Literature DB >> 24088260

Proposal of a quantitative PCR-based protocol for an optimal Pseudomonas aeruginosa detection in patients with cystic fibrosis.

Florence Le Gall1, Rozenn Le Berre, Sylvain Rosec, Jeanne Hardy, Stéphanie Gouriou, Sylvie Boisramé-Gastrin, Sophie Vallet, Gilles Rault, Christopher Payan, Geneviève Héry-Arnaud.   

Abstract

BACKGROUND: The lung of patients with cystic fibrosis (CF) is particularly sensitive to Pseudomonas aeruginosa. This bacterium plays an important role in the poor outcome of CF patients. During the disease progress, first acquisition of P. aeruginosa is the key-step in the management of CF patients. Quantitative PCR (qPCR) offers an opportunity to detect earlier the first acquisition of P. aeruginosa by CF patients. Given the lack of a validated protocol, our goal was to find an optimal molecular protocol for detection of P. aeruginosa in CF patients.
METHODS: We compared two formerly described qPCR formats in early detection of P. aeruginosa in CF sputum samples: a qPCR targeting oprL gene, and a multiplex PCR targeting gyrB and ecfX genes.
RESULTS: Tested in vitro on a large panel of P. aeruginosa isolates and others gram-negative bacilli, oprL qPCR exhibited a better sensitivity (threshold of 10 CFU/mL versus 730 CFU/mL), whereas the gyrB/ecfX qPCR exhibited a better specificity (90% versus 73%). These results were validated ex vivo on 46 CF sputum samples positive for P. aeruginosa in culture. Ex vivo assays revealed that qPCR detected 100 times more bacterial cells than culture-based method did.
CONCLUSION: Based on these results, we proposed a reference molecular protocol combining the two qPCRs, which offers a sensitivity of 100% with a threshold of 10 CFU/mL and a specificity of 100%. This combined qPCR-based protocol can be adapted and used for other future prospective studies.

Entities:  

Mesh:

Substances:

Year:  2013        PMID: 24088260      PMCID: PMC3691768          DOI: 10.1186/1471-2180-13-143

Source DB:  PubMed          Journal:  BMC Microbiol        ISSN: 1471-2180            Impact factor:   3.605


Background

Pseudomonas aeruginosa is the major pathogen involved in the decline of lung function in patients with cystic fibrosis (CF) [1-5]. Its presence in the lungs is associated with an increased mortality and morbidity of CF patients [6]. Early detection of this bacterium from respiratory tract is determinant because it ensures effective patient management [5,7,8]. Indeed, after intermittent colonization by different strains, once acquired, chronic P. aeruginosa colonization by mucoid and biofilm-growing isolates is difficult to eradicate [2,4,9,10]. Thus, the earlier the treatment toward P. aeruginosa onset, the higher the chance to efficiently control P. aeruginosa [5,7,8]. However, accurate identification of this bacterium in CF sputum by conventional microbiology techniques is known to be limited. This can be explained by a large phenotypic diversity of P. aeruginosa isolates recovered from CF patients such as loss of pigment production or exopolysaccharide production. Moreover, Singh et al. demonstrated that P. aeruginosa can form biofilms in the airways of CF patients [11]. Biofilms contain bacterial cells that are in a wide range of physiological states. One of the mechanisms contributing to this physiological heterogeneity includes the adaptation to the local environmental conditions. For instance, bacterial cells from the deep layers of biofilm depleted of oxygen [12] can grow in anaerobic conditions. Therefore, the CF patients isolates obtained from biofilms, i.e. in anaerobic conditions, grow hardly in aerobic conditions on a conventional culture medium [13]. Another limitation of conventional culture is that P. aeruginosa can be easily misidentified with closely related Gram-negative bacilli in CF sputum [14-19]. The use of molecular techniques such as PCR could improve accurate identification of P. aeruginosa [14-19], and consequently, its early detection in CF sputum patients [20-24]. To date, there is no consensus for a universal protocol for the molecular detection of P. aeruginosa. Indeed, its genome is known to be highly polymorphic. Changes that can occur at the genetic level could compromise the reliability of molecular identification techniques. In particular in CF patients lungs, most of the recovered isolates are hypermutable [2,4,25,26], and show a high genetic plasticity by acquisition or loss of genes [27,28]. Since mutations or gene deletions occur on PCR target sequences, they could decrease the sensitivity of the method [29]. Moreover, horizontal genetic transfer with other bacterial species present in the CF lung niche can impact upon the specificity of the PCR [14]. In a prospective multicenter study, we aimed to assess the role of PCR for the early detection of P. aeruginosa in CF patients; we evaluated two qPCRs in detection of P. aeruginosa: a simplex qPCR targeting oprL gene [30], and a multiplex qPCR, targeting gyrB and ecfX genes [14]. The sensitivity and the specificity of both qPCRs were initially evaluated testing a large panel of P. aeruginosa isolates and closely related non-P. aeruginosa gram-negative bacilli isolates from CF patients. Then, the two different qPCRs ability in detection of P. aeruginosa were tested ex vivo, i.e in CF sputum samples. Finally, we were able to propose a promising reference protocol combining these two qPCRs for an optimal detection of P. aeruginosa in clinical setting.

