Literature DB >> 23940577

Surface display and bioactivity of Bombyx mori acetylcholinesterase on Pichia pastoris.

Jie-Xian Dong1, Xi Xie, Yong-Sheng He, Ross C Beier, Yuan-Ming Sun, Zhen-Lin Xu, Wei-Jian Wu, Yu-Dong Shen, Zhi-Li Xiao, Li-Na Lai, Hong Wang, Jin-Yi Yang.   

Abstract

A Pichia pastoris (P. pastoris) cell surface display system of Bombyx mori acetylcholinesterase (BmAChE) was constructed and its bioactivity was studied. The modified Bombyx mori acetylcholinesterase gene (bmace) was fused with the anchor protein (AGα1) from Saccharomyces cerevisiae and transformed into P. pastoris strain GS115. The recombinant strain harboring the fusion gene bmace-AGα1 was induced to display BmAChE on the P. pastoris cell surface. Fluorescence microscopy and flow cytometry assays revealed that the BmAChE was successfully displayed on the cell surface of P. pastoris GS115. The enzyme activity of the displayed BmAChE was detected by the Ellman method at 787.7 U/g (wet cell weight). In addition, bioactivity of the displayed BmAChE was verified by inhibition tests conducted with eserine, and with carbamate and organophosphorus pesticides. The displayed BmAChE had an IC50 of 4.17×10(-8) M and was highly sensitive to eserine and five carbamate pesticides, as well as seven organophosphorus pesticides. Results suggest that the displayed BmAChE had good bioactivity.

Entities:  

Mesh:

Substances:

Year:  2013        PMID: 23940577      PMCID: PMC3734245          DOI: 10.1371/journal.pone.0070451

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

The intensive use of carbamate (CB) and organophosphorus (OP) pesticides in recent years has led to potentially dangerous effects on human and animal health. The control of pesticide residues in food and the environment is of great importance to minimize the risk to consumers and environmental animal species. Routinely, CB and OP pesticide residues are measured by instrumental methods, such as gas chromatography, liquid chromatography and gas chromatography–tandem mass spectrometry [1], [2], [3]. There is a growing interest in more rapid and low-cost field-portable detection systems. A promising approach involves the use of screening enzyme-linked immunoassays [4]. However, these assays require broad-specificity antibodies that are difficult to develop. Nevertheless, an enzyme-based method was demonstrated to be an efficient and rapid method for the detection of pesticides because it was inexpensive, allowed high sample throughput, and was easily adapted for use in Asian markets [5]. Previously, acetylcholinesterase (AChE), aldehyde dehydrogenase, alkaline and acid phosphatase, butyrylcholinesterase, organophosphorus hydrolase and tyrosinase have been investigated for their ability to detect pesticides in water and other matrices such as soil, food and beverages [6]. However, AChE has been most often used for enzymatic detection of pesticides because of its broad substrate specificity and good sensitivity [6]. AChE is a key enzyme in the cholinergic system that regulates the level of acetylcholine and terminates nerve impulses by catalyzing the hydrolysis of the neurotransmitter acetylcholine in the synaptic cleft [7], [8]. The enzyme activity of AChE can be inhibited by CB and OP pesticides. Therefore, it is feasible to use AChE for the detection of CB and OP pesticides based on the degree of AChE activity inhibition [9]. AChE has been isolated by traditional extraction methods from natural tissues [10], [11], [12] or from secretions of engineered cells [8], [13]. Isolation from these areas requires an enzyme purification step, which leads to higher preparation costs. However, natively displayed molecules on the surface of cells presents another option, which is currently of great interest. Many heterologous proteins and polypeptides have been displayed on the surface of cells, and these displays have been widely used [14], [15], [16], [17], [18]. The use of displayed molecules on the cell surface can save tedious purification steps required for enzymes used in traditional immobilization methods. Further, protein engineering can help generate a surface display of enzymes that can be used in efficient high-throughput screening methods for residue detection. In cell surface display development, the anchor protein is a necessary component. The most frequently used anchor is the N-terminal fusion display of α-agglutinin from Saccharomyces cerevisiae (S. cerevisiae), which is composed of a secretion-signal region, an active region, a serine- and threonine-rich support region, and a putative glycosylphosphatidylinositol anchor-attachment protein. AGα1 protein is one of the α-agglutinins in N-terminal fusion displays [19]. Different enzymes used for the detection of pesticides, like organophosphorus hydrolase [20] and mouse AChE [21], have been expressed on the surface of microorganisms. In this study we took advantage of the domestic silkworm, Bombyx mori as the ace gene source to investigate the sensitivity of the displayed AChE for pesticides. Domesticated silkworms have not suffered from pesticide selection, severe competition for food, or from finding good mating partners over the last number of decades. As a result, the sensitivity of AChE in domestic silkworms would be expected to be preserved and be more sensitive than the enzyme from the wild-type source [22], suggesting that AChE from Bombyx mori may be a remarkable reagent for pesticide detection. This study was conducted with the aim to construct a cell surface display system for Bombyx mori AChE (BmAChE). The work may lay the foundation for further sensitivity improvement by developing a displayed AChE system through recombinant molecular methods and application of whole-cell biosensors for the broad-specificity detection of CB and OP pesticides. Here we displayed the BmAChE on Pichia pastoris (P. pastoris) for the first time. We cloned the AChE gene from Bombyx mori and the anchor protein gene AGα1 from Saccharomyces cerevisiae (S. cerevisiae). We then constructed a stable P. pastoris cell surface display system for the recombinant BmAChE. The display of the recombinant enzyme on the surface of the yeast was then used for the detection of CB and OP pesticides, which resulted in the development of a rapid, easy and sensitive analytical method useful for the detection of pesticide residues.

