Literature DB >> 24037111

Prevalence of plasmid-mediated quinolone resistance determinants among oxyiminocephalosporin-resistant Enterobacteriaceae in Argentina.

Giovana Rincon Cruz, Marcela Radice, Samantha Sennati, Lucia Pallecchi, Gian María Rossolini, Gabriel Gutkind, Jose Alejandro Di Conza.   

Abstract

High quinolone resistance rates were observed among oxyiminocephalosporin-resistant enterobacteria. In the present study, we searched for the prevalence of plasmid-mediated quinolone resistance (PMQR) genes within the 55 oxyiminocephalosporin-resistant enterobacteria collected in a previous survey. The main PMQR determinants were aac(6')-Ib-cr and qnrB, which had prevalence rates of 42.4% and 33.3%, respectively. The aac(6')-Ib-cr gene was more frequently found in CTX-M-15-producing isolates, while qnrB was homogeneously distributed among all CTX-M producers.

Entities:  

Mesh:

Substances:

Year:  2013        PMID: 24037111      PMCID: PMC3970647          DOI: 10.1590/0074-0276130084

Source DB:  PubMed          Journal:  Mem Inst Oswaldo Cruz        ISSN: 0074-0276            Impact factor:   2.743


Quinolone resistance in Gram-negative bacilli is primarily related to mutations in the chromosomal genes encoding for type II topoisomerases, the target site of quinolones (Drlica & Zhao 1997). However, in 1998, the first plasmid-mediated quinolone resistance (PMQR) determinant, qnrA, was reported in a Klebsiella pneumoniae strain. Since then, four additional qnr determinants, qnrB, qnrC, qnrD and qnrS, have been identified in Enterobacteriaceae species and some of these determinants have several allelic variants (Rodriguez-Martinez et al. 2011). These determinants encode for a pentapeptide repeat protein that binds to DNA gyrase, protecting the DNA gyrase from quinolone-mediated inhibition and increasing the minimum inhibitory concentrations (MICs) of the quinolones by eight-64-fold (Rodriguez-Martinez et al. 2011). In addition to the qnr genes, various new PMQR genes have been discovered during the past decade, including the modified acetyltransferase aac(6')-Ib-cr and the efflux pumps qepA and oqxAB (Rodriguez-Martinez et al. 2011). The association of PMQR genes with extended-spectrum β-lactamases (ESBLs) and AmpC β-lactamases is note worthy (Canton & Coque 2006). Although a few studies describing PMQR determinants in selected isolates have been performed, these associations have not been previously studied in Argentina (Quiroga et al. 2007, Jacoby et al. 2009, Andres et al. 2013). This study aimed to investigate the prevalence of PMQR genes (qnrA, -B, -S, -C and -D, aac(6)-Ib-cr and qepA) in oxyiminocephalosporin-resistant Enterobacteriaceae recovered during a recent multicentre survey conducted in Argentina (Sennati et al. 2012). In addition, we also examined the coexistence of these determinants with different ESBL and/or AmpC β-lactamases. The surveillance study was performed during October 2010 in 15 community hospitals distributed in three different regions of Argentina. Samples from both inpatients and outpatients were included. From 1,586 consecutive and non-repetitive enterobacterial clinical isolates recovered during this period, 207 (13.05%) displayed reduced susceptibility to expanded-spectrum cephalosporins (ESC) (Sennati et al. 2012). Antimicrobial susceptibility tests were