Literature DB >> 24033984

Molecular characterization of Listeria monocytogenes isolated from fresh seafood samples in Iran.

Hassan Momtaz1, Shole Yadollahi.   

Abstract

BACKGROUND: Among all species of Listeria, Listeria monocytogenes (L. monocytogenes) is a major pathogenic microorganism of humans and animals and L. ivanovii is rarely pathogenic for humans. The objective of this study was to isolate and characterize Listeria species and to determine the frequencies of virulence genes in L. monocytogenes serotypes in fresh fish, shrimp, crab and lobster in Isfahan and Shahrekord, Iran.
METHODS: From September 2010 to April 2011, a total of 300 marine food samples were purchased from supermarkets of Isfahan and Shahrekord cities, Iran. All samples were cultured and the positive samples for L. monocytogenes were analyzed for presence of serotypes and virulence genes.
RESULTS: From the total 300 samples, 23 (10.45%) fresh fish and 1 (2.5%) shrimp samples were positive for Listeria spp., but there were no positive lobster and crab samples for Listeria species. Only L. monocytogenes was isolated from 17 fish (7.25%) and 1 shrimp (2.5%) samples while L. innocua, L. ivanovii and L. seeligeri only detected in fish samples (2 (0.9%), 3 (1.36%) and 1 (0.45%)), respectively. The plcA, prfA, actA, hlyA and iap virulence genes were detected in all of the 18 L. monocytogenes isolates. Totally, the 4b, 1/2a and 1/2b serotypes were detected in 66.66%, 5.55% and 27.77% bacterial isolates, respectively.
CONCLUSIONS: Consumption of these sea foods, either raw or undercooked, may contribute to food-borne illness due to L. monocytogenes in Iran. The hygienic quality of sea food products should be observe. VIRTUAL SLIDES: The virtual slide(s) for this article can be found here: http://www.diagnosticpathology.diagnomx.eu/vs/3422944359800606.

Entities:  

Mesh:

Substances:

Year:  2013        PMID: 24033984      PMCID: PMC3852293          DOI: 10.1186/1746-1596-8-149

Source DB:  PubMed          Journal:  Diagn Pathol        ISSN: 1746-1596            Impact factor:   2.644


Background

Some-food borne diseases are well recognized but their prevalence rate has been increased these days. Totally, Campylobacter species (Campylobacter spp.), Salmonella spp., Listeria species (Listeria spp.), and Escherichia coli O157:H7 have been generally found to be responsible for majority of food- borne outbreaks [1,2]. Listeria spp. are ubiquitous, Gram-positive, facultative anaerobic, non-spore-forming, rod-shaped bacteria. Listeria monocytogenes (L. monocytogenes), L. ivanovii, L. innocua, L. seeligeri, L.welshimeri, and L. grayi are the most important species in the genus Listeria[3]. The hemolytic species of Listeria such as L. monocytogenes, L. ivanovii and L. seeligeri, are associated with human pathogenicity. Both L. ivanovii and L. seeligeri are the rare causes of human infection. These two pathogens are responsible for meningitis in a nonimmunocompromised adult [4]. The L. monocytogenes has been involved in known food-borne outbreaks of listeriosis [5,6] however, there are some reports of L. seeligeri and L. ivanovii causing food-borne illness in humans [7,8]. The L. monocytogenes is responsible for listeriosis which can known by several complications including abortion, bacteraemia, sepsis, and meningoencephalitis [9,10]. The ability of L. monocytogenes to survive in a wide range of environmental conditions like grow at refrigerator temperatures is undeniable. Approximately, 2,500 cases of human listeriosis occur annually in the United States, resulting in 500 deaths [11]. Since, Listeria spp. has been isolated from a wide range of sea-food products such as shrimp [12], crab [13], cold-smoked rainbow trout [14], fish products [15] and lobster [16]. Multiple virulence factors such as hemolysin (hlyA), phosphatidylinositol phospholipase C (plcA), actin polymerization protein (actA) and invasive associated protein (iap) are important in the pathogenesis of L. monocytogenes infections [17]. The 1/2a, 1/2b, and 4b are the most commonly detected serotypes of Listeria spp. isolated from various types of clinical samples [18]. Isolation and characterization of Listeria species is done mainly by cultural, biochemical and molecular methods. There is a need for quick and reliable molecular methods such as the Polymerase Chain Reaction (PCR) for Listeria detection. Sea-foods are so popular among Iranian people. The epidemiology and prevalence of Listeria spp. is essentially unknown in Iranian sea-foods. Therefore, the present study was carried out in order to detection and characterization of Listeria spp. and study the frequency of virulence genes and serotypes of L. monocytogenes isolated from fresh fish, crab, shrimp and lobster using cultural, biochemical and molecular techniques.