Materials and Methods

Strains and Media

Escherichia coli (E. coli) DH5α stored in our laboratory was used as the host for recombinant DNA manipulation. The P. pastoris GS115 strains and the integrative expression vector (pPIC9K) were obtained from Invitrogen Biotechnology Co. (Shanghai, China). E. coli was grown in Luria-Bertani medium (1% peptone, 0.5% yeast extract, and 1% sodium chloride). Pichia pastoris was cultivated in yeast peptone dextrose medium (1% yeast extract, 2% peptone, and 2% glucose), and P. pastoris transformants were cultivated on minimal dextrose medium (MD) plates (2% glucose, 0.00004% biotin, 1.34% yeast nitrogen base (YNB) and 1.8% agarose).

Reagents

Gel extraction kits were obtained from Tiangen (Beijing, China). Yeast genome extraction kits were obtained from Beijing ComWin Biotech Co., Ltd (Beijing, China). PrimerSTAR DNA polymerase, restriction enzymes, and dNTP were obtained from Takara Biotechnology Co. Ltd. (Dalian, China). Primers were synthesized by Shanghai Sangon Biotechnology (Shanghai, China). The mouse anti-FLAG monoclonal antibody, Alex Fluor 488 labeled goat anti-mouse IgG, acetylthiocholine iodide (ATC) and 5,5′-dithiobis(2-nitrobenzoic acid) (DTNB) were obtained from Sigma-Aldrich (St. Louis, MO, USA). CB and OP standards were obtained from the National Center of Standard Material (Beijing, China).

Cloning and Assembly of the bmace-AGα1 Gene

The construction scheme for the plasmid containing the bmace-AGα1 fusion gene is shown in Fig. 1; DNA fragments encoding for BmAChE were amplified with the constructed vector pPIC9K–bmace [23] as a template without the signal peptides and the hydrophobic amino acid tail gene. The PCR process was performed using PrimerSTAR DNA Polymerase and the amplification experiment was run at a melting temperature of 94°C for 1 min, annealing at 58°C for 1 min, and extension at 72°C for 2 min, with a 30 cycle repeat. Primers used for PCR amplification containing the FLAG tag at 5′ and partial linker at 3′ were the two oligonucleotides F1 and R1, respectively (Table 1). The genome of S. cerevisiae was extracted using the yeast genome extraction kit, and the AGα1 gene was amplified using the genome as template and the F2 and R2 primers listed in Table 1. The purified bmace and AGα1 DNA segments (50 ng each) were spliced using overlap extension PCR to assemble the bmace-AGα1 gene with the (Gly4Ser)3 linker. Then, the bmace-AGα1 gene was amplified using the F1 and R2 primers (Table 1). The PCR amplification products were purified by an agarose gel DNA purification kit and stored at −20°C.
Figure 1

The chemical structures of the different compounds tested.

(A) structure of the natural inhibitor of AChE, (B) structures of the CB pesticides, (C) structures of the OP pesticides.

Table 1

Primers used for cloning bmace and AGα1 genes and generating the synthetic gene encoding bmace-AGα1 fusion protein.

