Detection of Salmonella spp, Salmonella Enteritidis and Typhimurium in naturally infected broiler chickens by a multiplex PCR-based assay.

The presence of Salmonella in the intestinal tract, on the chickens skin and among their feathers, may cause carcasses contamination during slaughtering and processing and possibly it is responsible by the introduction of this microorganism in the slaughterhouses. A rapid method to identify and monitor Salmonella and their sorovars in farm is becoming necessary. A pre-enriched multiplex polymerase chain reaction (m-PCR) assay employing specific primers was developed and used to detect Salmonella at the genus level and to identify the Salmonella enterica serovar Enteritidis (S. Enteritidis) and Salmonella enterica serovar Typhimurium (S. Typhimurium) in broiler chicken swab samples. The method was validated by testing DNA extract from 90 fresh culture cloacal swab samples from poultry chicken cultured in phosphate buffer peptone water at 37 °C for 18 h. The final results showed the presence of Salmonella spp. in 25% of samples, S. Enteritidis was present in 12% of the Salmonella-positive samples and S. Typhimurium in 3% of the samples. The m-PCR assay developed in this study is a specific and rapid alternative method for the identification of Salmonella spp. and allowed the observation of specific serovar contamination in the field conditions within the locations where these chickens are typically raised.

Introduction

Salmonella enterica is the representative pathogen causing salmonellosis in humans and animals worldwide and is sub-classified into more than 2500 serovars. Salmonella serovars Enteritidis and Typhimurium are the most important agents of food-borne salmonellosis in humans (Popoff ). S. Enteritidis was the most prevalent serovar isolated from patients and food preparations in a survey conducted in southern Brazil from 1999 to 2008 (Kottwitz ). It was estimated that approximately 75% of human Salmonella infection cases were due to contaminated food products derived from beef, pork, poultry and eggs (Hald ) Poultry often become infected through the consumption of contaminated feed, cross-contamination in brooding houses, or during slaughter and processing (Doyle ; Fratamico, 2003). With increasing regulatory pressure placed on poultry and livestock processors to reduce pathogen contamination in processed meats, more emphasis is likely to be focused on reducing pathogen contamination on farms (Rasschaert ). Therefore, development of a rapid and sensitive method to Salmonella spp and their serovars is desirable. Several techniques for improving the detection of Salmonella serovars in fecal material such as the use of a selective culture medium and enzyme-linked immunosorbent assay have been developed (Araj and Chugh, 1987, Aspinall ). However, problems remain with sensitivity and specificity that have limited routine use of these procedures. In general, these methods are laborious and time-consuming, in contrast with molecular methods that reduce the time of diagnostic with the same efficiency (Aabo , Malorny ). We herein report a simple, accurate and fast PCR assay to detect and identify Salmonella at the genus level and the serovars Enteritidis and Typhimurium, that utilizes the sequences of the Inv-A, IE-1 and Flic-C respectively (Fratamico and Strobaugh 1998, Rahn ; Wang and Yeh, 2002) as targets for amplification of Salmonella bacteria in broiler swabs.

Materials and Methods

Bacterial strains

S. Enteriditis (ATCC 13076) and Typhimurium (ATCC 14028) were used as reference strains in the m-PCR assays. The Salmonella strains and the non-Salmonella bacterial strains used in this study are listed in Table 1. The isolates were grown in brain and heart infusion broth (Himedia) at 37 °C for 24 h.

Table 1

Bacterial strains used to assay the specificity of the Multiplex PCR. Salmonella and related bacteria were grown in phosphate-buffered peptone water for 24 h at 37 °C prior DNA extraction to use in this m-PCR assay.

