Prevalence of genotypes in Helicobacter pyloriisolates from patients in eastern Turkey and the association of these genotypes with clinical outcome.

There is not much information available regarding the prevalence of the genotypes of Helicobacter pylori isolates in Turkey, particularly in eastern Turkey. The aims of this study were to detect the prevalence of different genotypes of H. pylori in Turkish patients with gastrointestinal complaints and to determine the relationship of these genotypes with clinical outcome and sex. One hundred forty H. pylori isolates were examined for the presence of its genotypes by the PCR. We found that the prevalence of vacAs1,vacAs2, cagA, cagE, iceA1, iceA2 and babA2 genes were 88.6%, 11.4%, 71.4%, 35.7%, 41.4%, 58.6%, and 62.1%, respectively. The most predominant vacA subtype was s1a (81.4%). The most vacA allelic combination detected were vacAs1m1 (65.2%) and s1m2 (53.9%) in patients with peptic ulcer and gastritis, respectively. The only vacAs1 isolate was significantly associated with gastritis and peptic ulcer (p<0.05). The vacAs1a, ml, slml and babA2 genes were significantly associated with peptic ulcer (p<0.05), whereas m2 gene was significantly associated with only gastritis (p<0.05). The difference between sex and genotypes was statistically significant among the cagA,vacAs1, iceA2 and babA2 genes. This study reported for the first time the prevalence of H. pylori genotypes in patients with gastrointestinal complaints in eastern Turkey. Further studies are needed to understand epidemiological importance of the genotypes of H. pylori isolates in this region and the association between the virulence genes and clinical outcome in different regions.

INTRODUCTION

Helicobacter pylori (H. pylori) which infects more than half of the world’s population, a major etiological agent in development of gastritis (G), peptic ulcer (PU) and gastric carcinoma (3). Scientists have been shown that several genes, such as the vacuolating cytotoxin (vacA), cytotoxin associated gene A (cagA), cytotoxin associated gene E (cagE), induced by contact with epithelium (iceA) and blood adhesion binding antigen (babA2) have been determined and these genes may play important roles in the pathogenesis of H. pylori infection (22, 24).

The cagA gene being a marker for the presence of the cag pathogenicity island (cagPAI) of approximaely 40 kb was the first gene found to be present in H. pylori strains (7) and its presence is associated with a more severe clinical outcome, such as PU, atrophic G, and gastric cancer (GC) (4, 5). The cagA induces interleukin-8 (IL-8) production and mucosal inflamation (4, 5). The cagPAI contains a gene known as cagE, is one of the marker genes in cagI of the cagPAI and it is required for translocation and phosphorylation (9, 28). The cagE gene was found to be associated with a more severe clinical outcome (11).

The vacA gene is present in all H. pylori strains and contains at least two variable parts (a hypervariable signal sequence and a middle region allele) (2). Among the vacA subtypes, subtypes s1a, s1b, s1c and s2, and m1, m2a and m2b have been identified (30). Although all strains of H. pylori include the vacA gene, they vary in their ability to produce cytotoxin (8). Type m1 strains show more toxic activity than m2, type s1a is more active than s1b, and type s2 is less active than s1 (2).

The recently discovered iceA gene exists in two main allelic variants of the gene, iceA1 and iceA2 (21). iceA1 is upregulated upon contact of H. pylori with the gastric epithelium (21) and is a marker for PU disease (31).

Blood adhesion binding antigen A, encoded by the babA2 gene has been exhibited to mediate binding activity between bacterial adhesin and human Lewis-b blood group antigens on gastric epithelial cells (14). Although three babA alleles have been identified (babA1, babA2 and babB), only the babA2 gene product is necessary for Lewis b binding activity (14).

There is not much information available on determination of the genotypes of H. pylori in Turkey, particularly in eastern Turkey where the overall incidence of G and PU are high. This study aimed 1) to detect the prevalence of the vacA, cagA, cagE, iceA1, iceA2 and babA2 genotypes in patients with G and PU, 2) to determine a possible association between clinical outcome and genotypes and 3) to identify any association between the genotypes and sex.

