Literature DB >> 24159500

Multiplex Real-Time Polymerase Chain Reaction-Based Method for the Rapid Detection of gyrA and parC Mutations in Quinolone-Resistant Escherichia coli and Shigella spp.

Junyoung Kim1, Semi Jeon, Hyungjun Kim, Misun Park, Soobok Kim, Seonghan Kim.   

Abstract

Two real-time polymerase chain reaction assays were developed to detect mutations in codons 83 and 87 in gyrA and in codons 80 and 91 in parC, the main sites that causes quinolone resistance in pathogenic Escherichia coli and Shigella spp. isolates. These assays can be employed as a useful method for controlling infections caused by quinolone-resistant E coli and Shigella isolates.

Entities:  

Keywords:  fluoroquinolone; gyrA; multiplex real-time PCR; parC

Year:  2012        PMID: 24159500      PMCID: PMC3747644          DOI: 10.1016/j.phrp.2012.04.004

Source DB:  PubMed          Journal:  Osong Public Health Res Perspect        ISSN: 2210-9099


1. Introduction

Fluoroquinolone is highly effective against enteric Gram-negative bacteria [1]. Within a short period of time, however, the widespread use of this drug has resulted in the emergence of fluoroquinolone-resistant, Gram-negative bacteria [2-4]. Resistance to fluoroquinolones is mainly caused by mutations in the quinolone-resistance determining regions (QRDRs) of gyrA and parC, which encode the GyrA and ParC proteins, respectively [5]. Most quinolone-resistant isolates have at least one gyrA mutation, and many have additional gyrA and/or parC mutations [2,3]. Mutations in the gyrA amino acid codons for Ser83 and/or Asp87 are commonly found in fluoroquinolone-resistant, Gram-negative bacteria [6]. Targeted mutations are also frequently present in parC in quinolone-resistant Gram-negative bacteria, including mutations in the codons for Ser80, Glu84, and/or Arg91 [7,8]. Mutations in gyrA or parC have less of an effect on resistance in Gram-negative bacteria by themselves than they do when found in combination with other mutations in these genes [9]. Currently, nucleotide sequencing is a common method for the identification of mutations in the QRDRs of gyrA and parC. Despite the widespread use of sequencing, it is slow and expensive [10]. Various alternative methods to replace sequencing have been proposed, including polymerase chain reaction (PCR)- restriction fragment length polymorphism (RFLP) [11], real-time (RT)-based detection [12], and single-stranded conformation polymorphism (SSCP) [13]. Our objective was to develop a quicker method for the detection of quinolone resistance-related mutations at the gyrA codons of Ser83 and Asp87 and the parC codons of Ser80 and Arg91 in quinolone-resistant Escherichia coli and Shigella spp. isolates. This technique is based on the detection of fluorescent emissions from the PCR products of wild-type gyrA and parC; isolates with mutations at specific sites in gyrA and parC do not emit detectable fluorescence.

2. Materials and Methods

The isolates used in this study are listed in Table 1. Quinolone-resistant pathogenic E coli and Shigella spp. isolates were obtained from the National Public Health Network of Korea. Each isolate was identified according to the Giraud method with some modifications [14].
Table 1.

MIC and nucleotide changes in the QRDRs of the gyrA and parC genes of quinolone-resistant strains of Escherichia coli and Shigella spp

Strain no.SpeciesMICRT-PCR assayagyrA amino acid at codonparC amino acid at codon

CIPbGyr Par83878091

83878091TCG (Ser)GAC (Asp)TCG (Ser)CGA (Arg)