F1: 5′-GCGACGCGTGACTACAAGGACGATGACGATAAGCGATCTTGGGCCAATCAC-3′
R1: 5′- CCAGAGCCACCTCCGCCTGAACCGCCTCCACCACTGCTGTAAGGACCGGT-3′
F2: 5′ -AGGCGGAGGTGGCTCTGGCGGTGGCGGATCGAACCTCGGTACAGCTAGC-3′
R2: 5′-GCCGCGGCCGCGAATAGCAGGTACGACAAAAG-3′
AOX-F 5′-GGCAAATGGCATTCTGACATCCT-3′
AOX-R 5′-GGCAAATGGCATTCTGACATCC-3′.

The chemical structures of the different compounds tested.

(A) structure of the natural inhibitor of AChE, (B) structures of the CB pesticides, (C) structures of the OP pesticides.

Construction of the Plasmid for Cell Surface Display

The resulting PCR products from the above step were digested with the restriction enzymes Mlu I and Not I, and then ligated into the expression vector pPIC9K. The ligated products were transformed into competent E. coli DH5α cells for propagation of the recombinant plasmid. The recombinant plasmid pPIC9K-bmace-AGα1 was confirmed by restriction enzyme digestion and DNA sequencing.

P. pastoris Transformation and Selection

Linearized vectors were transformed into P. pastoris as previously described [24]. Transformed cells were spread on MD plates and incubated at 30°C for 3 d to select His+ transformants. Genomic integration was confirmed by performing PCR on genomic DNA with the AOX-F and AOX-R primers (Table 1).

Expression of the bmace-AGα1 Gene

The recombinant P. pastoris clone was grown in 20 mL BMGY medium (1% yeast extract, 2% peptone, 1.34% YNB, 0.00004% biotin, 1% glycerol and 100 mM potassium phosphate (pH 6.0)) in shake culture at 30°C for 24 h until the OD600 reached a value of more than 4. The culture (5 mL) was centrifuged at 3000×g for 5 min. The cells were induced by re-suspension with 20 mL BMMY medium (1% yeast extract, 2% peptone, 1.34% YNB, 0.00004% biotin, 0.5% methanol and 100 mM potassium phosphate (pH 6.0)) and the resulting OD600 was approximately 1. The induction was continued at 28°C for 4 more d by adding 200 µL of 100% methanol to the cultures daily.

Characterization of the Displayed BmAChE by Fluorescence Microscopy

The immunofluorescent labeling of yeast cells was carried out as follows: A cell suspension was centrifuged at 8000×g for 1 min, and the collected cells were washed three times with 0.01 M phosphate buffered saline (PBS) (8.0 g/L NaCl, 1.44 g/L Na2HPO4•12H2O, 0.2 g/L KCl, 0.24 g/L KH2PO4 (pH 7.4)). The cells were suspended and blocked with PBS containing 1% bovine serum albumin (BSA) for 0.5 h (OD600 = 1.0). Anti-FLAG IgG (1 µL) was added to the 200 µL cell suspension and incubated at room temperature for 1.5 h. The cells were then washed with PBS, centrifuged at 6000×g for 10 min at room temperature, suspended in 200 µL of PBS with 1 µL Alexa Fluor TM 488-conjugated goat anti-mouse IgG (1∶200), and then incubated at room temperature for 1.5 h. The PBS washed cells were observed under a fluorescence microscope (Nikon Eclipse 80i, Tokyo, Japan). The excitation and emission wavelengths used were 488 nm and 510–535 nm, respectively.

Flow Cytometry Detection

The number of yeast cells displaying BmAChE was determined using a flow cytometer (BD FAcscalibur, CA, USA) with a 488 nm excitation wavelength and a 525 nm emission wavelength to estimate the percentage of BmAChE molecules displayed.

Enzyme Activity Determination of the Displayed BmAChE

The activity of the displayed BmAChE was evaluated spectrophotometrically at 405 nm according to Ellman et al [25]. using the substrate ATC and the chromogenic reagent DTNB. A cell suspension (100 µL) of transformed P. pastoris was centrifuged at 8000×g for 2 min and the cells were weighed. The collected cells (approximately 1.03×107 cells as determined by a hemocytometer) were washed three times with potassium phosphate buffer (3.075 mL of a 1 M K2HPO4 solution combined with 1.925 mL of a 1 M KH2PO4 solution (pH 7.0)) and re-suspended in 780 µL potassium phosphate buffer (pH 7.0). The enzymatic reaction was activated by consecutively adding 100 µL of 1 mM ATC and 7.8 mM DTNB. The reaction mixture was incubated at room temperature for 5 min and stopped with 20 µL of 1×10−7 M eserine. After centrifugation of the reaction mixture, the supernatant was used to measure the OD at 405 nm with an ELISA reader (Multiscan MK3, Labsystem Co., Finland). One unit of AChE activity was defined as the amount of enzyme hydrolyzing 1 mmol of ATC in 1 min with 1 g of wet cells.

