosis (caspase-4, Annexin A2, HSPA9, AIFM1, UQCRC2, and caspase-7) were increased in HepG2 human hepatocarcinoma cells after their treatment with enzyme-modified ginseng extract (EMGE). Furthermore, several genes implicated in cell cycle progression (CDCA3, CDCA8, CABLES2, CDC25B, CNNM3, and CCNK) showed decreased expression in HepG2 cells treated with EMGE. Finally, from flow cytometric analysis, we found that EMGE-treated HepG2 cells showed increased apoptotic sub-G1 population (24%), compared with that observed in DMSO-treated control cells (1.6%). Taken together, our results suggest that EMGE induces anticancer activity through the induction of apoptosis-related genes and cell cycle arrest via decreased expression of cell cycle regulatory genes.

Entities:  

Year:  2013        PMID: 24174975      PMCID: PMC3794629          DOI: 10.1155/2013/502568

Source DB:  PubMed          Journal:  Evid Based Complement Alternat Med        ISSN: 1741-427X            Impact factor:   2.629


1. Introduction

Panax ginseng (Korean ginseng) has been used as a traditional medicine for the treatment of cancer and has been shown to inhibit tumor cell proliferation and tumor growth, to induce differentiation and apoptosis, and to inhibit cancer cell invasion [1-4]. The major biologically active components of Panax ginseng are a series of saponin glycosides collectively known as the ginsenosides, a group of steroidal saponins. Over 50 ginsenosides have been isolated and identified from ginseng saponins to date [5]. Ginsenosides are characterized by a steroid-like skeleton consisting of 4 trans-rings, with modifications that depend on the type (e.g., glucose, maltose, and fructose) and number of sugar moieties, as well as the sites of attachment of the hydroxyl group (e.g., C-3, C-6, or C-20). Based on chemical structural characteristics, ginseng saponins can be divided into protopanaxadiol and protopanaxatriol groups, except for ginsenoside Ro, which is derived from an oleanolic group. In the protopanaxadiol group, sugars are attached to the β-OH at C-3 and another –OH at C-20, as found in Rb1, Rb2, Rc, Rd, Rg3, and Rh2. In the protopanaxatriol group, sugar residues are attached to the α-OH at C-6, with another –OH at C-20, examples being Re, Rg1, Rg2, Rh1, and Rf. Recent studies have indicated that intestinal bacteria cleave the oligosaccharide connected to the aglycon stepwise from the terminal sugar to form the ginsenoside metabolite 20S-protopanaxadiol 20-O--d-glucopyranoside (compound K) after oral administration of ginseng extract in both humans and rats [6]. Wakabayashi et al. have revealed that the antitumor activities of ginsenoside following oral administration are attributable to the metabolites formed by colonic bacteria-mediated deglycosylation [7]. In addition, compound K is known to exhibit cytotoxicity by the induction of apoptosis and cell cycle arrest at the G1 phase, by a caspase-dependent pathway via mitochondrial disruption in tumor cells, and by reversing multidrug resistance in tumor cells [8-10]. The combined treatment of compound K and radiation enhances human lung cancer cell death [8, 11]. Various transformation methods, including mild acid hydrolysis, enzymatic conversion, and microbial conversion, have been tested for their ability to transform ginsenosides to enhance their physiological effectiveness. In this study, we investigated the antiproliferative effects and possible mechanism of action of EMGE that were transformed by enzyme treatment, by using the human hepatocarcinoma cell line HepG2.

2. Materials and Methods

2.1. Cell Culture

HepG2 cells were maintained in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% heat-inactivated fetal calf serum (Invitrogen, Carlsbad, CA), 100 units/mL penicillin G sodium, 100 μg/mL streptomycin sulfate, and 0.25 μg/mL amphotericin B (Invitrogen, Carlsbad, CA) in a 5% CO2 atmosphere at 37°C. Confluent cells were detached with 0.25% trypsin-EDTA for 5 min, and aliquots were subcultured. Human hepatoma HepG2 cells were purchased from the Korean Cell Line Bank (KCLB, Seoul, Republic of Korea).