performed by dilution and diffusion methods according to the Clinical and Laboratory Standards Institute (CLSI) for ampicillin, amoxicillin - clavulanic acid, piperacillin/tazobactam, cephalothin, cefoxitin, cefotaxime, ceftazidime, cefotaxime/clavulanic acid, ceftazidime/clavulanic acid, cefepime, imipenem, meropenem, amikacin, gentamicin, tobramycin, nalidixic acid, ciprofloxacin, levofloxacin and gatifloxacin (CLSI/NCCLS 2010). Molecular epidemiology of PMQR determinants was conducted for all confirmed ESC-resistant isolates (n = 55) collected during the first week of the study (22 K. pneumoniae, 16 Escherichia coli, 6 Proteus mirabilis, 4 Klebsiella oxytoca, 3 Serratia spp, 3 Enterobacter spp and 1 Providencia sp.) (Sennati et al. 2012). This sample was considered to be representative of the entire study period because the relative frequency of the most prevalent species was similar throughout the study period. Molecular detection of qnrA, qnrB, qnrC, qnrD and qnrS was carried out by polymerase chain reaction (PCR) amplification using total heat-extracted DNA as a template and primers previously described (Cattoir et al. 2007, Cavaco et al. 2009, Wang et al. 2009). For further characterisation of qnrB alleles, the following primers were designed (5'-3'): QnrBcF: GTTRGCGAAAAAATTRACAG, QnrBlF: ATGWYGYCATTATGTATA and QnrBcR: CCMATHAYMGCGATRCCAAG. All qnrB amplicons were sequenced on both strands using an ABI PRISM 3700 DNA sequencer. Screening for the aac(6')-Ib gene was performed using the following primers (5'-3'): aac(6')IbF: CGATCTCATATCGTCGAGTG and aac(6')IbR: TTAGGCATCACTGCGTGTTC. Characterisation of the aac(6')-Ib-cr variant was conducted by restriction fragment length polymorfism-PCR using BseGI (Fermentas, Thermo Fisher Scientific Inc, Massachusetts, USA) (Park et al. 2006) and sequencing. The presence of the qepA gene was investigated by PCR amplification using the following primers (5'-3'): qepAF: ACATCTACGGCTTCTTCGTCG and qepAR: AACGCTTGAGCCCGTAGATC. The 55 ESC-resistant isolates investigated in this study included 50 ESBL producers and the remaining five isolates were strong producers of AmpC. Among the ESBL-positive isolates, 47 were CTX-M producers (94%), with the most prevalent enzymes produced being CTX-M-2 (44%) and CTX-M-15 (38%) and to a lesser extent CTXM-14 (3/50), PER-2 (3/50), SHV-12 (2/50), SHV-5 (2/50), CTX-M-8 (1/50) and CTX-M-56 (1/50). Three isolates encoded two different ESBLs simultaneously. Susceptibility to nalidixic acid and ciprofloxacin was 7.3% and the susceptibility rate of isolates to either levofloxacin or gatifloxacin was 23.6%. Gentamicin, amikacin and tobramycin displayed susceptibility rates of 43.6%, 61.8% and 23.6%, respectively. The MIC50 and MIC90 values of the fluoroquinolones were higher for PMQR-positive K. pneumoniae isolates (data not shown). However, no differences in MIC values were observed within E. coli isolates. High diversity of PMQR genes was found among these enterobacteria. Sixty-six percent (33/50) of ESBL-producing isolates had at least one PMQR determinant (Table). In contrast, no PMQR genes were detected in isolates that produced high levels of AmpC (2 E. coli and 1 P. mirabilis harbouring CMY-2 and 2 Enterobacter spp).
TABLE

Main features of the plasmid-mediated quinolone resistance-harbouring enterobacteria isolated in this study