Methods

Bacterial collection

Thirty-six P. aeruginosa isolates, including mucoid and non mucoid forms, were obtained from 31 sputum samples of CF patients and from 5 samples of non CF patients (blood, n = 1; stool, n = 1; urine, n = 1; sputum, n = 1; peritoneal fluid, n = 1), attending three French University Hospitals, the CHRU of Brest (n = 3), the CHU of Nantes (n = 26), and the GHSR of Saint Pierre, La Réunion (n = 2). The reference strain P. aeruginosa CIP 76.110 was also included in the study. Forty-one closely related non-P. aeruginosa gram-negative bacillus isolates were collected, including 26 obtained from sputum samples of CF patients, and 15 from clinical samples of non CF patients (n = 13) or environmental samples (n = 2). Sixteen species were represented: Achromobacter xylosoxidans (n = 9), P. putida (n = 5), Stenotrophomonas maltophilia (n = 5), Burkholderia cepacia (n = 4), B. multivorans (n = 3), B. gladioli (n = 2), Chryseobacterium indologenes (n = 2), Elizabethkingia meningoseptica (n = 2), P. stutzeri (n = 2), B. cenocepacia (n = 1), Flavimonas oryzihabitans (n = 1), Pandoraea pnomenusa (n = 1), P. fluorescens (n = 1), Ralstonia picketti (n = 1), Roseomonas spp. (n = 1), and Shewanella putrefaciens (n = 1). Identification of bacterial isolates was previously conducted based on phenotypical and morphological criteria (colony morphology, pigmentation, lactose fermentation, oxidase activity checked with 1% tetramethyl p-phenylenediamine dihydrochloride, sensitivity to antibiotics). Atypical P. aeruginosa isolates, for which difficulties of identification were encountered, were further analyzed with biochemical tests [API 20NE system (bioMérieux, Marcy l’Etoile, France), ID 32GN (bioMérieux)], or with the gram-negative bacillus identification card on VITEK 2 Compact (bioMéreux). All non- P. aeruginosa gram-negative bacillus isolates were identified by 16S rRNA gene sequencing as previously described [31]. All bacteria were stored at -80°C. Bacteria from frozen stocks were grown aerobically at 37°C for 24 to 48 hours on Muller-Hinton medium (bioMérieux).

P. aeruginosa detection and quantification by sputum samples culture

CF patients and sample processing

Fourty-six sputa were selected in line with our study objective. These CF sputum samples have been collected from 34 patients (median age: 11 years, range: 4-29, 53% female) attending the CF center of Roscoff (France), between March 2008 and May 2012. At the time of CF patients inclusion, all of the patients were P. aeruginosa free for at least one year. More precisely, according to the Leeds definition [32], ten of them were never and 22 were free (Table 1). Each sputum sample was mixed with equal volume of dithiothreitol (Digesteur® Eurobio, Courtaboeuf, France) and incubated at room temperature for 30 min. For isolation of P. aeruginosa, liquefied sputa were immediately processed. For molecular detection of P. aeruginosa, two one-milliliter aliquots of every liquefied sputum were stored at -80°C.
Table 1

Quantification of in CF sputum samples by culture and the L qPCR and detection by the B/X qPCR

CF patient
CF sputum sampleQuantification (CFU/mL)
Multiplex qPCR detection (gyrB/ecfX)
Anonymisation numberP. aeruginosa category*By cultureBy oprL qPCR**
003
F
1
0.0E + 00
7.5E + 00
-/-
 
 
2
0.0E + 00
1.4E + 03
+/-
 
 
3
2.0E + 05
2.7E + 06
+/+
004
F
4
2.0E + 03
1.2E + 05
+/+
010
F
5
1.0E + 04
9.9E + 06
+/+
012
F
6
0.0E + 00
5.0E + 01
+/-
 
 
7
0.0E + 00
7.5E + 01
-/-
 
 
8
0.0E + 00
2.1E + 02
-/-
 
 
9
1.0E + 07
7.8E + 06
+/-
013
F
10
1.0E + 08
4.0E + 09
+/+
014
N
11
1.0E + 06
5.5E + 06
+/+
023
N
12
4.0E + 01
2.5E + 03
+/-
024
F
13
1.0E + 03
1.3E + 05
+/+
025
N
14
5.0E + 04
4.3E + 07
+/+
 
 
15
1.0E + 05
3.8E + 03
+/+
026
N
16
2.0E + 06
6.7E + 07
+/+
028
F
17
1.0E + 04
1.1E + 05
+/+
030
F
18
1.0E + 03
1.3E + 04
+/+
031
N
19
1.0E + 06
1.2E + 07
+/+
 