2.2. Preparation of Enzyme-Modified Ginseng Extract (EMGE)

The root of regular ginseng (4 years old) was purchased from G&V, Korea. A total of 20 g of pulverized ginseng root powder were suspended in 380 mL of distilled water and then sterilized by heating at 121°C for 15 min. To reduce the complexity of components in ginseng root, the extract was fractionated via extraction with water, methanol, and butanol. Among the fractions, ginseng butanol extract contained the compounds with specific anticancer activity. In addition, the suspension was treated with aliquots of filter-sterilized commercial enzymes (laminarinase 100 mg, pectinase 100 mg) with an equimolar ratio (1 : 1, specific activity unit). For these treatments, the mixture was incubated at 40°C for 2 days and then evaporated to dryness at 60°C. These enzyme-modified ginseng powders were then suspended in 400 mL of 80% (v/v) methanol and subjected to ultrasonication for 5 min followed by filtration through Whatman No. 2 Filter Paper. The wet powder on the filter paper was then collected, suspended, treated in an ultrasound bath, and filtered in the same manner once again, after which the two filtrates were combined and evaporated to dryness at 50°C. The methanol extract dissolved in 200 mL of distilled water was washed with 200 mL of ethyl acetate in a separation funnel and then extracted with 200 mL of butanol. Next, the butanol extract was evaporated to dryness at 50°C and then dissolved to a concentration of 10% (w/v) in 70% ethanol.

2.3. HPLC Analysis of Ginsenosides

Standard ginsenosides including Rg1, Re, Rf, Rh1, Rb1, Rc, Rb2, f1, Rd, Rg3(S), Rg3(R), PPT, Com K, Rh2, and PPD were obtained from ChromaDex Inc. (Irvine, CA) and analyzed using an Acquity UPLC system (Waters, Milford, MA) with an Acquity BEH C18 HPLC column. The mobile phase consisted of solution A (CH3CN, HPLC-grade, JT Baker, NJ) and solution B (Milli-Q H2O, Millipore, MA). The flow rate was set at 0.6 mL/min, and the injection of volume was fixed at 2 : 1. The separation of ginsenosides was performed using an isocratic gradient of 100% solution A for 27 min. The column temperature was maintained at room temperature during the separation, and the UV diode array detection was set at 203 nm. To confirm a reliable retention time of sample ginsenoside, the individual ginsenosides were identified and quantified based on comparison with the retention times of standard ginsenosides.

2.4. Cell Viability Assay

The effect of EMGE on cell viability was determined using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, a yellow tetrazole) assay, which quantifies the number of viable cells. Cells were seeded (2 × 104 cells/well) in 24-well flat-bottomed plates (Nunc, EU). After incubation at 37°C for 24 h, the medium was replaced with EMGE at the appropriate concentrations. Control cells were treated with DMSO at a final concentration of less than 0.2%. After further 24 h incubation, cells were washed 3 times with Dulbecco's phosphate-buffered saline (DPBS), and 500 μL MTT solution (5 mg/mL in PBS) was added to each well. After incubating for 4 h, the medium was removed, and 200 μL of formazan (crystals dissolved in DMSO) was added to the cells. The absorbance of each well was read at 540 nm using a microplate reader.

2.5. RNA Extraction and cDNA Synthesis

Total RNA was extracted using the Easy-spin RNA Extraction kit (iNtRON, Seoul, Republic of Korea) according to the manufacturer's instructions. The purity of RNA was assessed by measuring the absorption at 260 and 280 nm (values of the ratio of A 260/A 280 of 1.9–2.1 were considered acceptable) and by ethidium bromide staining of 18 S and 28 S RNA by gel electrophoresis. RNA concentrations were determined from the A 260. Two micrograms of total RNA were reverse-transcribed in a 20 μL reaction mixture containing 50 units of SuperScript II reverse transcriptase (Invitrogen, Carlsbad, CA), 5 μM DTT, 40 units of RNaseOUT recombinant ribonuclease inhibitor (Invitrogen, Carlsbad, CA), 0.5 μM of random hexanucleotide primers, and 500 μM of dNTP mixture. The reverse transcription reaction was carried out at 50°C for 60 min. The reaction was terminated by heating the reaction mixture at 70°C for 15 min, and the cDNA was stored at −20°C.