Species Isolate City Hospital qnrB-like allele aac(6’)-Ib / aac(6’)-Ib-cr ESBL genes Phylogenetic group/clone ST MIC (µg/mL)
NAL CIP LEV GAT GEN TOB AMK
Klebisella pneumoniae CM4 CAB H6 qnrB2 -/+ bla CTX-M-15 NC/Kp1 ST11> 512> 64 32 16 32 4 4
CL4 CAB H1 qnrB2 -/+ bla CTX-M-15 NC/Kp1 ST11> 512> 64> 64 64> 64 16 4
I3 SF H5 - -/+ bla CTX-M-15 NC/Kp1 ST11> 512> 64 16 16> 64 32 4
I4 SF H5 - -/+ bla CTX-M-15 NC/Kp1 ST11> 512> 64 16 16 64 16 4
CL6 CAB H1 qnrB2 -/+ bla CTX-M-15 NC/Kp2 ST11> 512> 64 16 8 1 16 4
CL9 CAB H1 qnrB1 -/+ bla CTX-M-15 NC/Kp3 ST48 64 4 1 2 32 16 2
T8 CH H10 - -/+ bla CTX-M-15 NC/Kp4 ST11> 512 64 32 16 64 32 4
CV1 CAB H7 qnrB19 +/+ bla CTX-M-15/ bla CTX-M-2 NC/Kp5 ST11> 512> 64 64 32> 64 64 32
L5 CAB H3 qnrB19 -/- bla CTX-M-15 NC/ND ST392> 512> 64 4 4 2 16 8
B4 CAB H4 qnrB2 -/- bla CTX-M-15 NC/ND ST11> 512 64> 64 64 0.5 1 1
CV2 CAB H7 - -/+ bla CTX-M-2 NC/ND ST15> 512 64 8 4< 0.5 4 4
CM1 CAB H6 qnrB19 -/+ bla CTX-M-2 NC/ND ST11> 512> 64 64 32> 64> 64> 256
B5 CAB H4 qnrB19 -/- bla CTX-M-2 NC/ND ST11> 512 64 64 64> 64> 64> 256
CL7 CAB H1 - -/+ bla CTX-M-2 NC/ND ST11> 512> 64 16 16 1 8 8
M2 CAB H7 qnrB19 -/- bla CTX-M-2 NC/ND ST11> 512> 64> 64 64 2 16> 256
CL5 CAB H1 - -/+ bla CTX-M-8 NC/ND ST14 64 8 2 4 1 16 8
Escherichia coli L4 CAB H3 - -/+ bla CTX-M-15 B2/EC1a ST131> 512> 64 16 16 1 16 8
T1 CH H10 - -/+ bla CTX-M-15 B2/EC1a ST131> 512> 64 64 16> 64> 64 16
CM2 CAB H6 - -/+ bla CTX-M-15 B2/EC1b ST131> 512> 64 8 8> 64 32 8
T3 CH H10 - -/+ bla CTX-M-15 B2/EC1b ST131> 512 64 32 8 1 1 2
SM5 BA H2 - -/+ bla CTX-M-15 B2/EC1c ST131 512 2 1 0.5 2 16 4
M1 CAB H7 - -/+ bla CTX-M-15 A/EC2 ST410> 512> 64 32 16> 64 64 32
SM4 BA H2 - -/+ bla CTX-M-15 A/EC3 ST167> 512> 64 64 32 2 16 16
T2 CH H10 qnrB6 -/+ bla CTX-M-2 B1/EC4 ST297> 512> 64> 64> 64 2 32 4
SM7 BA H2 qnrB2 -/+ bla CTX-M-14 D/EC5 ST68> 512> 64> 64 32 1 1 4
SM8 BA H2 qnrB2 -/- bla CTX-M-14 D/EC5 ST68> 512> 64 64 32< 0.5 0.5 0,5
Klebsiella oxytoca C1 SF H9 - -/+ bla CTX-M-2 NC/ND ND 128 2 4 2 8 16 2
T4 CH H10 qnrB10 -/- bla CTX-M-2 NC/ND ND> 512 64 32 16> 64> 64 16
Proteus mirabilis SM6 BA H2 qnrB2 -/- bla CTX-M-2 NC/ND ND> 512> 64> 64 64 32 8 4
CX2 BA H8 qnrB10 -/- bla CTX-M-2 NC/ND ND 128 2 4 2 8 16 32
T12 CH H10 qnrB19 -/- bla CTX-M-2 NC/ND ND> 512 32 8 32 64 32 4
Providencia sp. CL2 CAB H1 qnrB2 -/- bla CTX-M-2 NC/ND ND> 512> 64> 64> 64> 64 64 1
Enterobacter cloacae CX1 BA H8 qnrB10 -/- bla PER-2/ bla SHV-12 NC/ND ND 128 2 4 2 8 16 4