Inhibition of Displayed BmAChE

Inhibition of the displayed BmAChE was carried out in the presence of eserine [26], a well-known AChE inhibitor previously employed to study the enzyme. Transformants were inoculated on MM-B agar plates (1.34% YNB (v/v), 0.00004% biotin, 1% methanol, 100 mM potassium phosphate buffer (pH 7.0) and 1.8% agarose) at 28°C for 3 d. Then 10 µL of 50 mM potassium phosphate buffer (pH 7.0) was placed on one GS115 colony (negative control) and on one GS115/pPIC9K-bmace-AGα1 colony (positive control), and 5 µL of 50 mM potassium phosphate buffer (pH 7.0) and 5 µL of different concentrations of eserine (10−2–10−9 M) were placed on 8 other positive colonies. Following a 10 min reaction period, 3 µL of 10 mM ATC and 3 µL of 7.8 mM DTNB were added to each colony, and the colony color was observed after 10 min at 37°C. Also, an inhibition study of the displayed BmAChE was performed according to Ellman's method [25] using the yeast cell suspension and different concentrations of eserine.

Detection of CB and OP Pesticides Using the Displayed BmAChE

Five CB pesticides (carbofuran, carbosulfan, isoprocarb, methiocarb and methomyl) and seven OP pesticides (dichlorphos, dimethoate, isocarbophos, malathion, methamidophos, parathion and trichlorphon) were tested (Figure 1). The induced cell suspension was centrifuged at 8000×g for 2 min, re-suspended and adjusted to an OD600 of 2 using 50 mM potassium phosphate buffer (pH 7.0). A volume of 120 µL transformed P. pastoris cell suspension (approximately 0.25×107) was mixed with the same volume but different concentrations of CB and OP pesticides. After a 5 min incubation at room temperature, 30 µL of 10 mM ATC and 7.8 mM DTNB were consecutively added, and 20 µL of 1×10−7 M eserine was added to stop the reaction. The reaction mixture was centrifuged at 8000×g for 2 min and the suspension was removed to microlon plates. The activity of AChE was measured using the multilabel counter at 405 nm. The median inhibition concentration (IC50) for each compound was calculated based on the Log-dose versus probit regression [27]. The lowest concentration that could be detected was measured according to the Inhibition Rate (B/B0).

Results and Discussion

Construction of the BmAChE Yeast Surface Display System Using P. pastoris

The plasmid for surface display of BmAChE was constructed as shown in Fig. 2. The amplification of bmace generated an approximate 1900 bp DNA fragment, while the AGα1 gene generated an expected 1000 bp fragment. PCR amplification of the assembled bmace-AGα1 gene produced an expected 2900 bp fragment (Figure S1, see supplementary data for the nucleic acid sequence in the Supporting Information). The bmace-AGα1 gene with a FLAG tag (eight amino acids) at the N-terminus of AChE was subcloned into the expression vector pPIC9K. The results from sequencing indicated the recombinant plasmid pPIC9K-bmace-AGα1 had been successfully constructed. PCR amplification using AOX-F and AOX-R primers (Table 1) with the genome of the selected transformants as template produced the 2900 bp amplified fragment, indicating that the constructed vectors were integrated into the genome of P. pastoris GS115.
Figure 2

Construction of the BmAChE-display with the P. pastoris expression system based on α-agglutinin.

The bmace and AGα1 DNA segments were spliced using overlap extension PCR to assemble the bmace-AGα1 gene and inserted into pPIC9K for the pPIC9K-bmace-AGα1 construction.

Construction of the BmAChE-display with the P. pastoris expression system based on α-agglutinin.

The bmace and AGα1 DNA segments were spliced using overlap extension PCR to assemble the bmace-AGα1 gene and inserted into pPIC9K for the pPIC9K-bmace-AGα1 construction.