Methods

Bacterial strains

The standard strains of L. monocytogenes (PTCC 1298), Listeria ivanovii subsp. ivanovii (PTCC 1303), Staphylococcus aureus (PTCC 1113) and Rhodococcus equi (PTCC 1633) were obtained from the Iranian Research Organization for Science and Technology, Iran and used in culture and PCR methods.

Sample collection

From September 2010 to April 2011, a total of 300 seafood samples including fresh fish (n = 120), crab (n = 20), lobster (n = 40) and shrimp (n = 120) were collected from the supermarkets and retailers of Isfahan and Shahrekord cities, Iran. Samples were transferred to the Food Microbiology Laboratory at the Islamic Azad University of Shahrekord Branch in portable insulated cold-boxes. Samples were analyzed on a day of collection.

Isolation and Identification of Listeria

Listeria spp. were isolated from seafood samples according to ISO 11290 protocol [19]. Then all isolates were subjected to standard biochemical tests including Gram staining, catalase test, motility test at 25°C and 37°C, acid production from glucose, manitol, rhamnose, zylose, α -methyl-D-mamoside, and nitrate reduction, hydrolysis of esculin, MR/VP test, ß-hemolytic activity, and CAMP test [20].

Phenotypic characterization

1- Haemolysis on sheep blood agar (SBA) All the Listeria isolates were tested for the type (α or β) and the degree (narrow or wider) of hemolysis on 7% sheep blood agar (SBA). Briefly, the isolates were streaked onto 7% SBA plates and incubated at 37°C in a humidified chamber for 24 h and examined for hemolytic zones around the colonies. Interpretation of the hemolytic reaction was based on the characteristic β-hemolysis in the form of wider and clear zone of hemolysis representing L. ivanovii while a narrow zone of α-hemolysis was the characteristic of L. monocytogenes or L. seeligeri[21]. 2- Christie, Atkins, Munch and Petersen (CAMP) test All the Listeria isolates were tested by CAMP test. Briefly, the standard strains of Staphylococcus aureus and Rhodococcus equi were grown overnight on 7% SBA plates at 37°C and their colonies were again streaked onto freshly prepared 7% SBA plates in a manner such that the streaks were wide apart and parallel to each other. In between the parallel streaks of S. aureus and R. equi the Listeria isolates were streaked at 90°C angle and 3 mm apart before incubating them at 37°C for 24 h. The plates were examined for enhancement of the hemolytic zone from partial hemolysis to a wider zone of complete hemolysis, if any, between a Listeria strain and the S. aureus or R. equi strain owing to the synergistic effect of their hemolysins in case of a CAMP-positive reaction. The Listeria isolates with CAMP-positivity against S. aureus were characterized as L. monocytogenes and those with CAMP positivity against R. equi were characterized as L. ivanovii[21]. 3- Phosphatidyiinositol- specific phospholipase C (PI-PLC) assay All the biochemically characterized Listeria isolates were assayed for PI-PLC activity as per the method of Leclercq [22] with certain modifications. In brief, the Listeria isolates were grown overnight onto 7% SBA plates at 37°C. All Listeria isolates were streaked on L. mono differential agar (Hi Media Ltd, Mumbai, India) in order to assess PI-PLC activity. The inoculated plates were incubated at 37°C in a humidified chamber for 24 h. On L. mono differential agar, light blue colonies showing a halo formation around the inoculation site were considered positive for PI-PLC assay. 4- Phosphatidyiinositol- specific phospholipase C (PC-PLC) assay The eggyolk opacity test was done to examine the phosphatidylcholine-specific phospholipase C (PCPLC) activity of the isolates. Tryptic soy agar (Hi Media Ltd. Mumbai, India) plates were prepared with 2.5 per cent egg-yolk emulsion (Hi Media Ltd. Mumbai, India) and 2.5 per cent NaCl, pH 6.5-7. Listeria isolates were streaked onto the agar surfaces and incubated at 37°C for 36–72 h and observed for formation of opaque zones surrounding the growth [23].