MATERIALS AND METHODS

Patients

A total of 140 H. pylori isolates (115 with G, 23 with PU, 2 with GC) identified by PCR from antral biopsies of 184 Turkish patients [17–92 years of age (average 49)] who underwent endoscopy at Firat University Hospital, Gastroenterology Department during 2009 and 2010. Approval of this study was obtained from the Medical Ethics Committee of Firat University. We received informed consent from all patients.

DNA Extraction

DNA samples was extracted by QIAamp DNA mini kit (Qiagen, Lot No: 11872534, Cat No: 51306) according to the manufacturer’s instructions. The extracted DNA was stored at -20 ºC until used as template in PCR.

PCR analysis of genotypes in H. pylori isolates

The primers used in this study and PCR conditions are shown in Table 1. For the cagA gene subtypıng, primers CAGA-F and CAGA-R yielded a fragment of 298 bp of the cagA gene were used (13). For analysis of the vacA s region, primers VA1-F, VA1-R, SS2-F, and SS3-F were used (2, 23, 34). Primers VA1-F and VA1-R yielded a fragment of 259 bp or 286 bp in size for type s1 or s2 strains, respectively. For detection of the vacA m region, primers VAG-F and VAG-R generated a fragment of 567 bp for m1 variants and a fragment of 642 bp for m2 variants (23). For analysis of the cagE gene, primers CagE-F and CagE-R yielded a fragment of 508 bp of the cagE gene described by Tomasini et al. (28) were used. For detection of the iceA gene, primers iceA1-F, iceA1-R, iceA2-F, and iceA2-R were used (31). Primers iceA1-F and iceA1-R generated a fragment of 247 bp for the iceA1 gene, and primers iceA2-F and iceA2-R generated a fragment of 229 or 334 bp for the iceA2 gene (31). For analysis of the babA2 gene, primers BABA2-F and BABA2-R described by Sheu et al. (27) were used.

Table 1

Primers and PCR conditions used in our study.

Genes	Sequence (5′ → 3′)	Cycle Conditions	Size (bp) of Expected PCR product	Reference number
cagA	ATAATGCTAAATTAGACAACTTGAGCGA TTAGAATAATCAACAAACATCACGCCAT	94°C, 1 min; 60°C, 1 min; 72°C, 1 min (45 cycles)	298	13
vacA s1/s2	ATGGAAATACAACAAACACAC CTGCTTGAATGCGCCAAAC	94°C, 1 min; 52°C, 1 min; 72°C, 1 min (35 cycles)	259/286	2, 23
vacAsla	GTCAGCATCACACCGCAAC CTGCTTGAATGCGCCAAAC	94°C, 1 min; 52°C, 1 min; 72°C, 1 min (35 cycles)	190	23
vacAslb	AGCGCCATACCGCAAGAG CTGCTTGAATGCGCCAAAC	94°C, 1 min; 52°C, 1 min; 72°C, 1 min (35 cycles)	187	23
vacAslc	CTCTCGCTTTAGTGGGGYT CTGCTTGAATGCGCCAAAC	94°C, 1 min; 52°C, 1 min; 72°C, 1 min (35 cycles)	213	34
vacA m1/m2	CAATCTGTCCAATCAAGCGAG GCGTCAAAATAATTCCAAGG	94°C, 1 min; 52°C, 1 min; 72°C, 1 min (35 cycles)	567/642	23
cagE	TTGAAAACTTCAAGGATAGGATAGAGC GCCTAGCGTAATATCACCATTACCC	94 °C, 1 min; 53°C, 45 s; 72°C, 45 s (35 cycles)	508	28
iceAl	GTGTTTTTAACCAAAGTATC CTATAGCCASTYTCTTTGCA	95°C 1 min; 57°C, 1 s; 72°C, 1 min (35 cycles)	247	31
iceA2	GTTGGGTATATCACAATTTAT TTRCCCTATTTTCTAGTAGGT	95°C 1 min; 57°C, 1 s; 72°C, 1 min (35 cycles)	229 or 334	31
babA2	CCAAACGAAACAAAAAGCGT GCTTGTGTAAAAGCCGTCGT	94°C, 1 min; 45°C, 1 min; 72°C, 1 min (30 cycles)	271	27