AMK: amikacin; BA: Buenos Aires; CAB: Ciudad Autónoma de Buenos Aires; CH: Chubut; CIP: ciprofloxacin; ESBL: extended-spectrum β-lactamases; GAT: gatifloxacin; GEN: gentamicin; H1: Hospital de Clínicas, Universidad de Buenos Aires; H2: Corporación médica San Martín; H3: Hospital Alemán; H4: Hospital Británico; H5: Hospital Iturraspe; H6: CEMIC; H7: Sanatorio Mater Dei; H8: Hospital Eva Perón; H9: Hospital Cullen; H10: Hospital de Trelew; LEV: levofloxacin; MIC: minimum inhibitory concentration; NAL: nalidixic acid; NC: not correspond; ND: not determined; SF: Santa Fe; TOB: tobramycin.

AMK: amikacin; BA: Buenos Aires; CAB: Ciudad Autónoma de Buenos Aires; CH: Chubut; CIP: ciprofloxacin; ESBL: extended-spectrum β-lactamases; GAT: gatifloxacin; GEN: gentamicin; H1: Hospital de Clínicas, Universidad de Buenos Aires; H2: Corporación médica San Martín; H3: Hospital Alemán; H4: Hospital Británico; H5: Hospital Iturraspe; H6: CEMIC; H7: Sanatorio Mater Dei; H8: Hospital Eva Perón; H9: Hospital Cullen; H10: Hospital de Trelew; LEV: levofloxacin; MIC: minimum inhibitory concentration; NAL: nalidixic acid; NC: not correspond; ND: not determined; SF: Santa Fe; TOB: tobramycin. Among the PMQR-positive isolates, 42.4% (14/33) and 33.3% (11/33) encoded either aac(6')-Ib-cr or qnrB as a determinant of quinolone resistance respectively, while 24.3% (8/33) had both determinants. No isolates rendered a positive amplification of qnrA, qnrS, qnrC, qnrD or qepA. Five qnrB variants were found in this study; qnrB2-like was the most prevalent (8/19), followed by qnrB19-like (6/19), qnrB10-like (3/19), qnrB1-like (1/19) and qnrB6-like (1/19). A homogeneous distribution of qnrB variants among CTX-M producers was observed (Table). The aac(6')-Ib-cr gene was detected in 44% (22/50) of the ESBL-producing isolates, displaying similar percentages for both E. coli (56.2%, 9/16) and K. pneumoniae (54.5%, 12/22). However, aac(6')-Ib-cr was mainly associated with CTX-M-15-producing Enterobacteriaceae (15/19) and to a lesser extent with other CTX-Ms, including CTX-M-2 (5), CTX-M-15/CTX-M-2 (1), CTX-M-14 (1) and CTX-M-8 (1). One of these 22 aac(6')-Ib-cr-harbouring isolates (K. pneumoniae CV1) also carried the wild-type aac(6')-Ib gene coupled to qnrB19 and both CTX-M-2 and CTX-M-15. We focused on the relationship between the isolates that harboured both the aac(6')-Ib-cr and bla determinants. Different clones were observed among the E. coli (7) and K. pneumoniae (8) isolates (Table). Phylogenetic analysis (Clermont et al. 2000) grouped the E. coli isolates into groups A (2) and B2 (5). Isolates belonging to the phylogenetic group B2 displayed a similar banding profile by REP-PCR and were characterised as ST131 according to the MLST Database (mlst.ucc.ie/mlst/dbs/Ecoli), corresponding with the worldwide pandemic clone known to cause nosocomial and community-acquired infections. Additionally, four/eight K. pneumoniae isolates were grouped into the same cluster (Kp1) and two of these isolates also possessed the qnrB2 allele. According to MLST analysis (Diancourt et al. 2005), seven/eight K. pneumoniae isolates were typed as ST11 (Table). The true prevalence of PMQR genes is underestimated because there are no reliable phenotypic methods to detect their presence; however, previous surveillance reports have shown the prevalence of PMQR determinants among ESBL producers (Cremet et al. 2011, Walsh & Rogers 2012). Reports on contemporary isolates in Latin American countries displayed conflicting results. Nevertheless, comparisons between these studies should be performed carefully due to the different bacterial selection criteria used. In concordance with a multicentre study performed in Mexico (Silva-Sanchez et al. 2011), we observed a high frequency of qnrB and aac(6')-Ib-cr genes amongst ESBL-producing isolates. However, a very low proportion of these markers were detected in Enterobacteriaceae isolated in a paediatric hospital in Uruguay (Garcia-Fulgueiras et al. 2011). Furthermore, these PMQR genes have also been detected in clinical enterobacteria, with unusual phenotypes of quinolone susceptibility collected in Argentina. Compared to this study, another study reported a different distribution in the qnrB allelic variants and the presence of different determinants (Andres et al. 2013). The present study highlights a putative association between aac(6')-Ib-cr and bla and a more homogenous distribution of qnrB alleles among ESBL-producing E. coli and K. pneumoniae. Notably, some PMQR determinants have been described in multiresistant clones with worldwide distribution (Woodford et al. 2011), such as E. coli ST131 and K. pneumoniae ST11, which were also detected in the present study, further underscoring the ability of these resistance mechanisms to disseminate. In conclusion, this study is the first report the prevalence of PMQR genes in ESBL-producing Enterobacteriaceae in Argentina and suggests that the qnrB and aac(6')-Ib-cr genes are widely dispersed among Ente-robacteriaceae, as found in many other countries. These isolates showed high-level quinolone resistance ESC resistance that was mediated by ESBLs; therefore, this study demonstrates the importance of understanding the potential risk associated with empirical treatment using these antibiotic families.
  18 in total