2.6. Quantitative Real-Time Reverse Transcriptase Polymerase Chain Reaction (RT-PCR)

Overexpression of the target genes was confirmed by quantitative real-time RT-PCR. All real-time PCR analyses were performed on an ABI Step One Real-time PCR system (Applied Biosystems). Each reaction contained 0.1 μM of each primer, 10 μL of 2x SYBR Green PCR master mix (including AmpliTaq Gold DNA polymerase with buffer, dNTPs mix, SYBR Green I dye, ROX dye, and 10 mm MgCl2, Applied Biosystems), and 1 μL of the template cDNA in a 20 μL total reaction volume. The typical amplification program included activation of the enzyme at 94°C for 10 min, followed by 40 cycles of denaturation at 94°C for 15 s, then annealing and extension at 60°C for 1 min. The C (cycle threshold) value for each gene was determined using the automated threshold analysis function of the ABI instrument and normalizing to C to obtain dC ( = C − C ). The difference of n between the 2C or dC values indicates a 2n-fold difference in the amount of the target sequence between the 2 cDNA samples being compared. The primers used in quantitative PCR are shown in Table 1.
Table 1

Primer sequences for real-time RT-PCR experiments.

GenesSense (5′-3′)Antisense (5′-3′)
Caspase-4 GAAGGACAAACCCAAGGTCAAAGAGGCCACTTCCAAGGAT
Cyp450 TGATAAGCACGTTGCAGGAGCAAAGCAAATGGCACAGATG
Caspase-7 AGACCTCATCCGGTCAAGTGTTATCAGACAGCGCAACAGC
Cyclin  M GAAGCGGAAGGAGGAGTTCTCGGGCTGAATACATCCACTT
Cyclin  K GACATCTGCCACCAAATCCTGCACTTGTGGTGTAGGCTGA
GAPDH TGGAAGGACTCATGACCACATTCAGCTCAGGGATGACCTT

2.7. Microarray Assay

Gene expression was analyzed with Agilent PrimeView Human Gene Expression Array containing 36,000 genes transcript and variants via Unigene annotation (Affymetrix, Santa Clara, CA), which are comprised of over 45,000 probe sets representing approximately 38,500 well-characterized human genes. For each gene, 11 pairs of oligonucleotide probes were synthesized in situ on the arrays. Biotinylated cRNA was prepared according to the standard Affymetrix protocol from 100 ng of total RNA (Expression Analysis Technical Manual, 2001, Affymetrix). Following fragmentation, 12 μg of aRNA was hybridized for 16 h at 45°C on a GeneChip Human Genome Array. GeneChips were washed and stained in the Affymetrix Fluidics Station 450. GeneChips were scanned using the Affymetrix GeneChip Scanner 3000 7G. The data were analyzed with Microarray Suite version 5.0 using the Affymetrix default analysis settings and global scaling as the normalization method. The trimmed mean target intensity of each array was arbitrarily set to 100. The normalized and log transformed intensity values were then analyzed using GeneSpring GX 11.5.1 (Agilent Technologies, CA). Fold-change filters included the requirement that the genes be present in at least 200% of controls for genes with upregulated expression and less than 50% of controls for genes with downregulated expression. Hierarchical cluster analysis using GeneSpring GX 11.5.1 (Agilent technologies, CA) identified clustered groups as those that behaved similarly across experiments. The clustering algorithm was Euclidean distance, with average linkage.