DNA extraction

Chromosomal DNA was prepared using the Zhang et al. [24] method. Briefly, 1 mL of overnight culture (from brain–heart infusion) broth was transferred to 1.5-mL microfuge tube and centrifuged at 8,000 rpm for 5 min, and the supernatant was discarded and 500 μL of cetyl trimethylammonium bromide buffer at 60°C was added to the microfuge tube containing the bacterial pellet; the mixture was held in water bath at 64°C for 20 min. During incubation, the mixture was briefly mixed several times. After incubation, 500 μL of chloroform/octanol (24:1) was added and mixed vigorously followed by centrifugation at 3,000 rpm for 5 min. The supernatant was transferred to a clean microfuge tube, and an equal volume of ice-cold isopropanol was added and kept on ice bath for 2-h precipitation. The solution was then centrifuged at 8,000 rpm for 8 min. The aqueous phase was discarded and the DNA pellet was rinsed with 80% ethanol, air- dried and resuspended in 50 μL of double distilled water and used for PCR [25].

PCR condition for detection of Listeria spp. L. monocytogenes serotypes and virulence genes of L. monocytogenes

The details of the primers sequences for amplification of Listeria spp., L. monocytogenes, its virulence genes and serotypes are shown in Table 1. DNA amplification was performed in a DNA thermal cycler (Eppendrof Mastercycler 5330; Eppendorf-Nethel-Hinz GmbH, Hamburg, Germany). The PCR programs and their volumes for L. monocytogenes, L. innocua, L. ivanovii, L. seeligeri, L. welshimeri, and L. grayi amplification were studied using the method which was described by Bubert et al. [26].
Table 1

Primers for amplification of virulence associated genes, spp. and serotypes of

Primer namePrimer sequence (5′-3′)TargetSize of product (bp)References
Lis1B
TTATACGCGACCGAAGCCAAC
L. innocua
870
[26]
Ino2
ACTAGCACTCCAGTTGTTAAAC
 
 
 
Lis1B
TTATACGCGACCGAAGCCAAC
L.
660
[26]
MonoA
CAAACTGCTAACACAGCTACT
monocytogenes
 
 
Lis1B
TTATACGCGACCGAAGCCAAC
L. ivanovii
1100
[26]
Iva1
CTACTCAAGCGCAAGCGGCAC
 
 
 
Lis1B
TTATACGCGACCGAAGCCAAC
L. seeligeri
1100
[26]
Sel1
TACACAAGCGGCTCCTGCTCAAC
 
 
 
Lis1B
TTATACGCGACCGAAGCCAAC
L. welshimeri
1050
[26]
Wel1
CCCTACTGCTCCAAAAGCAGCG
 
 
 
Lis1B
TTATACGCGACCGAAGCCAAC
L. grayi
480
[26]
MuraI
GTGATTTCTGCTTGCCATAG
 
 
 
prsF
GCTGAAGAGATTGCGAAAGAAG
All L. monocytogenes serovares
370
[27]
prsR
CAAAGAAACCTTGGATTTGCGG
 
 
 
lmo0737F
AGGGCTTCAAGGACTTACCC
L. monocytogenes serovar1/2a
691
[27]
lmo0737R
ACGATTTCTGCTTGCCATTC
 
 
 
ORF2819F
AGCAAAATGCCAAAACTCGT
L. monocytogenes serovar1/2b
471
[27]
ORF2819R
CATCACTAAAGCCTCCCATTG
 
 
 
ORF2110F
AGTGGACAATTGATTGGTGAA
L. monocytogenes serovar 4b
597
[27]
ORF2110R
CATCCATCCCTTACTTTGGAC
 
 
 
plc A-F
CTGCTTGAGCGTTCATGTCTCCATCCCCC
plcA gene
1484
[28]
plc A-R
CATGGGTTTCACTCTCCTTCTAC
 
 
 
prf A-F
CTGTTGGAGCTCTTCTTGGTGAAGCAATCG
prfA gene
1060
[28]
prf A-R
AGCAACCTCGGTACCATATACTAACTC
 
 
 
act A-F
CGCCGCGGAAATTAAAAAAAGA
actA gene
839
[29]
act A-R
ACGAAGGAACCGGGCTGCTAG
 
 
 
hly A-F
GCAGTTGCAAGCGCTTGGAGTGAA
hlyA gene
456
[30]
hly A-R
GCAACGTATCCTCCAGAGTGATCG
 
 
 