 
20
2.0E + 07
1.0E + 08
+/+
034
F
21
4.0E + 02
6.8E + 04
+/+
035
F
22
1.0E + 04
2.7E + 04
+/+
040
F
23
1.0E + 06
1.4E + 06
+/+
041
F
24
1.0E + 02
4.9E + 01
+/-
043
N
25
6.0E + 02
5.6E + 06
+/+
047
N
26
0.0E + 00
1.1E + 03
+/+
 
 
27
0.0E + 00
5.3E + 03
+/+
 
 
28
1.0E + 07
1.1E + 07
+/+
048
F
29
0.0E + 00
8.1E + 02
+/+
 
 
30
4.0E + 01
2.5E + 02
+/+
053
F
31
1.0E + 02
5.1E + 03
+/+
054
N
32
0.0E + 00
2.3E + 01
-/-
 
 
33
2.0E + 05
3.7E + 06
+/+
057
F
34
1.0E + 06
2.0E + 01
-/-
060
F
35
4.0E + 06
1.5E + 08
+/+
061
F
36
1.0E + 02
6.1E + 03
+/+
066
F
37
4.0E + 03
3.1E + 04
+/+
 
 
38
1.0E + 04
9.5E + 06
+/+
070
N
39
1.0E + 06
9.0E + 07
+/+
072
F
40
4.0E + 04
7.8E + 07
+/+
076
F
41
1.0E + 03
1.5E + 04
+/+
078
F
42
1.0E + 02
2.0E + 04
+/+
202
F
43
1.0E + 05
1.7E + 05
+/-
205
F
44
1.0E + 03
3.3E + 06
+/+
220
F
45
1.0E + 06
2.3E + 08
+/+
256
N
46
1.0E + 03
3.4E + 04
+/+
mean  3.3E + 061.2E + 08NA

*F: Free; N: Never (Lee et al., 2003).

**mean of quantification by oprL qPCR tested in duplicate.

NA: not applicable.

Quantification of in CF sputum samples by culture and the L qPCR and detection by the B/X qPCR *F: Free; N: Never (Lee et al., 2003). **mean of quantification by oprL qPCR tested in duplicate. NA: not applicable.

P. aeruginosa isolation

Ten μl of liquefied sputum pure and diluted into 1/1000, were inoculated and incubated onto several non selective and selective media for P. aeruginosa isolation, including Columbia blood agar supplemented with 5% defribinated horse blood (Oxoid, Dardilly, France), Columbia chocolate agar (Oxoid), and cetrimide agar (Oxoid). All media were incubated aerobically at 37°C for five days and monitored daily. All different morphotypes of bacterial colonies were identified phenotypically with conventional screening methods (Gram coloration, oxidase test) followed by mass spectrometry identification (MicroFlex LT, Bruker Daltonics, Germany) [33,34]. Quantification was conducted based on the colony forming unit (CFU) counts and the dilution ratio of the plate.

P. aeruginosa detection and quantification by quantitative PCR (qPCR)

DNA extraction

For each isolate of the bacterial collection, 1 ml of a 0.5 McFarland suspension was extracted. For each sputum sample, one of the two 1 ml-aliquots was treated by 5 min of sonication using a bath sonicator (Elamsonic S10, Singen, Germany). After a 10 min-centrifugation (5000 g), the pellet was suspended in 200 μl of DNA free water. Ten μl of the IC2, an internal control provided in the DICO Extra r-gene™ kit (Argène, Verniolle, France), were added in each sample and, for each batch of extraction, in 200 μl of DNA free water as a negative control. DNA was extracted using the QIAamp DNA Minikit® (Qiagen, Courtaboeuf, France) according to the instructions of the manufacturer (“Tissue protocol”) with elution volumes of 100 μl.

oprL qPCR

oprL qPCR was performed using primers OPRL-F and OPRL-R and hydrolysis probe oprL-MGB, previously described by Joly et al. [30] (Table 2). The reaction mix comprised 12.5 μl of Qiagen Quantitect Probe Master Mix, 0.3 μM of each primer, 0.2 μM of hydrolysis probe and 4.5 μl of DNA extract, and was made up to a final reaction volume of 25 μl with water. A negative amplification control was used for each batch. For sputum samples, a standard curve provided a full concentration range of P. aeruginosa extending from 102 to 106 CFU/mL. Each qPCR assay was repeated twice, and the mean value of the quantification was calculated for each duplicate (Table 1). Cycling was performed on an ABI Prism 7300 Real Time PCR System (Applied Biosystem, Foster city, Californy), with an initial hold at 95°C for 15 min, followed by 50 cycles at 95°C for 15 s, and 60°C for 1 min. The oprL-MGB probe was labelled with carboxyfluorescein (FAM).
Table 2

Primers and probes used in this study for the detection and quantification of

NameSequence (5′- 3′)*DNA targetReference
OPRL-F
AACAGCGGTGCCGTTGAC
oprL
[30]
OPRL-R
GTCGGAGCTGTCGTACTCGAA
oprL
[30]
oprL-MGB
fam -TGAGCGACGAAGCC-bhq
oprL
[30]
gyrB-F
CCTGACCATCCGTCGCCACAAC
gyrB
[19,36]
gyrB-F
CGCAGCAGGATGCCGACGCC
gyrB
[19,36]
gyrB-TM
fam-CCGTGGTGGTAGACCTGTTCCCAGACC-bhq
gyrB
[14]
ecfX-F
CGCATGCCTATCAGGCGTT
ecfX
[14]
ecfX-R
GAACTGCCCAGGTGCTTGC
ecfX
[14]
ecfX-TMyak-ATGGCGAGTTGCTGCGCTTCCT-bhqecfX[14]

*yak = Yakima Yellow; fam = carboxyfluorescein; bhq = block hole quencher.