982962S sonnei 1.0-+++-T-(Leu)
994263S sonnei 0.125-+++-T-(Leu)
990379S flexneri0.25-+++-T-(Leu)
990036S flexneri0.5+++--AG(Gln)
000207S sonnei 0.25-+++-T-(Leu)
000784S flexneri0.125-+++-T-(Leu)
013008S sonnei 0.25-+++-T-(Leu)
020065S sonnei 0.25-+++-T-(Leu)
021586S sonnei 0.5+++--AG(Gln)
020369S flexneri0.5-+++-T-(Leu)
021787S flexneri16-+---T-(Leu)G–(Ile)-AG(Gln)
021895S flexneri8-----T-(Leu)-G-(Gly)G–(Ile)-AG(Gln)
022149S flexneri0.5+++--AG(Gln)
QR01E coli64-----T-(Leu)-G-(Gly)G–(Ile)-AG(Gln)
QR02E coli64-----T-(Leu)-G-(Gly)G–(Ile)-AG(Gln)
QR03E coli64-----T-(Leu)-G-(Gly)G–(Ile)-AG(Gln)
QR04E coli64-----T-(Leu)-G-(Gly)G–(Ile)-AG(Gln)
QR05E coli64-----T-(Leu)-G-(Gly)G–(Ile)-AG(Gln)
QR06E coli64-----T-(Leu)-G-(Gly)G–(Ile)-AG(Gln)
QR07E coli64---+-T-(Leu)-G-(Gly)G–(Ile)
QR08E coli64-----T-(Leu)-G-(Gly)G–(Ile)-AG(Gln)
QR09E coli64-----T-(Leu)-G-(Gly)G–(Ile)-AG(Gln)
QR10E coli64-----T-(Leu)-G-(Gly)G–(Ile)-AG(Gln)
QR11E coli64-----T-(Leu)-G-(Gly)G–(Ile)-AG(Gln)
QR12E coli64-----T-(Leu)-G-(Gly)G–(Ile)-AG(Gln)
QR13E coli6-+-+-T-(Leu)G–(Ile)
QR14E coli6-+-+-T-(Leu)G–(Ile)
QR15E coli32---+-T-(Leu)-G-(Gly)G–(Ile)
QR16E coli6-+-+-T-(Leu)G–(Ile)
QR17E coli32-----T-(Leu)-G-(Gly)G–(Ile)-AG(Gln)
QR18E coli64-----T-(Leu)-G-(Gly)G–(Ile)-AG(Gln)
QR19E coli32-+-+-T-(Leu)G–(Ile)
QR20E coli32-+-+-T-(Leu)G–(Ile)
QR21E coli64-----T-(Leu)-G-(Gly)G–(Ile)-AG(Gln)
QR22E coli64-----T-(Leu)-G-(Gly)G–(Ile)-AG(Gln)
QR23E coli64-----T-(Leu)-G-(Gly)G–(Ile)-AG(Gln)
QR24E coli32-+++-T-(Leu)
QR25E coli128---+-T-(Leu)-G-(Gly)G–(Ile)
QR26E coli32-+-+-T-(Leu)G–(Ile)
QR27E coli8-+-+-T-(Leu)G–(Ile)
QR28E coli6-+-+-T-(Leu)G–(Ile)
QR29E coli256---+-T-(Leu)-G-(Gly)G–(Ile)
QR30E coli8-+-+-T-(Leu)G–(Ile)
QR31E coli256---+-T-(Leu)-G-(Gly)G–(Ile)
QR32E coli128---+-T-(Leu)-G-(Gly)G–(Ile)
QR33E coli256<---- -T-(Leu)-G-(Gly)G–(Ile)-AG(Gln)
QR34E coli32-+-+-T-(Leu)G– (Ile)
QR35E coli32-+-+-T-(Leu)G–(Ile)
QR36E coli32-+-+-T-(Leu)G–(Ile)
QR37E coli32-+-+-T-(Leu)G–(Ile)
QR38E coli128---+-T-(Leu)-G-(Gly)G–(Ile)
QR39E coli128---+-T-(Leu)-G-(Gly)G–(Ile)
Strain no.SpeciesMICRT-PCR assayagyrA amino acid at codonparC amino acid at codon

CIPbGyr Par83878091

83878091TCG (Ser)GAC (Asp)TCG (Ser)CGA (Arg)