2.8. Cell Count and Flow Cytometry Analysis

Cell counts were performed using a hemocytometer. Approximately 1 × 106 HepG2 cells were suspended in 100 μL of PBS, and 200 μL of 95% ethanol was added while vortexing. The cells were incubated at 4°C for 1 h, washed with PBS, and resuspended in 250 μL of 1.12% sodium citrate buffer (pH 8.4) together with 12.5 μg of RNase. Incubation was continued at 37°C for 30 min. The cellular DNA was then stained by applying 250 μL of propidium iodide (50 μg/mL) for 30 min at room temperature. The stained cells were analyzed by fluorescence-activated cell sorting (FACS) flow cytometry (FACScanner, Becton Dickinson) for relative DNA content based on red fluorescence.

3. Results

3.1. Chromatographic Analysis of Ginseng Saponin during the Enzyme Treatment

Ginseng saponins (ginsenosides) have been regarded as the principal components responsible for the pharmacological activities of ginseng, and a large number of ginsenoside derivatives have been identified in Panax ginseng [5]. Recently, cytotoxic effects of minor saponins, such as Rh1 and Rh2, on the growth of various cancer cells and also inhibitory effects of human intestinal bacterial saponin metabolites, such as compound K and protopanaxatriol (PPT), on the growth, invasion, and migration of tumor cells, have been reported [12-16]. High-performance liquid chromatography (HPLC) analysis was performed to determine the changes in chemical constituent in ginseng saponin following enzyme treatment. HPLC results showed the appearance of minor ginsenosides (Rh1, Rg3, and compound K), indicative of EMGE (Table 2).
Table 2

HPLC analysis of EMGE.

(mg/g)
Rg1ReRfRh1Rb1RcRb2F1RdRg3Com.KRh2
Control (ginseng)9.27.22.57.74.72.32.00.6
EMGE0.61.02.72.79.54.72.7

3.2. Antiproliferative Effects of EMGE on HepG2 Hepatocarcinoma Cells

Ginsenosides have been shown to inhibit tumor cell proliferation and tumor growth and to induce differentiation and apoptosis [17]. To determine the antiproliferative effects of EMGE on HepG2 human hepatocarcinoma cells, we performed the MTT assay. EMGE inhibited HepG2 cell growth in a dose-dependent manner at 14.8, 22.2, 33.3, 50, and 100 μg/mL at 24 h. The concentration at which 50% growth inhibition (IC50) occurred was 30 μg/mL (Figure 1). However, exposure of HepG2 cells to 30 μg/mL nontreated ginseng saponin extract showed less growth inhibition (approximately 20%). Thus, these results suggest that enzymatic processing of ginseng saponin increased its antiproliferative effects on HepG2 cells.
Figure 1

Antiproliferative effects of EMGE on human HepG2 hepatocarcinoma cells. Cell viability at the indicated concentrations of EMGE at 24 h was assessed by the MTT test. The treated cells were used for total RNA isolation followed by microarray analysis.

3.3. Identification of Differentially Expressed Genes in HepG2 Human Hepatocarcinoma Cells Treated with EMGE

Although ginseng has been used as a traditional medicine for the treatment of cancer, the underlying mechanisms for the varying activities observed following exposure to ginseng are largely unclear. To identify relevant alterations of gene expression associated with treatment of EMGE, we analyzed the gene expression profiles of HepG2 cells by using Affymetrix Gene Chip arrays containing more than 38,500 genes. From the results of Affymetrix Gene Chip array analysis, we detected 31 differentially expressed genes exhibiting at least a 5-fold change following treatment with EMGE. Of these, 17 had significantly upregulated expression, and 14 had significantly downregulated expression when comparing treatment with the EMGE versus the control treatment (Tables 3 and 4).
Table 3

Genes with highly upregulated expression due to EMGE in HepG2.