Amplification was performed in a reaction mixture (50 µl final volume) containing 25 µl 2XPCR Master Mix (Fermentas, K01071), 15 µl distilled water, 2.5 µl of each primer and 400 ng genomic DNA. The thermal cycling conditions performed with a touchdown thermal cycler (Hybaid, Middlesex, England). PCR product was analyzed on 1.5% agarose gel containing 0.5 µg/ml of ethidium bromide.

The DNAs of the HP 26695, HP J99 and some clinical isolates, provided by Dr. Yoshio Yamaoka from Michael E. DeBakey Veterans Affairs Medical Center, Houston, TX 77030, USA was used to confirm the PCR test as positive controls. Distilled water used as a negative control.

Statistical analysis

The Fischer’s exact and χ 2tests were used to compare the differences between H. pylori genotypes and clinical outcome and between the sex and genotypes. A p value of <0.05 was taken statistically significant.

RESULTS

The prevalence of cagA vacA, cagE, iceA and babA2 genes are shown in Table 2. Because the number of patients with GC is very low, the relationship between H. pylori genotypes in patients with GC was not determined.

Table 2

The prevalence of virulence genes inH. pylori isolates.

Virulence genes	Prevalence (n) (%)
cagA	100 (71.4)
vacAs1	124 (88.6)
vacAs1a	114 (81.4)
vacAs1b	4 (2.9)
vacAs1c	6 (4.3)
vacAs2	16 (11.4)
vacAm1	53 (37.9)
vacAm2	87 (62.1)
vacAs1/m1	53 (37.9)
vacAs1/m2	71 (50.7)
vacAs2/m2	16 (11.4)
cagE	50 (35.7)
iceA1	58 (41,4)
iceA2	82 (58.6)
babA2	87 (62.1)
vacAs1+ cagA+ babA2+	74 (52.9)

The cagA gene was determined in 100 (71.4%) of 140 isolates examined (Table 2). The vacA genes was found in all isolates we studied. All vacAm1 genotypes from patients were also vacAs1. The vacAs1a (81.4%) gene was found most frequently than vacAs1b (2.9%) and vacAs1c (4.3%). The most vacA allelic combination was s1/m2 (50.7%), followed by s1/m1 (37.9%) and s2/m2 (11.4%). In addition, the most common vacA allelic combination were vacAs1m1 (65.2%) and s1m2 (53.9%) in patients with PU and G, respectively. No vacAs2m1 genotype was observed in our study. Seventy-four (52.9%) isolates were found to be “triple positive” (vacAs1+cagA+babA2+) (Table 2).

The prevalence of the cagE genotype was 50 (35.7%), and it was found more commonly in patients with PU. The iceA genes were found in all isolates we studied. The iceA1 and iceA2 genes were detected in 58 (41.4%) and 82 (58.6%) isolates, respectively. The iceA1 gene was most frequently observed in patients (60.9%) with PU, whereas iceA2 was most commonly found in patients (63.5%) with G. The iceA2 isolates classified in two types according to PCR product size: 229 and 334 bp. The distribution of these two types were similar in the isolates examined (data not shown). The babA2 gene was observed in 87 (62.1%) of all isolates studied (Table 2 and 3).

Table 3

The prevalence of the genotypes in 140 H. pylori positive patients with G and PU.