QR40E coli32-+-+-T-(Leu)G–(Ile)
QR41E coli64-----T-(Leu)-G-(Gly)G–(Ile)-AG(Gln)
QR42E coli32-+-+-T-(Leu)G–(Ile)
QR43E coli32-+-+-T-(Leu)G–(Ile)
QR44E coli32-+-+-T-(Leu)G–(Ile)
QR45E coli6-+-+-T-(Leu)G–(Ile)
QR46E coli4-+-+-T-(Leu)G–(Ile)
QR47E coli3-+-+-T-(Leu)G–(Ile)
QR48E coli32-+-+-T-(Leu)G–(Ile)
100020S flexneri4-----T-(Leu)-G-(Gly)G–(Ile)-AG(Gln)
100053S flexneri4-----T-(Leu)-G-(Gly)G–(Ile)-AG(Gln)
100054S flexneri4-----T-(Leu)-G-(Gly)G–(Ile)-AG(Gln)
100377S flexneri4-----T-(Leu)-G-(Gly)G–(Ile)-AG(Gln)
100378S flexneri4-----T-(Leu)-G-(Gly)G–(Ile)-AG(Gln)
100379S flexneri4-----T-(Leu)A–(Gly)G–(Ile)-AG(Gln)
100449S flexneri16-----T-(Leu)A–(Gly)G–(Ile)-AG(Gln)
100781S flexneri4-----T-(Leu)-G-(Gly)G–(Ile)-AG(Gln)
100782S flexneri16-----T-(Leu)-G-(Gly)G–(Ile)-AG(Gln)
100985S flexneri16-----T-(Leu)A–(Gly)G–(Ile)-AG(Gln)
101464S flexneri4-----T-(Leu)-G-(Gly)G–(Ile)-AG(Gln)
102724S flexneri4-----T-(Leu)-G-(Gly)G–(Ile)-AG(Gln)
102725S flexneri4-----T-(Leu)-G-(Gly)G–(Ile)-AG(Gln)
102726S flexneri4-----T-(Leu)A–(Gly)G–(Ile)-AG(Gln)

a+, emitted fluorescenc; bCIP, Ciprofloxacin; -, did not emit fluorescence.

Two multiplex PCR assays were developed to detect mutations in the QRDRs of gyrA and parC. In the first assay (named Gyr), Taqman MGB probes were designed to detect wild-type nucleotide sequences corresponding to the codons of Ser83 and Asp87 in gyrA; in the second assay (named Par), probes were designed to detect wildtype nucleotide sequences corresponding to the codons of Ser80 and Agr87 in parC. Selective probes for both assays were designed using Primer Express (version 3.0; Applied Biosystems, Foster City, CA, USA) to detect mutations in the second base of the each targeted codon. Template DNA was prepared from each isolate by boiling in 100 μL of 10 mM Tris-HCl (pH 8.0) for 10 minutes. The primers were synthesized by Bioneer (Seoul, Korea), and the probes were synthesized by Applied Biosystems. For each assay set, the probe for one allele was labeled with FAM (6-carboxy-fluorescein) and the other was labeled with VIC (4,7,2'-trichloro- 7'-phenyl-6-carboxyfluorescein). The primers and probes used in this study are shown in Table 2.
Table 2.

Primer and probe sequences for the SNPs tests

Target genePrimerSequence (5’→3’)

gyrADetection primer FTGGTGACGTAATCGGTAAATACCA
Detection primer RGAATGGCTGCGCCATACG
SNP 83 detection probe (FAM)FAM-TGACTCGGCGGTTT- MGBNF
SNP 87 detection probe (VIC)VIC-ACGATAGTGTCATAAAC-MGBNF
parCDetection primer FGACGTACTGGGTAAATACCATCCG
Detection primer RTCAACCAGCGGATAACGGTAA
SNP 80 detection probe (FAM)FAM-GCGATAGCACCTGT-MGBNFQ
SNP 91 detection probe (VIC)VIC-AGAACGGTCGCGCC-MGBNFQ
All of the PCR assays were used in a final volume of 20 μL that contained 5 μL of template DNA with 0.2 μM of each primer, 0.5 μM of each probe, and 10 μL of RT-PCR master mix (Kogen Biotech, Seoul, Korea). All of the assays used the same thermocycling parameters. The reactions were performed in a LightCycler 480 system (Roche Diagnostics, Basel, Switzerland) under the following conditions: one cycle of 50℃ for 5 minutes followed by 40 cycles of 95℃ for 15 seconds and 60℃ for 1 minute.