Iap-F
ACAAGCTGCACCTGTTGCAG
Iap gene
131
[31]
Iap-RTGACAGCGTGTGTAGTAGCA   
Primers for amplification of virulence associated genes, spp. and serotypes of The PCR was standardized for the detection of virulence associated genes of L. monocytogenes by previously described methods [26-31]. The multiplex PCR assay was standardized for the detection of three major serovars of L. monocytogenes namely 1/2a, 1/2b and 4b, using the method which was described by Doumith et al. [27]. The PCR products were analyzed by 1.5% agarose gel electrophoresis and the specific DNA bands were visualized using ethidium bromide staining under UV illumination.

Results and discussion

All of the three houndred sea-food samples were studied for presence of Listeria spp. Totally, twenty three fresh fish samples (10.45%) and only one shrimp sample (2.5%) were positive for Listeria spp. there were no positive results for lobster and crab samples. Also, 17 fresh fish samples (7.72%) were positive for the L. monocytogenes. Totally, the frequency of L. innocua, L. ivanovii and L. seelgeri in fresh fish samples of our study were 0.9%, 1.36% and 0.45%, respectively (Table 2). One of the shrimp samples of our study was positive for L. monocytogenes (2.5%).
Table 2

Prevalence of spp. in marine foods in Iran

Type of sampleNo. of samplesNo. (%) of Listeria spp.No. (%) of L. monocytogenesNo. (%) of L. innocuaNo. (%) of L. ivanoviiNo. (%) of L. seeligeri
Fish
220
23 (10.45)
17 (7.72)
2 (0.9)
3 (1.36)
1 (0.45)
Shrimp
40
1 (2.5)
1 (2.5)
-
-
-
Lobster
20
-
-
-
-
-
Crab
20
-
-
-
-
-
Total30024 (8)18 (6)2 (0.66)3 (1)1 (0.33)
Prevalence of spp. in marine foods in Iran All the 18 isolates of L. monocytogenes showed the characteristic enhancement of hemolytic zone with S. aureus. Also, all of the 18 isolates of L. monocytogenes were found to be pathogenic by PI- PLC and PC-PLC. The five virulence-associated genes (plcA, prfA, actA, hlyA and iap) were detected in all of the 18 L. monocytogenes isolates. The most commonly detected serotype in L. monocytogenes isolates was 4b, which occurred in 12/18 (66.66%) samples. The frequency of 1/2a and 1/2b serotypes were 5.55% and 27.77%, respectively (Table 3).
Table 3