Strains	Number of strains	m-PCR positive results from amplified products
		796 bp	316 bp	432 bp
S. Enteritidis	5	5	5	0
S. Typhimurium	3	3	0	3
S. Agnona	2	2	0	0
S. Dublin	2	2	0	0
S. Infantis	4	4	0	0
S. Montevideo	2	2	0	0
S. Newport	2	2	0
Bacillus cereus	1	0	0	0
Bacillus subtilis	1	0	0	0
Citrobacter freundii	2	0	0	0
Enterobacter aerogenes	1	0	0	0
Enterobacter cloacae	1	0	0	0
Escherichia coli	2	0	0	0
Klebisiella pneumonia	2	0	0	0
Morganella morganii	2	0	0	0
Proteus mirabilis	3	0	0	0
Shigella sonnei	2	0	0	0
Staphylococcus aureus	1	0	0	0
Staphylococcus saprophyticus	1	0	0	0

DNA extraction

Pure culture from the different bacteria genera and swabs collected from broiler chickens were cultured in 10 mL of phosphate buffer peptone water (Acumedia) for 18 h. One milliliter of these cultures was then centrifuged at 14,000 × g and re-suspended in 1 mL 0.9% (m/v) saline solution by vortexing. The tubes were centrifuged at 14,000 × g for 5 min, and the supernatants were carefully discarded. The pellets were re-suspended in 0.5 mL 0.1% Triton X-100 (Nuclear) by vortexing. The cell suspensions were held in a boiling water-bath for 10 min to lyse the cells and immediately placed on ice bath. The tubes were then centrifuged for 5 min at 14,000 × g. The supernatants were carefully transferred into new microcentrifuge tubes, and a 4 μL aliquot of the supernatant was used as the template DNA for the m-PCR.

m-PCR experiments

Reactions were carried out in a total volume of 20 μL containing 1 U Taq Polymerase (Invitrogen), 1 × Taq buffer (5 mM KCl, 10 mM Tris-HCl, pH 8.5), 1.5 mM MgCl2, 0.1 mM dNTPs (Promega), 0.9 μM Inv-A primers, and 0.4 μM IE1 and Flic-C primers (Invitrogen). Amplifications were performed in a DNA thermocycler (MJ Research, PTC 100) The m-PCR protocol consisted of an initial denaturation step for 5 min at 95 °C followed by 30 cycles of 1 min at 95 °C, 1 min at 58 °C, and 30 s at 72 °C) and by a final extension step for 7 min at 72 °C. The PCR products were analyzed by electrophoresis using 1.5% agarose gels (Rozen ) with TBE (45 mmol L−1 Tris, pH 8.3, 45 mmol L−1 borate, and 2 mmol L−1 EDTA) as the running buffer. The gels were stained with SYBR® Safe (Invitrogen) and photographed with UV illumination by a photodocumentation system (Loccus, L-PIX HE).

Primer design

For multiplex PCR analysis, two primers pairs were used: Inv-A, which is specific for Salmonella spp. described by Fratamico and Strobaugh (1998) and IE 1, specific for S. Enteritidis described by designed by Wang and Yeh (2002), amplifying fragments of 796 bp and 316 bp. A third primer pair specific for Salmonella Typhimurium was designed in this work to amplify a fragment between 796 and 316 bp (Table 2). Primers were selected from a gene sequence involved in flagellin synthesis from complete sequence from Salmonella Typhimurium strain AY649720, recovered from the GenBank database. Primers were designed using the software Primer 3.0 (Rozen ). The specificity of pair of primers was evaluated by nucleotide similarity searched with the BLAST algorithm at the NCBI website (http://www.ncbi.nlm.nih.gov). Additionally, the PCR amplification was evaluated with DNA samples from the bacterial species listed in Table 2.

Table 2

Primers used for identification of Salmonella spp. Salmonella Enteritidis and Typhimurium.