3. Results

After optimizing each assay, 14 Shigella spp. strains with known mutations in gyrA and/or parC were tested using the Gyr and Par assays. All of the known mutations at Ser83 and Asp87 were successfully detected in the gyrA mutants using the Gyr assay: 10 strains had mutations at Ser83 and one strain had a mutation at both Ser83 and Asp87. Additionally, all of the known mutations in Ser80 and Arg87 were successfully detected in the parC mutants using the Par assays. We assessed PCR amplification in all of the mutant isolates (i.e., those that did not emit fluorescence). Amplification of both the 78-base pair (bp) Gyr assay PCR product and the 98-bp Par assay PCR product were confirmed in all of the tested isolates using electrophoresis (data not shown). To determine the accuracies of the RT-PCR assays, 48 strains of quinolone-resistant pathogenic E coli and 14 S flexneri isolates were tested using both the Gyr and Par assays. The fluorescent signals generated from the RT-PCR Gyr and Par assays were analyzed to determine the presence of mutations in gyrA and/or parC. The PCR results were confirmed by sequencing. All of the PCR results corresponded 100% with the sequencing results (Table 1). Notably, in strain QR24, a fluorescent signal was detected with the Par assay, but sequencing revealed a mutation in parC codon Ala81; however, this mutation at codon Ala81 did not affect the PCR results.

4. Discussion

Resistance to quinolone is caused by a variety of mechanisms, such as a mutation in the targeted enzyme’s coding sequence, participation of the efflux system, and the actions of qnr [15]. Compared with other quinolone-resistance mechanisms, the largest contributing factor to resistance is alteration of the target sequence. Thus, the fast, precise detection of mutations in the QRDRs of the target enzymes is very important for controlling infections caused by quinolone-resistant strains [9]. The RT-PCR assay developed for this study can simultaneously identify mutations in specific regions of the gyrA and parC genes. Compared with similar PCR MIC and nucleotide changes in the QRDRs of the gyrA and parC genes of quinolone-resistant strains of Escherichia coli and Shigella spp a+, emitted fluorescenc; bCIP, Ciprofloxacin; -, did not emit fluorescence. detection methods developed for use in other studies that can only identify one or two mutated sites in gyrA and parC, this RT-PCR assay is relatively simple and fast. In the accuracy test for quinolone-resistant S flexneri isolates, this assay detected different types of mutations at gyrA codon 87. In 10 strains, the codon was mutated from aspartic acid (GAC) to glycine (GGC); in the other four strains, the codon was mutated to asparagine (AAC). This assay was designed to detect mutations in the second base pair of each targeted codon, but it also Primer and probe sequences for the SNPs tests detected mutations in the first base pair of the targeted codon. Therefore, the Par assay can also be influenced by silent mutations in the target site. This assay cannot identify mutations outside of the four target sites (codons 83 and 87 in gyrA and codons 81 and 90 in parC ). Also, it cannot identify mutations in gyrB or parE. However, most mutations that influence quinolone resistance usually include one or more of these four target sites. Identification of mutations at these four target sites is sufficient to explain the resistance mechanism of quinolone-resistant isolates. In conclusion, we developed a simple and efficient RT-PCR assay that simultaneously detects the major gyrA and parC mutations related to quinolone resistance. This assay can be easily applied to laboratory-based surveillance systems as a substitute method forDNAsequencing.
  13 in total

Review 1.  New uses for new and old quinolones and the challenge of resistance.

Authors:  D C Hooper
Journal:  Clin Infect Dis       Date:  2000-02       Impact factor: 9.079

2.  High prevalence of nalidixic acid resistant, ciprofloxacin susceptible phenotype among clinical isolates of Escherichia coli and other Enterobacteriaceae.