Primers and probes used in this study for the detection and quantification of *yak = Yakima Yellow; fam = carboxyfluorescein; bhq = block hole quencher.

gyrB/ecfX qPCR

The P. aeruginosa multiplex PCR was performed using primers ecfX-F, ecfX-R, gyrB-F, gyrB-F, and hydrolysis probes ecfX-TM and gyrB-TM, previously described by Anuj in 2009 [14] (Table 2). The reaction mix comprised 12.5 μl of Qiagen Quantitect Probe Master Mix, 0.4 μM of each primer, 0.16 μM of each hydrolysis probe, and 4.5 μl of DNA extract and was made up to a final reaction volume of 25 μl with free DNA water. All qPCR reaction plates contained negative amplification controls. For reaction plates containing sputum samples, a broad-range of P. aeruginosa concentrations from 102 to 106 CFU/mL was tested. Cycling was performed on an ABI Prism 7300 Real Time PCR System (Applied Biosystem), with an initial hold at 95°C for 15 min, followed by 50 cycles at 95°C for 15 s, and 60°C for 1 min. The gyrB-TM probe was labelled with carboxyfluorescein (FAM), whereas the ecfX-TM probe was labeled with a Yakima Yellow fluorophore, enabling the reaction to be distinguished using the ABI 7300 FAM and JOE detection channels, respectively. Results were analyzed by the 7300 System SDS logiciel (Applied biosystem). The gyrB/ecfX qPCR was considered positive when at least one of the two target genes was detected.

DICO extra r-gene amplification

Ten microliter of extracted sputum samples were distributed in 15 μl of the DICO Extra r-gene premix (DP2, Argène) with 0.1 μl of the HotStarTaq™ (Qiagen). The amplification program recommended by the manufacturer was applied on the automate ABI Prism 7300 Real Time PCR System (Applied Biosystem). The validation of both DNA isolation and amplification procedures, as well as the samples result interpretation, were conducted according to the instructions by Argene.

Determination of the lower detection threshold

To determine the lower detection threshold, six dilution ranges were realized with six different P. aeruginosa isolates. One range was prepared with the reference strain (CIP 76.110), two with a mucoid and a non-mucoid isolates from a sputum sample of a CF patient, and three with three isolates from three non-CF patients (urine, n = 1; blood, n = 1; stool, n = 1). Ten fold iterative dilutions from 0.5 McFarland calibrated P. aeruginosa suspensions provided a full concentration range extending from 100 to 108 CFU/mL. The nine dilutions of the range were tested 30 times. To determine the exact inoculum of each dilution range, a plate counting was carried out on a Mueller-Hinton medium (bioMérieux) incubated from 24 to 48 hours at 30°C. A mean of the results was calculated taking into account the sum of all assays.

Ethics

The Comité de Protection des Personnes Ouest VI approved the protocol. All of the patients and their relatives gave written informed consent. The collection of archival specimens was registered with the French Ministry of Research and the Agence Régionale de l’Hospitalisation, No. DC-2008-214.

Results

In vitro characteristics of the oprL and gyrB/ecfX qPCR

Sensitivity

The two qPCRs showed 100% sensitivity. At the concentration of 106 CFU/mL, all the 37 P. aeruginosa isolates were detected by the two qPCRs. The cycle treshold (Cq) mean was 24.8 and 24/28.2 respectively for the oprL qPCR and the gyrB/ecfX qPCR.

Specificity

The specificity of the oprL qPCR was evaluated at 73%. At the concentration of 106 CFU/mL, eleven isolates out of the 41 non-P. aeruginosa gram-negative bacillus isolates, corresponding to six different species, were amplified by the oprL qPCR. The six species responsible for cross-reactions were A. xylosoxidans, B. cenocepacia, B. multivorans, E. meningoseptica, Roseomonas spp., and S. maltophilia (Table 3). By considering the gyrB/ecfX qPCR positive when at least one of the two targeted genes was amplified, the specificity was calculated at 90%. Four out of the 41 isolates corresponding to four different species induced false positive reactions in at least one of their assays (Table 3): C. indologenes, F. oryzihabitans, P. putida and P. stutzeri. No species cross-reacted with both qPCRs. In this manner, combining oprL and gyrB/ecfX amplifications allowed achieving 100% specificity.
Table 3