Frequency of in marine foods in Iran

Type of sampleNo. (%) of L. monocytogenes4b1/2a1/2b
Fish
17
11 (64.70%)
1 (5.88%)
5 (29.41%)
Shrimp
1
1 (100%)
-
-
Total1812 (66.66%)1 (5.55%)5 (27.77%)
Frequency of in marine foods in Iran Listeriosis is one of the most important zoonotic bacterial diseases with worldwide distribution. Disease has considerable economic and public health importance. Listeria monocytogenes has been described as opportunistic pathogen mainly affecting children, pregnant women, and aged and immune-challenged individuals [32,33]. Also, a wide variety of animals including sheep, cattle, goats, pigs, rabbits, mice, birds, and fish are also infected with L. monocytogenes. An atypical foodborne listeriosis has a range of 25 to 30% in susceptible populations [34]. Since 1975, foodborne listeriosis outbreaks have been reported in industrialized countries of Europe, North America and Oceania with few or no reports from Africa, Asia and Latin America [35,36]. Despite the high importance of sea-foods listeriosis, there were few published data about its distribution in fish and shrimp samples of Iran [12,37,38]. Our results revealed that 6%, 1%, 0.66% and 0.66% of Iranian sea-food samples were positive for L. monocytogenes, L. ivanovii, L. innocua and seeligeri, respectively. Rahimi et al. (2012) reported that L. monocytogenes and L. innocua were detected in 1.9% and 5.7% of the frozen and fresh sea-food samples, respectively [12]. Zarei et al. [38] reported the low frequency of L. monocytogenes in Iranian sea-food samples (1.4%). Also, Akhondzadeh Basti et al. [37] reported that 2.6% of smoked fish samples were positive for L. monocytogenes. Study in Urumia, Iran showed that 12.37% of collected fish samples were positive for Listeria[39]. They showed that 21% and 29% of isolates were L. monocytogenes and L. ivonoi[39]. The results of our study and several Iranian reports showed that the Listeria spp. had the low frequency in Iranian sea-foods. An overall prevalence of L. monocytogenes was 3% in European fish [40] but Miettinen and Wirtanen [41] reported that the prevalence of Listeria spp. and L. monocytogenes in pooled unprocessed fresh rainbow trout were 35% and 14.6%, respectively. The L. innocua was the most common Listeria spp. in the fishes of Greece country [42]. The incidence of Listeria spp. in Turkey was 30% in freshwater samples and 10.4% in marine fish samples. Also, 44.5% and 83.5% of all isolates were L. monocytogenes and L. murrayi, respectively [43]. These high differences in prevalence of Listeria spp. in sea-foods maybe due the facts that type of samples (fish, shrimp, crab, oyster and lobster), number of samples, methods of sampling, method of experiment, geographical area and even climate of area which samples were collected are different in each investigation. All of the detected L. monocytogenes bacteria had plcA, prfA, actA, hlyA and iap putative virulence genes. Unfortunately, there were no previously published data about detection of L. monocytogenes virulence factors in sea-food products but their high frequencies in the bacterial strains of our study can lead to adhesion, invasion and epithelial damage to the human digestive system. The most commonly detected serotypes in L. monocytogenes isolates our study was 4b (66.66%), followed by 1/2b (27.77%) and 1/2a (5.55%). Similar results have been reported previously [26,27,44]. Previous report of the National Reference Center in France showed that over than 98% of 5,000 isolates of L. monocytogenes harbored 1/2a, 1/2b, 1 /2c, and 4b serotypes [26].

Conclusions

The results of our study showed that severe controls should be performed on the hygienic quality of Iranian sea-foods. These products are well contaminated with Listeria spp. and especially L. monocytogenes. Contact with intestinal contents, cross contamination from infected staffs, using contaminated equipments, fish manipulation and inappropriate transportation are the main factors for sea-foods contamination. Also, may be some food safety and quality standards need to be applied and performed in most of Iranian supermarkets and even fishing centers to control growth of Listeria during fishing, collection, transmission, distribution and storage periods. Suitable cocking of sea-foods can diminish the microbial loads of these products especially for Listeria spp.

Competing interests

Both authors declare that they have no competing interests.

Authors’ contributions

The DNA extraction, PCR techniques, statistical analysis, writing of manuscript and supporting of project was performed by HM and samples collection and culture was performed by SY. Both authors read and approved the final manuscript.
  29 in total

1.  Food and Agriculture Organization (FAO) expert consultation on the trade impact of Listeria in fish products. Amherst, Massachusetts, USA. 17-20 May 1999. Proceedings.

Authors: 
Journal:  Int J Food Microbiol       Date:  2000-12-20       Impact factor: 5.277

Review 2.  Market analysis of biosensors for food safety.

Authors:  Evangelyn C Alocilja; Stephen M Radke
Journal:  Biosens Bioelectron       Date:  2003-05       Impact factor: 10.618

Review 3.  Epidemiology of human listeriosis and seafoods.

Authors:  J Rocourt; C Jacquet; A Reilly
Journal:  Int J Food Microbiol       Date:  2000-12-20       Impact factor: 5.277

4.  Detection and differentiation of Listeria spp. by a single reaction based on multiplex PCR.

Authors:  A Bubert; I Hein; M Rauch; A Lehner; B Yoon; W Goebel; M Wagner
Journal:  Appl Environ Microbiol       Date:  1999-10       Impact factor: 4.792

5.  Rapid detection of Listeria monocytogenes in foods, by a combination of PCR and DNA probe.

Authors:  A Ingianni; M Floris; P Palomba; M A Madeddu; M Quartuccio; R Pompei
Journal:  Mol Cell Probes       Date:  2001-10       Impact factor: 2.365

6.  Validation of ISO method 11290 part 1--detection of Listeria monocytogenes in foods.

Authors:  S L Scotter; S Langton; B Lombard; S Schulten; N Nagelkerke; P H In't Veld; P Rollier; C Lahellec
Journal:  Int J Food Microbiol       Date:  2001-03-20       Impact factor: 5.277

7.  Evaluation of the API test, phosphatidylinositol-specific phospholipase C activity and PCR method in identification of Listeria monocytogenes in meat foods.