Genotypes	G (n = 115) (%)	PU (n=23)(%)
cagA	79 (68.7)	19 (82.6)
vacAs1	99 (86.1)*	23 (100)*
vacAs1a	90 (78.3)	22 (95.7)*
vacAs1b	4 (3.5)	0 (0)
vacAs1c	5 (4.3)	1 (4.3)
vacAs2	16 (13.9)	0 (0)
vacAm1	37 (32.2)	15 (65.2)*
vacAm2	78 (67.8)*	8 (34.8)
vacAs1/m1	37 (32.2)	15 (65.2)*
vacAs1/m2	62 (53.9)	8 (34.8)
vacAs2/m2	16 (13.9)	0 (0)
cagE	39 (33.9)	10 (43.5)
iceA1	42 (36.5)	14 (60.9)
iceA2	73 (63.5)	9 (39.1)
babA2	68 (59.1)	17 (73.9)*
vacAs1+ cagA+ babA2+	59 (51.3)	13 (56.5)

significant p<0.05

The presence of the only vacAs1 isolate was significantly associated with G and PU (p<0.05). The vacAs1a, ml, slml and babA2 genes were significantly associated with PU (p<0.05), whereas m2 gene was significantly associated with only G (p<0.05). The cagA gene was significantly associated with s1, s1m1 and babA2 genotypes (p<0.05) (Table 3).

The distribution of H. pylori genotypes and sex is shown in Table 4. The difference between sex and genotypes was statistically significant among the cagA, vacAs1, iceA2 and babA2 genes (p<0.05) (Table 4).

Table 4

The association between the sex of 140 H. pylori-positive patients and its genotypes.

Genotypes	Male (70)	Female (70)
	n (%)	n (%)
cagA	53 (75.7)*	47 (67.1)
vacA s1	66 (94.3)*	58 (82.9)
vacA s2	4 (5.7)	12 (17.1)
vacA s1a	58 (82.9)	56 (80)
vacA s1b	3 (4.3)	1 (1.4)
vacA s1c	5 (7.1)	1 (1.4)
vacA m1	31 (44.3)	22 (31.4)
vacA m2	39 (55.7)	48 (68.6)
vacA s1/m1	31 (44.3)	22 (31.4)
vacA s1/m2	35 (50)	36 (51.4)
vacA s2/m2	4 (5.7)	12 (17.1)
cagE	28 (40)	22 (31.4)
iceA1	20 (28.6)	38 (54.3)
iceA2	50 (71.4)*	32 (45.7)
babA2	50 (71.4)*	37 (52.9)
vacAs1+ cagA+ babA2+	45 (64.3)	29 (41.4)

significant p<0.05

DISCUSSION

The number of studies related to genotypes of H. pylori in Turkey is seldom, and the data on the relationship of the genotypes and gastrointestinal diseases have been still disputable (8).

The cagA prevalence is different in every part of the world. The prevalence of cagA gene in this study was 71.4%.Ozbey, G. and Aygun, C.

This finding is in agrement with reports from Western countries (22, 24) but lower than reports from East Asian countries where the cagA are present in more than 90% of cases (33). In addition, the results of this study are consistent with previous reports (6, 29) which no association was found between cagA gene and PU. However, some studies have been reported that cagA gene was statistically associated with PU (10, 20, 26).

The different results have also been reported in studies related to the vacA gene of H. pylori strains. In the present study, the vacA gene was observed in all strains. Our finding was similar to previous reports from Turkey (10, 25, 26), Northern and Eastern European countries (32) where s1a gene was predominant genotype, but in contrast to a report from Korea (16). We detected a low prevalence of vacAs1b in this study which was contrast to pevious reports in Portugal, Central and South America (32). No vacAs1c genotype was determined except for the only one study reported in Turkey (18). In this study, the prevalence of the vacAs1c gene was found to be low. This may be related to low prevalence of GC in Turkey as stated in a study carried out by Erzin et al. (10).