Bacterial species responsible for false positive amplifications with the L and B X qPCRs

SpeciesNumber of isolates PCR+ / number of isolates testedoprL qPCR resultsgyrB /ecf X qPCR results
Achromobacter xylosoxidans
6/9
+
- / -
Burkholderia cenocepacia
1/1
+
- / -
Burkholderia multivorans
1/3
+
- / -
Chryseobacterium indologenes
1/2
-
+ / +
Elizabethkingia meningoseptica
1/2
+
- / -
Flavimonas oryzihabitans
1/1
-
+ / +
Pseudomonas putida
1/5
-
- / +
Pseudomonas stutzeri
1/2
-
- / +
Roseomonas spp.
1/1
+
- / -
Stenotrophomonas maltophilia1/5+- / -
Bacterial species responsible for false positive amplifications with the L and B X qPCRs

Lower detection threshold

The lower detection threshold of the oprL qPCR was evaluated at 10 CFU/mL. Given a positive multiplex PCR when at least one of the two probes was detected, the detection threshold of the gyrB/ecfX qPCR was evaluated at 730 CFU/mL.

Ex vivo validation of the detection and quantification of P. aeruginosa in CF sputa by the two qPCRs

The oprL qPCR detected P. aeruginosa in all the 46 CF sputum samples. The multiplex PCR failed to detect the bacterium in five samples. The mean quantification of P. aeruginosa of these samples was evaluated at 67.1 CFU/mL, i.e. under the lower detection threshold of the gyrB/ecfX qPCR. For six of the 46 samples, only one probe (gyrB) was detected positive. Comparison of the results of P. aeruginosa quantification in CF sputum samples by culture and oprL qPCR is reported in Table 1. For 37 out of the 46 sputum samples tested, the quantification found by PCR is at least one log above the one found by culture. In average, for the 46 tested sputum samples, the molecular quantification of P. aeruginosa was two logs higher than the conventional culture quantification (1.2E + 08 CFU/mL versus 3.3E + 06 CFU/mL).

Consistency between in vitro and ex vivo experiments

The theoretical threshold calculated from in vitro experiments was totally consistent with the observed threshold from ex vivo experiments. Indeed, oprL qPCR assays performed ex vivo identified one hundred times more bacterial cells than culture-based methods did. Thus, the theoretical lower detection threshold of oprL qPCR of 10 CFU/mL calculated from in vitro cultures is equivalent to a threshold of 1E + 03 CFU/mL if applied ex vivo. This was verified on 9 culture-/PCR + samples for which the quantification by oprL qPCR retrieved a mean of quantification of 997.3 CFU/mL. The theoretical lower detection of the multiplex qPCR was found at 7.3E + 02 CFU/mL in vitro. Ex vivo, the amplification conducted on the sputum samples showed a positive signal for at least one target (gyrB or ecfX) for all of the P. aeruginosa-positive sputa with quantification above 7.3E + 02 CFU/mL (n = 38). On the contrary, below 7.3E + 02 CFU/mL, the majority (5 of 8 samples) of the sputa that were P. aeruginosa-positive by oprL PCR, were P. aeruginosa-negative by multiplex PCR. To conclude, the theoretical thresholds of both qPCRs were verified on the sputum samples.