SymbolGene descriptionFold changeGenBank ID
CYP1A1 Cytochrome P450, family 1, subfamily A 20.0NM000499
HGD Homogentisate 1,2-dioxygenase15.3NM000187
AQP3 Aquaporin 314.5NM004925
IL8 Interleukin 814.3NM000584
ANXA2 Annexin A211.1NM001002857
HSPA9 Heat shock 70 kDa protein 910.5NM004134
CASP4 Caspase-410.4NM001225
SMAD2 SMAD family member 29.8NM001003652
MAPK6 Mitogen-activated protein kinase 69.3NM002748
KLF6 Kruppel-like factor 69.0NM001160124
CTNNB1 Catenin (cadherin-associated protein), beta 1, 88 kda8.3NM001098209
AIFM1 Apoptosis-inducing factor, mitochondrion-associated, 17.8NM001130846
PPHLN1 Periphilin 17.5NM001143787
UQCRC2 Ubiquinol-cytochrome c reductase core protein II7.4NM003366
IL6ST Interleukin 6 signal transducer6.4NM001190981
IFITM1 Interferon-induced transmembrane protein 15.1NM003641
CASP7 Caspase-75.0NM001227
Table 4

Genes with highly downregulated expression due to EMGE in HepG2.

SymbolGene descriptionFold changeGenBank ID
CDCA3 Cell division cycle associated 3−8.4NM031299
CS Citrate synthase−8.0NM004077
CDCA8 Cell division cycle associated 8−7.7NM018101
CABLES2 Cdk5 and Abl enzyme substrate 2−7.4NM031215
CDC25B Cell division cycle 25 homolog B−6.6NM004358
CNNM3 Cyclin M3−6.2NM017623
ZNF362 Zinc finger protein 362−5.8NM152493
CCNK Cyclin K−5.8NM001099402
RAD51AP1 RAD51 associated protein 1−5.8NM001130862
LEAP2 Liver expressed antimicrobial peptide 2−5.3NM052971
HEPACAM Hepatocyte cell adhesion molecule−5.1NM152722
ALDH3B1 Aldehyde dehydrogenase 3 family, member B1−5.0NM000694
NPRL3 Nitrogen permease regulator-like 3−5.0NM001039476
DOT1L DOT1-like, histone H3 methyltransferase−5.0NM032482
Several genes involved in apoptosis (caspase-4, Annexin A2, HSPA9, AIFM1, UQCRC2, and caspase-7) were expressed at higher levels following treatment with EMGE (Table 3). The expression of genes involved in the regulation of cell signaling (MAPK6, SMAD2, IL6ST, KLF6, and IFITM1) also increased. Furthermore, several genes implicated in cell adhesion (CTNNB1), transport (AQP3, IFITM1), and the immune response (IL8) showed increased expression in HepG2 human hepatocarcinoma cells that were treated with EMGE. In contrast, 14 genes showed reduced expression in HepG2 human hepatocarcinoma cells treated with EMGE. There was an overrepresentation of members of genes involved in cell cycle progression (CDCA3, CDCA8, CABLES2, CDC25B, CNNM3, and CCNK) and cellular metabolism (CS, ALDH3B1, and NPRL3). Table 4 lists the names of genes exhibiting a reduction in expression, where the difference was >5-fold. This group of genes that were expressed very differently may serve as an important target in EMGE-mediated anticancer activity in human hepatocarcinoma cells.

3.4. Real-Time RT-PCR Validation of Microarray Data

To confirm the results obtained using microarrays, we choose to determine if the expression of 5 target genes was regulated by EMGE in HepG2 cells by quantitative real-time RT-PCR analysis. These genes included 3 genes with highly upregulated expression (cyp450, caspase-4, and caspase-7) and 2 with highly downregulated expression (Cyclin K and Cyclin M). To accurately quantify the expression of these 5 genes, GAPDH expression was amplified and the mean data in each case was used to normalize the result. As shown in Figures 2 and 3, the expression level of the 3 selected upregulated genes (cyp450 (73-fold), caspase-4 (6-fold), and caspase-7 (3-fold)) significantly increased upon treatment with EMGE. Conversely, the expression of the 2 downregulated genes (Cyclin M (4-fold), Cyclin K (12-fold)) decreased. These results indicate that the real-time RT-PCR results are highly consistent with the microarray data.
Figure 2

Quantitative real-time RT-PCR analysis of 3 genes with upregulated expression: cyp450, caspase-4, and caspase-7.