1.  Prevalence in the United States of aac(6')-Ib-cr encoding a ciprofloxacin-modifying enzyme.

Authors:  Chi Hye Park; Ari Robicsek; George A Jacoby; Daniel Sahm; David C Hooper
Journal:  Antimicrob Agents Chemother       Date:  2006-09-05       Impact factor: 5.191

Review 2.  The CTX-M beta-lactamase pandemic.

Authors:  Rafael Cantón; Teresa M Coque
Journal:  Curr Opin Microbiol       Date:  2006-08-30       Impact factor: 7.934

3.  Complex class 1 integrons with diverse variable regions, including aac(6')-Ib-cr, and a novel allele, qnrB10, associated with ISCR1 in clinical enterobacterial isolates from Argentina.

Authors:  María Paula Quiroga; Patricia Andres; Alejandro Petroni; Alfonso J C Soler Bistué; Leonor Guerriero; Liliana Jordá Vargas; Angeles Zorreguieta; Marta Tokumoto; Cecilia Quiroga; Marcelo E Tolmasky; Marcelo Galas; Daniela Centrón
Journal:  Antimicrob Agents Chemother       Date:  2007-10-15       Impact factor: 5.191

4.  Multilocus sequence typing of Klebsiella pneumoniae nosocomial isolates.

Authors:  Laure Diancourt; Virginie Passet; Jan Verhoef; Patrick A D Grimont; Sylvain Brisse
Journal:  J Clin Microbiol       Date:  2005-08       Impact factor: 5.948

Review 5.  Plasmid-mediated quinolone resistance: an update.

Authors:  José Manuel Rodríguez-Martínez; María Eliecer Cano; Carmen Velasco; Luis Martínez-Martínez; Alvaro Pascual
Journal:  J Infect Chemother       Date:  2010-10-01       Impact factor: 2.211

6.  Multiplex PCR for detection of plasmid-mediated quinolone resistance qnr genes in ESBL-producing enterobacterial isolates.

Authors:  Vincent Cattoir; Laurent Poirel; Vincent Rotimi; Claude-James Soussy; Patrice Nordmann
Journal:  J Antimicrob Chemother       Date:  2007-06-08       Impact factor: 5.790

7.  Prevalence of plasmid-mediated quinolone resistance determinants in ESBL Enterobacteriaceae clinical isolates over a 1-year period in a French hospital.

Authors:  L Crémet; N Caroff; S Dauvergne; A Reynaud; D Lepelletier; S Corvec
Journal:  Pathol Biol (Paris)       Date:  2009-05-29

8.  qnrD, a novel gene conferring transferable quinolone resistance in Salmonella enterica serovar Kentucky and Bovismorbificans strains of human origin.