Discussion and conclusion

Several studies have suggested that qPCR is superior to culture for detecting early colonization of P. aeruginosa in CF sputum [20,22-24]. Today, the main goal is to have an optimal protocol as the gold standard for the molecular detection of P. aeruginosa. Therefore, we performed in vitro and ex vivo evaluation of two qPCRs, one targeting the oprL gene and the other targeting simultaneously gyrB and ecfX genes [14,30]. Numerous DNA targets have been described for the amplification of P. aeruginosa[15,17,19,34-36], of these three housekeeping genes, oprL, gyrB and ecfX have been reported to be reliable targets in the detection of P. aeruginosa[14,19,30,35]. The first criterion for an optimal technique in early detection of P. aeruginosa in CF sputum is related to the choice of the PCR format and its optimization. Today, the DNA molecules counting of a particular sequence in a complex sample can be achieved with exceptional accuracy and sensitivity sufficient to detect a single molecule [36]. As underlined by Deschagt et al. [35], the choice of PCR format may influence the performance of the molecular detection. We chose a probe-based assay, which is known to be more sensitive and specific than the SYBR Green-based qPCR [35]. The second criterion is a good sensitivity to prevent false negative results. Despite wide genetic variability of P. aeruginosa isolates recovered from CF patients [2,4,25-28], results of previous studies aiming at detecting P. aeruginosa by PCR have been encouraging. In our study, both evaluated qPCRs showed an excellent sensitivity covering all the tested panel of P. aeruginosa isolates. Focusing on the lower detection threshold, the difference was significant between the two qPCR assays with a detection threshold of 10 CFU/mL for the oprL qPCR versus 730 CFU/mL for the multiplex PCR. The sensitivity of the in vitro oprL qPCR in our study was higher than that recommended by the French guidelines, i.e. a detection threshold of 102 CFU/mL for CF sputum sample [37]. The third criterion needed for early P. aeruginosa detection technique, in particular, for molecular one, is to have a high specificity to prevent false positive amplification. When looking at a large panel of genes described in the literature e.g. oprI, oprL, rrl, ecfX, gyrB, or rrs, specificity varied from 74% to 100% [14,17,34-36,38]. In our study, specificity of the oprL qPCR was evaluated at 73% versus 90% for the multiplex PCR. Four previous studies have tested the specificity of the oprL primer pairs and found different values ranging from 87% to 100% [22,34,35,38]. Again, previous studies looking at gyrB and ecfX genes found a better specificity (100%) than in our study [14,35]. Different reasons could explain these discrepancies. Firstly, our specificity could have been influenced by a larger panel of closely related non P. aeruginosa gram-negative bacilli (41 isolates including 16 different species). Secondly, all the bacterial isolates (except one reference strain) were recovered from clinical samples (CF or non CF) or from environmental samples. These isolates, which were recovered from CF could have undergone genetic exchange with other species in the natural CF microenvironment, especially P. aeruginosa, influencing the specificity of the molecular method [38]. Thus, specificity in previous studies could have been overestimated [14,34,35,38]. As highlighted by Anuj et al. [14,35], the higher specificity of our results for the multiplex PCR may be explained by the fact that we amplified at least 2 DNA targets. The use of two probes simultaneously seems to improve the specificity, providing at the same time the detection and the confirmation of the presence of P. aeruginosa[14,19]. Interestingly, our bacterial species that cross-reacted with the oprL qPCR did not do so when oprL qPCR was combined with the multiplex PCR thus allowing 100% specificity. These results were successfully validated by the sputum samples of CF patients from the never or free categories according to the definition of Leeds [32]. The ex vivo experiments put forward a significant difference between the culture-based quantification and the qPCR-based quantification. In average, the qPCR detected 100 times more CFU of P. aeruginosa than the culture did. This could be explained by different hypotheses. First, the difference in utilized sputum volumes contributes to this discrepancy. Indeed, only 10 μl were cultured whereas 1 ml was extracted for the qPCR. The lowest concentration that theoretically can be detected by qPCR equals the presence of one genome (i.e. equivalent to one CFU) per qPCR reaction mixture. Using 1 ml of 10-fold concentrated sputum by centrifugation and extraction (elution volume of 100 μl) and 4.5 μl for the PCR reaction (final volume of 25 μl), the detection limit of our molecular diagnosis is ≈22 CFU/mL. In comparison, the lowest concentration that theoretically can be detected by culture is 100 CFU/mL. Second, given the phenotypic diversity of P. aeruginosa isolates and the large diversity of species found in pulmonary microbiota, the detection of P. aeruginosa by culture in CF sputum is a hard task [14-19]. Moreover, culture in aerobic conditions can fail in the detection of some isolates adapted to anaerobic conditions of the CF lung niche [13], or of non-cultivable isolates present in the bacterial biofilm [39]. Another explanation could be that qPCR detects P. aeruginosa DNA, i.e. not only live bacteria but also dead cells [40]. As CF patients are chronically treated with antibiotics, one can suppose that dead bacteria are significantly present in the pulmonary tract. In a study lead by Deschaght et al. in 2009, no difference in sensitivity between culture and oprL qPCR was found [41]. Their study was conducted on eight artificial P. aeruginosa-positive sputum pre-liquefied samples thus skipping the sample homogenization step, one of the cornerstones in amplification-based technique. Our ex vivo application of the two qPCR assays with real samples took into account the sample homogenization. It also put forward the importance of having a controlled amplification assay in particular to avoid false negatives due to inhibitors or a bad extraction. Indeed, the DNA-extraction method has been shown to be a critical step in the PCR performances [41]. In our study, we chose the DICO Extra r-gene kit, a totally artificial DNA, as internal control, which prevents from contamination during procedure handling, and allows to test extraction and amplification at the same time. Altogether, our study showed that the oprL qPCR offers a good sensitivity whereas the multiplex PCR offers a good specificity. Based on these data, we decided to combine these two qPCR assays and proposed a molecular protocol for an optimal detection of P. aeruginosa by qPCR in CF sputum as follows (Figure 1). The oprL qPCR can be applied in screening because of its good sensitivity. In case of a doubtful or a positive result, we can proceed to the multiplex PCR. Interpretation of the multiplex PCR takes into account the quantification found with oprL PCR. Below the detection threshold of 730 CFU/mL, the oprL qPCR prevails over the multiplex PCR. Conversely, beyond this threshold, the multiplex PCR prevails over the oprL qPCR. Overall, this combined molecular protocol offers a sensitivity of 100% with a threshold of 10 CFU/mL and a specificity of 100%.
Figure 1

Proposal of a molecular protocol integrating two qPCR formats (targeting L and B/X genes) for an early detection of in sputum samples of patients with cystic fibrosis. The oprL qPCR is applied in screening because of its good sensitivity. In case of a doubtful or a positive result, the gyrB/ecfX qPCR is applied in a second time. Interpretation of the gyrB/ecfX qPCR takes into account the quantification found with oprL qPCR. Below the detection threshold of 730 CFU/mL, the oprL qPCR prevails over the gyrB/ecfX qPCR. Conversely, beyond this threshold, the gyrB/ecfX qPCR prevails over the oprL qPCR.