Figure 3

Quantitative real-time RT-PCR analysis of 2 downregulated genes: Cyclin K and Cyclin M.

3.5. Effect of EMGE on Cell Cycle Distribution and Apoptosis in HepG2 Hepatocarcinoma Cells

To determine whether EMGE has an effect on cell cycle arrest, apoptosis, or both in human HepG2 hepatocarcinoma cells, cells treated with DMSO or EMGE for 12 or 24 h were subjected to flow cytometric analysis after DNA staining. Histograms of flow cytometric data are shown in Figure 4. Control cells (DMSO-treated) progressed through the cell cycle normally. In contrast, EMGE-treated HepG2 cells showed increased apoptotic sub-G1 populations (24%) compared with that observed in DMSO-treated control cells (1.6%). These results suggest that EMGE induces antiproliferative effects in HepG2 cells, mainly through apoptotic mechanisms.
Figure 4

FACS analysis of PI-stained nuclei of HepG2 cells treated with EMGE. Cells were treated with DMSO (0.05%) or EMGE (50 μg/mL) for 24 h, and cell cycle analysis was conducted as described in Section 2. Data are representative of 3 independent experiments.

4. Discussion

We found that the enzymatic processing of ginseng saponin could increase the content of active constituents and enhance its anticancer activity, presumably because of the production of minor saponins, such as Rh1, Rg3, compound K, and PPT constituents in ginseng saponin. In this study, we used cDNA microarray analysis to detect target genes involved in the anticancer activity of EMGE. Microarray (DNA chip) is a 2D array of microscopic DNA spots for high-throughput expression screening. We found that several genes involved in apoptosis (caspase-4, Annexin A2, HSPA9, AIFM1, UQCRC2, and caspase-7) as well as several genes involved in cell signaling (MAPK6, SMAD2, IL6ST, KLF6, and IFITM1) were expressed at higher levels after treatment with EMGE. Furthermore, several genes implicated in cell cycle progression (CDCA3, CDCA8, CABLES2, CDC25B, CNNM3, and CCNK) and metabolism (CS, ALDH3B1, and NPRL3) exhibited decreased expression in HepG2 human hepatocarcinoma cells treated with EMGE. Thus, the apoptosis-related genes with upregulated expression and cell cycle-related genes with downregulated expression could be important target genes involved in the anticancer activity of EMGE. In this study, caspase-4 and caspase-7, which are components of the cell-intrinsic apoptosis machinery, were significantly induced by EMGE. Caspase-4 has a functional role in endoplasmic-reticulum-stress- (ERS-) induced apoptosis in humans [18]. Upregulation of caspase-4 has been demonstrated to mediate apoptosis in human bronchial epithelial cells [19], human neuroblastoma SKN-SH cells, and human esophageal squamous carcinoma EC109 [20]. Thus, the induction of apoptosis-related genes, such as caspase-4 and caspase-7, in cells treated with EMGE may contribute to the antiproliferative activity of EMGE. The cytochrome P450 1A1 (CYP1A1) is a member of the cytochrome P450 monooxygenase superfamily, which plays an important role in xenobiotic metabolism as well as in carcinogenesis [21]. In this study, CYP1A1 level was significantly increased after treatment with EMGE. The CYP1A1 enzymes mediate the bioactivation of carcinogens found both in the human diet and in the environment, including compounds such as polycyclic aromatic hydrocarbons, such as 3-methylcholanthrene, benzo(a)pyrene, polyhalogenated aromatic hydrocarbons, and certain congeners of polyhalogenated biphenyls [22]. Our finding that the EMGE increased the expression of CYP1A1 is consistent with the previous results showing the induction of CYP1A1 expression by ginsenosides Rg1 and Rb1 [23]. Cell cycle progression is a tightly regulated process requiring regulatory factors such as CDCs and cyclins. Thus, lack of cell cycle machinery molecules often causes cell cycle arrest leading to cell growth inhibition, apoptosis, or both. Our results showing the decreased expression of several genes implicated in cell cycle regulation (CDCA3, CDCA8, CABLES2, CDC25B, CNNM3, and CCNK) in HepG2 cells treated with EMGE suggest that the induction of cell cycle arrest by EMGE may contribute to the antiproliferative activity of EMGE. In summary, we found that the anticancer activity of ginseng was increased by enzymatic processing of ginseng saponin, which may be the result of the relative accumulation of minor saponins, such as Rh1, Rg3, compound K, and PPT constituents in ginseng saponin. Moreover, the results of microarray analysis suggest that EMGE induces anticancer activity through the induction of apoptosis-related genes and the decreased expression of cell cycle regulatory genes. However, these results do not exclude the role of other genes that may be involved in anticancer activity.
  23 in total