Primers	Length	Primer sequence 5′ → 3′	Amplification product (bp)	Source
Inv-A forward	22	CGG TGG TTT TAA GCG TAC TCT T	796	Fratamico (2003)
Inv-A reverse	21	CGA ATA TGC TCC ACA AGG TTA
IE-1 forward	20	AGT GCC ATA CTT TTA ATG AC	316	Wang and Yeh (2002)
IE-1 reverse	19	ACT ATG TCG ATA CGG TGG G
Flic-C forward	20	CCCGCTTACAGGTGGACTAC	432	This work
Flic-C reverse	20	AGCGGGTTTTCGGTGGTTGT

PCR sensitivity

PCR sensitivity was determined using suspensions of S. Enteritidis and S. Typhimurium in BHI broth incubated at 37 °C overnight without and with introduction of chicken swab. A serial of 10-fold dilutions was prepared in phosphate-buffered peptone water to obtain suspensions containing 103–108 CFU of each Salmonella serovar per ml. The cell bacterial concentrations were estimated by plating 0.1 mL of each dilution onto BHI agar. The plates were incubated at 37°C overnight, and colonies were counted. Experiments were conducted in triplicate. One milliliter of each dilution was centrifuged at 12,000 × g for 10min and the pellets washed twice with 900 μL of 0.85% saline solution. The pellets were resuspended in 500 μL of 1% Triton X-100, heated in a water bath for 10 min, cooled in ice, and centrifuged at 8000 × g for 5 min. The supernatants containing DNA of each dilution were used in m-PCR, adding five microliters of each serovar Enteritidis and Typhimurium DNA separately and both mixed in order to test the triplex specificity and sensitivity.

Sampling

Newly hatched Cobb chicks were obtained from a commercial broiler hatchery. Feed and drinking water were provided ad libitum. Thirty swabs from cloacae were assessed for the presence of Salmonella spp Enteritidis and Typhimurium on the dietary treatment at 10 and 20 days of chicken age and during the first day of the chick’s housing period.

Results and Discussion

Specificity and sensitivity of multiplex PCR

In the present study, two primer sets were selected to detect Salmonella spp and the serovar Enteritidis and a pair of primers was designed to detect Typhimurium serovar simultaneously using a m-PCR. The pair of primers used to detect Salmonella at genus level codifies the invasion protein A gene (InvA), widely distributed in Salmonella spp (Rahn ; Fratamico 2003; Germini ). The pair of Enteritidis-specific primers, using the IE-1 DNA sequence is an Insertion Element, found only in this serovar (Wang and Yeah, 2002; Silva ). The pair of primers used to detect S. Typhimurium was designed in this work using the gene sequence involved in flagellin synthesis, ie, the Flic-C gene (Soumet ) gives an amplicon size of 432 bp located in the central region of the gene (from nucleotides 794 to 1226) based on DNA sequence from AY649720.1. To asses and evaluate the specificity of the three primers sets, the m-PCR was first optimized and then tested with DNA templates prepared from the 38 bacterial strains, including positive control strains, as shown in Table 1. All bacteria from Salmonella genera showed a 796 bp amplicon, yielded from Inv-A pair of primer amplification. S. Enteritidis showed two amplicons, a 796 bp and a 316 bp amplicon, specific to this serovar, yielded from IE-1 amplification. S. Typhimurium also showed a 796 bp amplicon and a 432 bp specific amplicon, resulted from Flic-C pair of primers amplification. These results confirmed that the Inv-A, IE1 and Flic-C genes were appropriate candidates for the specific detection of Salmonella spp. and serovars Enteritidis and Typhimurium. In recent years, many studies have been published using specific primers complementary to virulence genes in combination with different pre-enrichment strategies (Cardona-Castroa , Kumar at al., 2009, Lim ). Soumet developed an m-PCR assay, but they were not able to detect Salmonella without the isolation of suspicious colonies. In this study we were able to detect Salmonella using pre enrichment culture and it was not necessary to submit the samples to the enrichment step and isolation of suspicious colonies thus reducing the time of analysis in at least 1.5 days. Another advantage is the simplicity of DNA extraction (by boiling), even though the most part of pathogens detection using feces, the DNA is extracted after a treatment with proteinase K and phenolchloroform to eliminate the PCR inhibitors (Frankel , Stone et al., 1999). These techniques, however, greatly increase the detection cost and time and certain chemicals as phenolchloroform also are able to inhibit PCR.