Proposal of a molecular protocol integrating two qPCR formats (targeting L and B/X genes) for an early detection of in sputum samples of patients with cystic fibrosis. The oprL qPCR is applied in screening because of its good sensitivity. In case of a doubtful or a positive result, the gyrB/ecfX qPCR is applied in a second time. Interpretation of the gyrB/ecfX qPCR takes into account the quantification found with oprL qPCR. Below the detection threshold of 730 CFU/mL, the oprL qPCR prevails over the gyrB/ecfX qPCR. Conversely, beyond this threshold, the gyrB/ecfX qPCR prevails over the oprL qPCR. This qPCR-based combined protocol can be adapted for instance in a subgroup of non-sputum producing patients and used for other future prospective studies. Indeed, the initial colonization of P. aeruginosa often occurs in CF patients who do not produce sputum (e.g. mainly children). This qPCR format should therefore be tested on the sample secretions routinely obtained from, e.g. deep throat swabs or endolaryngeal suction.

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

GHA, FLG, and RLB conceived the study and designed the experiments. FLG, GHA and RLB wrote the manuscript. FLG, SR, JH, SG and GHA performed the experiments. SBG, SV, CP and GR helped with the manuscript discussion. All authors have read and approved the final manuscript.
  40 in total

1.  Improved early diagnosis of Pseudomonas aeruginosa by real-time PCR to prevent chronic colonisation in a paediatric cystic fibrosis population.

Authors:  Elaine McCulloch; Carol Lucas; Gordon Ramage; Craig Williams
Journal:  J Cyst Fibros       Date:  2011-01       Impact factor: 5.482

Review 2.  The real-time polymerase chain reaction.

Authors:  Mikael Kubista; José Manuel Andrade; Martin Bengtsson; Amin Forootan; Jiri Jonák; Kristina Lind; Radek Sindelka; Robert Sjöback; Björn Sjögreen; Linda Strömbom; Anders Ståhlberg; Neven Zoric
Journal:  Mol Aspects Med       Date:  2006-02-03

3.  Relative expression of Pseudomonas aeruginosa virulence genes analyzed by a real time RT-PCR method during lung infection in rats.

Authors:  Béatrice Joly; Joly Béatrice; Maud Pierre; Pierre Maud; Stéphane Auvin; Auvin Stéphane; Franc Colin; Collet Franc Cois; Frédéric Gottrand; Gottrand Frédéric; Benoit Guery; Guery Benoit; Marie-Odile Husson
Journal:  FEMS Microbiol Lett       Date:  2005-02-01       Impact factor: 2.742

4.  Clinical outcome after early Pseudomonas aeruginosa infection in cystic fibrosis.

Authors:  G M Nixon; D S Armstrong; R Carzino; J B Carlin; A Olinsky; C F Robertson; K Grimwood
Journal:  J Pediatr       Date:  2001-05       Impact factor: 4.406

Review 5.  Early eradication of Pseudomonas aeruginosa in patients with cystic fibrosis.

Authors:  Bridget Stuart; Jenny H Lin; Peter J Mogayzel
Journal:  Paediatr Respir Rev       Date:  2010-06-16       Impact factor: 2.726

6.  [Kinetics of Pseudomonas aeruginosa virulence gene expression during chronic lung infection in the murine model].

Authors:  M Pierre; R Le Berre; H Tiesset; K Faure; B Guery; J-L Desseyn; C Galabert; L Béghin; C Beermann; F Gottrand; M-O Husson
Journal:  Med Mal Infect       Date:  2008-05-01       Impact factor: 2.152

7.  Matrix-assisted laser desorption ionization-time of flight mass spectrometry for identification of nonfermenting gram-negative bacilli isolated from cystic fibrosis patients.

Authors:  Nicolas Degand; Etienne Carbonnelle; Brunhilde Dauphin; Jean-Luc Beretti; Muriel Le Bourgeois; Isabelle Sermet-Gaudelus; Christine Segonds; Patrick Berche; Xavier Nassif; Agnès Ferroni
Journal:  J Clin Microbiol       Date:  2008-08-06       Impact factor: 5.948

8.  [Phenotypic and genotypic characteristics of non fermenting atypical strains recovered from cystic fibrosis patients].

Authors:  A Ferroni; I Sermet-Gaudelus; E Abachin; G Quesnes; G Lenoir; P Berche; J L Gaillard
Journal:  Pathol Biol (Paris)       Date:  2003-09

9.  Long-term follow up of changes in FEV1 and treatment intensity during Pseudomonas aeruginosa colonisation in patients with cystic fibrosis.