We found that no s1b, s1c and s2 genotypes associated with G and PU. Our data similar to previous reports in Turkey where vacAs1a strains were showed to be significantly associated with PU (10, 18), but different from a study in Turkey reported that vacAs1a strains were not found to be statistically associated with PU (26).

Our results supported the findings of the studies performed in Turkey and other countries (3, 6, 10, 18) where the s1m2 genotype was the most common gene combinations of the vacA, but contrary to studies (8, 26) reported that s1m1 genotype was the most predominant gene. The prevalence of s2m2 genotype was determined as 11.4% and all of s2m2 positive isolates were cagA negative. No s2m1 genotype was found in this study. This finding correlated confirm few data reported from other geographic regions of Turkey (6, 10, 18). On the other hand, this study confirmed the findings of previous reports (6, 8, 10, 29) where there was no significant association between vacAs1m2 genotype, G and PU disease.

The prevalence (35.7%) of cagE in this study is lower than other studies conducted in USA (64%) (22), Turkey (59.3%) (10), UK (71.2%) (15) and Thailand (88.4%) (8) but higher than a previous study in Turkey (28.6%) (25). In an attempt to detect association between the cagE gene and PU, Fallone et al. (11), Day et al. (9) and Erzin et al. (10) have reported a significant association between the cagE gene and PU which is contrast to our findings.

In contrast to the results reported in China, Japan, Korea and Netherlands where the iceA1 gene was predominant (16, 20, 31), the iceA2 gene was detected to be predominant genotype in this study. This result is in agreement with previous reports that the iceA2 gene was found to be prevalent in Brazilian, European and American patients (1, 20, 22).

Our results were similar to a previous study (1) reported that the distribution of iceA2 229 and 334-bp amplicon was found to almost the same in H. pylori strains. The results of the present study are similar to previous studies that no significant association between the iceA1 gene and PU have found in Brazilian and Turkish patients (1, 6, 10), but in contrast to those reported by Peek et al. (21) and van Doorn et al. (31), who showed the association between the presence of iceA1 gene and PU. The iceA2 was more frequently observed in males than in females. Similar result have been reported by Ashour et al. (1).

The prevalence of the babA2 genotype in H. pylori strains varied in different countries of world. The prevalence of the babA2 was 34–72% in Western countries (12, 19, 29) while it was 80–100% in Asian countries (16). We found a higher prevalence (62.1%) of babA2 than the result (53.8%) reported in a previous study (10) in Turkey. Erzin et al. (10) had used the primers described by Gerhard et al. (12), we used the primers of Sheu et al. (27) which exhibited a high prevalence of babA (8). A low prevalence of the babA2 gene was detected when the primers described by Gerhard et al. (12) were used (12, 20). These primers amplifies 832 bp (12) in a highly variable region, associated with false negative PCR due to allelic

variation (19). This study showed a highly significant association between the babA2 gene and PU disease, concurring with the previous studies (12, 29). This state may be explained by allelic variation in the babA gene which could have a variable affect in the different geographic regions of a country (19).

Regarding the relationship with genotypes in each isolate, we found to be an association between the cagA stratus and the vacAs1 genotype in present study which was similar with previous findings (12, 26, 29, 32). In addition, our study showed significantly association between the babA2 and the vacAs1 in contrast to the results reported by Erzin et al. (10) and Torres et al. (29).

In regard to the association with the distribution of H. pylori genotypes and sex in this study, the association was statistically significant among the cagA, vacAs1, iceA2 and babA2 genes. In a study conducted by Mansour and colleagues (17), there was no significant association between cagA gene and sex, but the association was statistically significant among the vacA, iceA and oipA genes (17).

This study reported the prevalence of the genotypes in H. pylori isolates in Elazig province located in the East of Turkey for the first time. However, the multicenter and large scale studies are needed to help us better understand epidemiological importance of this disease and the association between H. pylori genotypes and clinical outcome in different regions and populations.