Authors:  L M Cavaco; H Hasman; S Xia; F M Aarestrup
Journal:  Antimicrob Agents Chemother       Date:  2008-11-24       Impact factor: 5.191

9.  Temporal appearance of plasmid-mediated quinolone resistance genes.

Authors:  George A Jacoby; Nancy Gacharna; Todd A Black; George H Miller; David C Hooper
Journal:  Antimicrob Agents Chemother       Date:  2009-01-21       Impact factor: 5.191

10.  New plasmid-mediated quinolone resistance gene, qnrC, found in a clinical isolate of Proteus mirabilis.

Authors:  Minghua Wang; Qinglan Guo; Xiaogang Xu; Xiaoying Wang; Xinyu Ye; Shi Wu; David C Hooper; Minggui Wang
Journal:  Antimicrob Agents Chemother       Date:  2009-03-02       Impact factor: 5.191

View more
  7 in total

1.  Characterization of Ciprofloxacin-Resistant and Ciprofloxacin-Susceptible Uropathogenic Escherichia coli Obtained from Patients with Gynecological Cancer.

Authors:  Muniqui S Capett; Patricia Vollú-Silva; Vanessa A Melchiades; Luciana C Bokehi; Fernanda M Araújo; Ianick Souto Martins; Felipe P G Neves; Alice G M Gonzalez; Eric Oswald; Geraldo R de Paula; Lenise A Teixeira
Journal:  Curr Microbiol       Date:  2016-07-26       Impact factor: 2.188

2.  [Prevalence and risk factors for extended-spectrum β-lactamase-producing Escherichia coli causing community-onset urinary tract infections in Colombia].

Authors:  Victor M Blanco; Juan J Maya; Adriana Correa; Marcela Perenguez; Juan S Muñoz; Gabriel Motoa; Christian J Pallares; Fernando Rosso; Lorena Matta; Yamile Celis; Martha Garzon; María V Villegas
Journal:  Enferm Infecc Microbiol Clin       Date:  2016-01-13       Impact factor: 1.731

3.  Resistance of Stenotrophomonas maltophilia to Fluoroquinolones: Prevalence in a University Hospital and Possible Mechanisms.

Authors:  Wei Jia; Jiayuan Wang; Haotong Xu; Gang Li
Journal:  Int J Environ Res Public Health       Date:  2015-05-13       Impact factor: 3.390

4.  Susceptibility to β-lactams and quinolones of Enterobacteriaceae isolated from urinary tract infections in outpatients.

Authors:  Martín Marchisio; Ayelén Porto; Romina Joris; Marina Rico; María R Baroni; José Di Conza
Journal:  Braz J Microbiol       Date:  2015-10-09       Impact factor: 2.476

5.  Simultaneous Carriage of mcr-1 and Other Antimicrobial Resistance Determinants in Escherichia coli From Poultry.

Authors:  Johana E Dominguez; Leandro M Redondo; Roque A Figueroa Espinosa; Daniela Cejas; Gabriel O Gutkind; Pablo A Chacana; José A Di Conza; Mariano E Fernández Miyakawa
Journal:  Front Microbiol       Date:  2018-07-25       Impact factor: 5.640

6.  Multiple mechanisms contributing to ciprofloxacin resistance among Gram negative bacteria causing infections to cancer patients.

Authors:  Samira M Hamed; Walid F Elkhatib; Hadir A El-Mahallawy; Mai M Helmy; Mohamed S Ashour; Khaled M A Aboshanab
Journal:  Sci Rep       Date:  2018-08-16       Impact factor: 4.379

7.  Molecular identification of fluoroquinolone resistance in Salmonella spp. isolated from broiler farms and human samples obtained from two regions in Colombia.

Authors:  María Paula Herrera-Sánchez; Rafael Enrique Castro-Vargas; Luz Clemencia Fandiño-de-Rubio; Roy Rodríguez-Hernández; Iang Schroniltgen Rondón-Barragán
Journal:  Vet World       Date:  2021-07-07
  7 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.