1.  Ginsenoside Rg3 attenuates cell migration via inhibition of aquaporin 1 expression in PC-3M prostate cancer cells.

Authors:  Xue-Yang Pan; Hao Guo; Jing Han; Feng Hao; Yu An; Yan Xu; Yilixiati Xiaokaiti; Yan Pan; Xue-Jun Li
Journal:  Eur J Pharmacol       Date:  2012-03-07       Impact factor: 4.432

2.  Main ginseng saponin metabolites formed by intestinal bacteria.

Authors:  H Hasegawa; J H Sung; S Matsumiya; M Uchiyama
Journal:  Planta Med       Date:  1996-10       Impact factor: 3.352

3.  Antitumor activity of a novel ginseng saponin metabolite in human pulmonary adenocarcinoma cells resistant to cisplatin.

Authors:  S J Lee; J H Sung; S J Lee; C K Moon; B H Lee
Journal:  Cancer Lett       Date:  1999-09-20       Impact factor: 8.679

4.  G1 phase arrest of the cell cycle by a ginseng metabolite, compound K, in U937 human monocytic leukamia cells.

Authors:  Kyoung Ah Kang; Yeong Wan Kim; Seung Uk Kim; Sungwook Chae; Young Sang Koh; Hee Sun Kim; Min Kyung Choo; Dong Hyun Kim; Jin Won Hyun
Journal:  Arch Pharm Res       Date:  2005-06       Impact factor: 4.946

Review 5.  Role of human cytochromes P450 in the metabolic activation of chemical carcinogens and toxins.

Authors:  F J Gonzalez; H V Gelboin
Journal:  Drug Metab Rev       Date:  1994       Impact factor: 4.518

Review 6.  Saponins of ginseng and related plants.

Authors:  O Tanaka; R Kasai
Journal:  Fortschr Chem Org Naturst       Date:  1984

7.  In vivo antimetastatic action of ginseng protopanaxadiol saponins is based on their intestinal bacterial metabolites after oral administration.

Authors:  C Wakabayashi; H Hasegawa; J Murata; I Saiki
Journal:  Oncol Res       Date:  1997       Impact factor: 5.574

8.  Ginsenoside Rh2 mediates changes in the microRNA expression profile of human non-small cell lung cancer A549 cells.

Authors:  In-Sook An; Sungkwan An; Ku Jung Kwon; Young Joo Kim; Seunghee Bae
Journal:  Oncol Rep       Date:  2012-11-14       Impact factor: 3.906

9.  In vitro antigenotoxic activity of novel ginseng saponin metabolites formed by intestinal bacteria.

Authors:  B H Lee; S J Lee; J H Hur; S Lee; J H Sung; J D Huh; C K Moon; J H Hui
Journal:  Planta Med       Date:  1998-08       Impact factor: 3.352

Review 10.  Anticarcinogenic effect of Panax ginseng C.A. Meyer and identification of active compounds.

