| Literature DB >> 24123815 |
Jesús Aranda1, Margarita Poza, Miguel Shingu-Vázquez, Pilar Cortés, John D Boyce, Ben Adler, Jordi Barbé, Germán Bou.
Abstract
The transcriptional response of Acinetobacter baumannii, a major cause of nosocomial infections, to the DNA-damaging agent mitomycin C (MMC) was studied using DNA microarray technology. Most of the 39 genes induced by MMC were related to either prophages or encoded proteins involved in DNA repair. Electrophoretic mobility shift assays demonstrated that the product of the A. baumannii MMC-inducible umuD gene (umuDAb) specifically binds to the palindromic sequence TTGAAAATGTAACTTTTTCAA present in its promoter region. Mutations in this palindromic region abolished UmuDAb protein binding. A comparison of the promoter regions of all MMC-induced genes identified four additional transcriptional units with similar palindromic sequences recognized and specifically bound by UmuDAb. Therefore, the UmuDAb regulon consists of at least eight genes encoding seven predicted error-prone DNA polymerase V components and DddR, a protein of unknown function. Expression of these genes was not induced in the MMC-treated recA mutant. Furthermore, inactivation of the umuDAb gene resulted in the deregulation of all DNA-damage-induced genes containing the described palindromic DNA motif. Together, these findings suggest that UmuDAb is a direct regulator of the DNA damage response in A. baumannii.Entities:
Mesh:
Substances:
Year: 2013 PMID: 24123815 PMCID: PMC3889614 DOI: 10.1128/JB.00853-13
Source DB: PubMed Journal: J Bacteriol ISSN: 0021-9193 Impact factor: 3.490