Authors:  M Ballmann; P Rabsch; H von der Hardt
Journal:  Thorax       Date:  1998-09       Impact factor: 9.139

10.  Comparison of culture and qPCR for the detection of Pseudomonas aeruginosa in not chronically infected cystic fibrosis patients.

Authors:  Pieter Deschaght; Petra Schelstraete; Guido Lopes dos Santos Santiago; Leen Van Simaey; Filomeen Haerynck; Sabine Van Daele; Elke De Wachter; Anne Malfroot; Patrick Lebecque; Christiane Knoop; Georges Casimir; Hedwige Boboli; Frédéric Pierart; Kristine Desager; Mario Vaneechoutte; Frans De Baets
Journal:  BMC Microbiol       Date:  2010-09-24       Impact factor: 3.605

View more
  11 in total

Review 1.  Biomarkers for cystic fibrosis drug development.

Authors:  Marianne S Muhlebach; J P Clancy; Sonya L Heltshe; Assem Ziady; Tom Kelley; Frank Accurso; Joseph Pilewski; Nicole Mayer-Hamblett; Elizabeth Joseloff; Scott D Sagel
Journal:  J Cyst Fibros       Date:  2016-10-27       Impact factor: 5.482

2.  Pseudomonas aeruginosa and Periodontal Pathogens in the Oral Cavity and Lungs of Cystic Fibrosis Patients: a Case-Control Study.

Authors:  Rocio Rivas Caldas; Florence Le Gall; Krista Revert; Gilles Rault; Michèle Virmaux; Stephanie Gouriou; Geneviève Héry-Arnaud; Georges Barbier; Sylvie Boisramé
Journal:  J Clin Microbiol       Date:  2015-04-08       Impact factor: 5.948

3.  Methods for Extraction and Detection of Pf Bacteriophage DNA from the Sputum of Patients with Cystic Fibrosis.

Authors:  Elizabeth B Burgener; Patrick R Secor; Michael C Tracy; Johanna M Sweere; Elisabeth M Bik; Carlos E Milla; Paul L Bollyky
Journal:  Phage (New Rochelle)       Date:  2020-06-16

4.  Development of two real-time multiplex PCR assays for the detection and quantification of eight key bacterial pathogens in lower respiratory tract infections.

Authors:  N J Gadsby; M P McHugh; C D Russell; H Mark; A Conway Morris; I F Laurenson; A T Hill; K E Templeton
Journal:  Clin Microbiol Infect       Date:  2015-05-14       Impact factor: 8.067

5.  Impact of the CFTR-potentiator ivacaftor on airway microbiota in cystic fibrosis patients carrying a G551D mutation.

Authors:  Cédric Bernarde; Marlène Keravec; Jérôme Mounier; Stéphanie Gouriou; Gilles Rault; Claude Férec; Georges Barbier; Geneviève Héry-Arnaud
Journal:  PLoS One       Date:  2015-04-08       Impact factor: 3.240

6.  Contribution of Drugs Interfering with Protein and Cell Wall Synthesis to the Persistence of Pseudomonas aeruginosa Biofilms: An In Vitro Model.

Authors:  Gianmarco Mangiaterra; Elisa Carotti; Salvatore Vaiasicca; Nicholas Cedraro; Barbara Citterio; Anna La La Teana; Francesca Biavasco
Journal:  Int J Mol Sci       Date:  2021-02-05       Impact factor: 5.923

7.  IL-6-elafin genetically modified macrophages as a lung immunotherapeutic strategy against Pseudomonas aeruginosa infections.

Authors:  Saadé Kheir; Bérengère Villeret; Ignacio Garcia-Verdugo; Jean-Michel Sallenave
Journal:  Mol Ther       Date:  2021-08-08       Impact factor: 11.454

8.  Insights into the respiratory tract microbiota of patients with cystic fibrosis during early Pseudomonas aeruginosa colonization.

Authors:  Marlène Keravec; Jérôme Mounier; Emmanuel Prestat; Sophie Vallet; Janet K Jansson; Gaëtan Burgaud; Sylvain Rosec; Stéphanie Gouriou; Gilles Rault; Emmanuel Coton; Georges Barbier; Geneviève Héry-Arnaud
Journal:  Springerplus       Date:  2015-08-09

9.  Lung Microbiota Changes Associated with Chronic Pseudomonas aeruginosa Lung Infection and the Impact of Intravenous Colistimethate Sodium.

Authors:  David Collie; Laura Glendinning; John Govan; Steven Wright; Elisabeth Thornton; Peter Tennant; Catherine Doherty; Gerry McLachlan
Journal:  PLoS One       Date:  2015-11-06       Impact factor: 3.240

Review 10.  Pseudomonas aeruginosa Biofilms.

Authors:  Minh Tam Tran Thi; David Wibowo; Bernd H A Rehm
Journal:  Int J Mol Sci       Date:  2020-11-17       Impact factor: 5.923

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.