Authors:  T K Yun; Y S Lee; Y H Lee; S I Kim; H Y Yun
Journal:  J Korean Med Sci       Date:  2001-12       Impact factor: 2.153

View more
  11 in total

1.  The roles of the cell division cycle-associated gene family in hepatocellular carcinoma.

Authors:  Qiang Tao; Siliang Chen; Jia Liu; Peng Zhao; Lingmin Jiang; Xinyue Tu; Xiang Tang; Zonghao Liu; Abudoukeyimu Yasheng; Kahaer Tuerxun; Yun Zheng
Journal:  J Gastrointest Oncol       Date:  2021-04

2.  Pfaffosidic Fraction from Hebanthe paniculata Induces Cell Cycle Arrest and Caspase-3-Induced Apoptosis in HepG2 Cells.

Authors:  Tereza Cristina da Silva; Bruno Cogliati; Andréia Oliveira Latorre; Gokithi Akisue; Márcia Kazumi Nagamine; Mitsue Haraguchi; Daiane Hansen; Daniel Soares Sanches; Maria Lúcia Zaidan Dagli
Journal:  Evid Based Complement Alternat Med       Date:  2015-05-13       Impact factor: 2.629

3.  Elemene injection induced autophagy protects human hepatoma cancer cells from starvation and undergoing apoptosis.

Authors:  Yan Lin; Keming Wang; Chunping Hu; Lin Lin; Shukui Qin; Xueting Cai
Journal:  Evid Based Complement Alternat Med       Date:  2014-07-24       Impact factor: 2.629

4.  Effects of pectin lyase-modified red ginseng extracts in high-fat diet-fed obese mice.

Authors:  Hak-Yong Lee; Kwang-Hyun Park; Young-Mi Park; Dae-In Moon; Hong-Geun Oh; Dae-Young Kwon; Hye-Jeong Yang; Okjin Kim; Dong-Woo Kim; Ji-Hyun Yoo; Se-Chul Hong; Kun-Hee Lee; Su-Yeon Seol; Yong-Sik Park; Jong-Dae Park; Mi-Kyung Pyo
Journal:  Lab Anim Res       Date:  2014-12-24

5.  Effect of method of deduplication on estimation of differential gene expression using RNA-seq.

Authors:  Anna V Klepikova; Artem S Kasianov; Mikhail S Chesnokov; Natalia L Lazarevich; Aleksey A Penin; Maria Logacheva
Journal:  PeerJ       Date:  2017-03-16       Impact factor: 2.984

6.  Apoptosis Induction by the Total Flavonoids from Arachniodes exilis in HepG2 Cells through Reactive Oxygen Species-Mediated Mitochondrial Dysfunction Involving MAPK Activation.

Authors:  Huimin Li; Jing Chen; Chaomei Xiong; Han Wei; Changchang Yin; Jinlan Ruan
Journal:  Evid Based Complement Alternat Med       Date:  2014-05-28       Impact factor: 2.629

7.  Extraction and purification of total flavonoids from pine needles of Cedrus deodara contribute to anti-tumor in vitro.

Authors:  Xiaofeng Shi; Dongyan Liu; Junmin Zhang; Pengbin Hu; Wei Shen; Bin Fan; Quhuan Ma; Xindi Wang
Journal:  BMC Complement Altern Med       Date:  2016-07-26       Impact factor: 3.659

8.  General and Genetic Toxicology of Enzyme-Treated Ginseng Extract: Toxicology of Ginseng Rh2.

Authors:  Mi-Kyung Jeong; Chong-Kwan Cho; Hwa-Seung Yoo
Journal:  J Pharmacopuncture       Date:  2016-09

9.  Ginseng Extracts, GS-KG9 and GS-E3D, Prevent Blood-Brain Barrier Disruption and Thereby Inhibit Apoptotic Cell Death of Hippocampal Neurons in Streptozotocin-Induced Diabetic Rats.

Authors:  Jee Youn Lee; Chan Sol Park; Hae Young Choi; Tae Young Yune
Journal:  Nutrients       Date:  2020-08-09       Impact factor: 5.717

Review 10.  Recent Advances in Panax ginseng C.A. Meyer as a Herb for Anti-Fatigue: An Effects and Mechanisms Review.

Authors:  Guanyu Lu; Zhuoting Liu; Xu Wang; Chunling Wang
Journal:  Foods       Date:  2021-05-10
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.