The m-PCR efficiency was not affected in the detection of target microorganisms when DNA of Salmonella Enterititdis and Typhimurium were mixed as observed by comparing PCR product intensity on agarose gel after staining. The m-PCR detection sensitivity was approximately 102 CFU/mL of S. Enteritidis mL− and S. Typhimurium in phosphate-buffered peptone water (Figure 1). While these serovars were cultured with swab material this sensitivity was reduced to 103 CFU/mL, showing matrix effect in amplification results. This was possible because swab as fecal samples might contain PCR inhibitors.

Figure 1

Multiplex PCR assay with the primers sets Inv-A, IE-1 and Flic-C, respectively. Lane M: 1Kb ladder (Invitrogen); Lane 1: Negative control; Lane 2: S. Enteritidis (ATCC 14028); Lane 3: S. Typhimurium; Lanes 4 to 7: PCR results from a serial of 10-fold dilutions prepared in phosphate-buffered peptone water containing 105 to 102 CFU/mL of S. Enteritidis and S. Typhimurium.

Analysis of cloacal chicken swabs

Ninety chicken cloacae swabs from poultry collected on the first, tenth, and twentieth days of age were cultured in peptone water for 18 h and used to extract DNA for m-PCR assays. It was verified whether the m-PCR assay could be applied in samples from field conditions (Figure 2). The amplification of Salmonella spp and serovars Enteritis and Typhimurium in chicken swab samples naturally infected presented a reliable sensitivity of the method.

Figure 2

Fragments resulting from m-PCR of chicken cloacal swabs. Lane M: 1 kb ladder (Invitrogen); Lane 1: negative control. Lanes 2 to 6: non contaminated chicken swabs samples. Lanes 7, 8 and 9: PCR positive controls: S. Infantis, S. Enteritidis and S. Typhimurium, respectively. Lanes 10 to 12: positive naturally contaminated swabs samples.

Salmonella spp., S. Enteritidis and Typhimurium were not detected in any of the first day collected chicken samples suggesting that the birds were originally Salmonella-free at the hatchery. However, on the tenth day, 12 samples were positive for Salmonella spp., five of them belonging to the serovar Enteritidis and 2 of them to the Typhimurium serovar (Table 3). Finally, on the twentieth day, ten samples were positive for Salmonella spp., and six of them belonging to the serovar Enteritidis and none Typhimurium serovar was detected. This tendency in reduction of contamination throughout 20 days was possible because the newly hatched chicks are highly susceptible to infection with Salmonella than the older because the acquisition of microorganisms that constitute the normal chickens intestinal microbiota as pointed is gradual (Sterzo et al., 1994). Infected young birds excrete Salmonella in the feces at greater rates (higher concentration of bacteria and higher number of birds) when compared to excretion by older infected chickens (Smith et al., 1995). Therefore it is possible to conclude that the m-PCR assay described herein was found to be a rapid and simple method to detect the Salmonella genus and for the identification of S. Enteritidis and Typhimurium in chicken swab samples.

Table 3

Number of samples positive for Salmonella spp., S. Enteritidis and Typhimurium from swabs cloacae of poultry.

	Number of contaminated chicken samples per day of life
	first day	10 days	20 days	Total
S. Enteritidis	0/30	5/30	6/30	11/90
S. Typhimuruim	0/30	2/30	0/30	3/90
Other (s) Salmonella*	0/30	5/30	4/30	9/90
Salmonella spp	0/30	12/30	10/30	22/90

Represents Salmonella spp serovars of Salmonella enterica except the serovars Enteritidis and Typhimurium.