Authors:  Joaquim Ruiz; Julián Gómez; Margarita M Navia; Anna Ribera; Josep M Sierra; Francesc Marco; Josep Mensa; Jordi Vila
Journal:  Diagn Microbiol Infect Dis       Date:  2002-04       Impact factor: 2.803

3.  Isolation of quinolone-resistant Escherichia coli found in major rivers in Korea.

Authors:  Dahye Jung; Min Young Lee; Jung Min Kim; Je Chul Lee; Dong Taek Cho; Yeonhee Lee
Journal:  J Microbiol       Date:  2006-12       Impact factor: 3.422

4.  Real-time PCR detection of gyrA and parC mutations in Streptococcus pneumoniae.

Authors:  S Page; F Vernel-Pauillac; O O'Connor; S Bremont; F Charavay; P Courvalin; C Goarant; S Le Hello
Journal:  Antimicrob Agents Chemother       Date:  2008-08-25       Impact factor: 5.191

5.  Rapid detection of a point mutation in the parC gene associated with decreased susceptibility to fluoroquinolones in Mycoplasma bovis.

Authors:  I Lysnyansky; I Mikula; I Gerchman; S Levisohn
Journal:  Antimicrob Agents Chemother       Date:  2009-08-31       Impact factor: 5.191

Review 6.  DNA gyrase, topoisomerase IV, and the 4-quinolones.

Authors:  K Drlica; X Zhao
Journal:  Microbiol Mol Biol Rev       Date:  1997-09       Impact factor: 11.056

7.  Detection of gyrA mutations in quinolone-resistant Salmonella enterica by denaturing high-performance liquid chromatography.

Authors:  Deborah J Eaves; Ernesto Liebana; Martin J Woodward; Laura J V Piddock
Journal:  J Clin Microbiol       Date:  2002-11       Impact factor: 5.948

8.  Comparative studies of mutations in animal isolates and experimental in vitro- and in vivo-selected mutants of Salmonella spp. suggest a counterselection of highly fluoroquinolone-resistant strains in the field.

Authors:  E Giraud; A Brisabois; J L Martel; E Chaslus-Dancla
Journal:  Antimicrob Agents Chemother       Date:  1999-09       Impact factor: 5.191

9.  Geographic distribution of fluoroquinolone-resistant Escherichia coli strains in Asia.

Authors:  Yujiro Uchida; Tomomi Mochimaru; Yuiko Morokuma; Makiko Kiyosuke; Masako Fujise; Fujiko Eto; Yukiko Harada; Masako Kadowaki; Nobuyuki Shimono; Dongchon Kang
Journal:  Int J Antimicrob Agents       Date:  2010-04       Impact factor: 5.283

10.  Resistance to fluoroquinolones by the combination of target site mutations and enhanced expression of genes for efflux pumps in Shigella flexneri and Shigella sonnei strains isolated in Korea.

Authors:  J-Y Kim; S-H Kim; S-M Jeon; M-S Park; H-G Rhie; B-K Lee
Journal:  Clin Microbiol Infect       Date:  2008-08       Impact factor: 8.067

View more
  3 in total

1.  Soft sweep development of resistance in Escherichia coli under fluoroquinolone stress.

Authors:  Xianxing Xie; Ruichen Lv; Chao Yang; Yajun Song; Yanfeng Yan; Yujun Cui; Ruifu Yang
Journal:  J Microbiol       Date:  2019-09-25       Impact factor: 3.422

2.  Rapid Detection of Genomic Mutations in gyrA and parC Genes of Escherichia coli by Multiplex Allele Specific Polymerase Chain Reaction.

Authors:  Sukanlayanee Onseedaeng; Panan Ratthawongjirakul
Journal:  J Clin Lab Anal       Date:  2016-04-13       Impact factor: 2.352

3.  Identification of novel bacterial DNA gyrase inhibitors: An in silico study.

Authors:  Hamzeh Rahimi; Ali Najafi; Habib Eslami; Babak Negahdari; Mehrdad Moosazadeh Moghaddam
Journal:  Res Pharm Sci       Date:  2016 May-Jun
  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.