Authors:  B Paziak-Domańska; E Bogusławska; M Wieckowska-Szakiel; R Kotłowski; B Rózalska; M Chmiela; J Kur; W Dabrowski; W Rudnicka
Journal:  FEMS Microbiol Lett       Date:  1999-02-15       Impact factor: 2.742

8.  Foodborne listeriosis.

Authors:  W F Schlech
Journal:  Clin Infect Dis       Date:  2000-09-26       Impact factor: 9.079

9.  Listeria monocytogenes serotype identification by PCR.

Authors:  Monica K Borucki; Douglas R Call
Journal:  J Clin Microbiol       Date:  2003-12       Impact factor: 5.948

Review 10.  Food-related illness and death in the United States.

Authors:  P S Mead; L Slutsker; V Dietz; L F McCaig; J S Bresee; C Shapiro; P M Griffin; R V Tauxe
Journal:  Emerg Infect Dis       Date:  1999 Sep-Oct       Impact factor: 6.883

View more
  8 in total

1.  Prevalence, antimicrobial susceptibility and virulotyping of Listeria species and Listeria monocytogenes isolated from open-air fish markets.

Authors:  Hossein Jamali; Mohammadjavad Paydar; Salmah Ismail; Chung Yeng Looi; Won Fen Wong; Behrad Radmehr; Atefeh Abedini
Journal:  BMC Microbiol       Date:  2015-07-25       Impact factor: 3.605

2.  Chemical Composition, Antioxidant and Antibacterial Activity of Bunium persicum, Eucalyptus globulus, and Rose Water on Multidrug-Resistant Listeria Species.

Authors:  Farhad Sharafati Chaleshtori; Mohamad Saholi; Reza Sharafati Chaleshtori
Journal:  J Evid Based Integr Med       Date:  2018 Jan-Dec

Review 3.  Epidemiology of Listeria monocytogenes prevalence in foods, animals and human origin from Iran: a systematic review and meta-analysis.

Authors:  Reza Ranjbar; Mehrdad Halaji
Journal:  BMC Public Health       Date:  2018-08-23       Impact factor: 3.295

4.  Occurrence, antimicrobial resistance, serotyping and virulence genes of Listeria monocytogenes isolated from foods.

Authors:  Aziz Bouymajane; Fouzia Rhazi Filali; Said Oulghazi; Nada Lafkih; Abdelaziz Ed-Dra; Amal Aboulkacem; Abdallah El Allaoui; Bouchra Ouhmidou; Mohieddine Moumni
Journal:  Heliyon       Date:  2021-02-02

5.  Prevalence and antibiotic resistance profile of Listeria spp. associated with seafoods from fish catchment areas in Kerala, India.

Authors:  K Vrinda Menon; B Sunil; C Latha
Journal:  Vet World       Date:  2021-03-27

Review 6.  Virulence Characteristics and Distribution of the Pathogen Listeria ivanovii in the Environment and in Food.

Authors:  Franca Rossi; Valerio Giaccone; Giampaolo Colavita; Carmela Amadoro; Francesco Pomilio; Paolo Catellani
Journal:  Microorganisms       Date:  2022-08-20

7.  Analysis of Fish Commonly Sold in Local Supermarkets Reveals the Presence of Pathogenic and Multidrug-Resistant Bacterial Communities.

Authors:  Ama Okyere; Dayna Bishoff; Micah O Oyaro; Nadim J Ajami; Charles Darkoh
Journal:  Microbiol Insights       Date:  2018-07-18

Review 8.  Epidemiological burden of Listeria monocytogenes in Iran.

Authors:  Abed Zahedi Bialvaei; Vajihe Sheikhalizadeh; Ali Mojtahedi; Gholamreza Irajian
Journal:  Iran J Basic Med Sci       Date:  2018-08       Impact factor: 2.699

  8 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.