Characterization of the Displayed BmAChE by Fluorescence Microscopy and Flow Cytometry

The display of BmAChE on the yeast cell surface was evaluated by immunofluorescence microscopy. Fluorescence was observed on the cell surface of the pPIC9K-bmace-AGα1 transformant strains using a fluorescence microscope, and fluorescence was not observed from the control cells (Fig. 3). The images demonstrated that the bmace-AGα1 fusion protein was anchored on the P. pastoris surface.
Figure 3

Fluorescence microscopy assay of recombinant P. pastoris cells displaying BmAChE: The fluorescence at 519 nm emitted with excitation at 495 nm was observed by fluorescence microscopy.

(a) and (c), phase micrographs of recombinant yeast cells; (b) and (d), fluorescent micrographs of recombinant yeast cells. GS115/pPIC9K-bmace-AGα1 (a, b); GS115 as a control (c, d).

Fluorescence microscopy assay of recombinant P. pastoris cells displaying BmAChE: The fluorescence at 519 nm emitted with excitation at 495 nm was observed by fluorescence microscopy.

(a) and (c), phase micrographs of recombinant yeast cells; (b) and (d), fluorescent micrographs of recombinant yeast cells. GS115/pPIC9K-bmace-AGα1 (a, b); GS115 as a control (c, d). The expression of the BmAChE fusion protein on the surface of P. pastoris was further analyzed by indirect immunofluorescence labeling using flow cytometry (Fig. 4). A difference was detected in the amounts of BmAChE-α-agglutinin fusion protein expression obtained from P. pastoris pPIC9K-bmace-AGα1 transformants. Fluorescence was detected in about 25% of the constructed cells. These studies confirmed that BmAChE was displayed on the cell surface of P. pastoris.
Figure 4

Flow cytometry detection of BmAChE displayed on the recombinant yeast surface.

Enzyme Activity Determination Using Displayed BmAChE

AChE activity was measured based on the Ellman method [25] using ATC and DTNB. The hydrolytic activity of the BmAChE enzymes displayed on the surface of the cells was 787.7 U/g (wet cell weight) after being induced with methanol for 4 days at 28°C.

The inhibition analysis of displayed BmAChE

The inhibition characteristics of eserine, the AChE specific inhibitor, were performed on MM-B plates. As shown in Fig. 5, the color of the original P. pastoris GS115 colonies was white (Fig. 5, colony 1), while the color of the transformed P. pastoris GS115/pPIC9K-bmace-AGα1 colonies was yellow (Fig. 5, colony 2). When the concentration of eserine was between 10−7–10−9 M, the color of the pPIC9K-bmace-AGα1 colonies gradually turned yellow (Fig. 5, colony 8–10). When the concentration of eserine was 10−9 M (Fig. 5, colony 10), the color was close to the positive control (Fig. 5, colony 2). Based on colony color, the inhibition characteristics of eserine for displayed BmAChE were estimated for a concentration series of eserine solutions (1×10−8, 2×10−8, 3×10−8, 4×10−8, 5×10−8, 6×10−8 and 7×10−8). The B/B0 decreased with increasing eserine concentrations (Fig. 6 (A)). The IC50 of BmAChE was 4.17×10−8 M. The results showed that the recombinant BmAChE that was displayed on the yeast surface exhibited high-sensitivity to eserine. Compared with the BmAChE expressed in Trichoplusia ni (BTI-Tn-5B1-4) cells [28], the sensitivity for eserine in our report was at about the same level, which indicated that BmAChE retained its natural activity after being displayed on the cell surface.
Figure 5

P. pastoris display of BmAChE on an MM-B plate: 1, GS115; 2, GS115/pPIC9K-bmace-AGα1; 3–10, GS115/pPIC9K-bmace-AGα1 inhibited by different concentrations of eserine (clone 3: 10−2 M, clone 4: 10−3 M, clone 5: 10−4 M, clone 6: 10−5 M, clone 7: 10−6 M, clone 8: 10−7 M, clone 9: 10−8 M, clone 10: 10−9 M).

Figure 6

Inhibition curve of displayed BmAChE.

(A), inhibition curve of displayed BmAChE for eserine; (B), inhibition curve of displayed BmAChE for CB pesticide (n = 3); and (C), inhibition curve of displayed BmAChE for OP pesticides (n = 3). B, the average absorbance at the indicated concentrations; B0, the average absorbance at zero concentration. The data were fitted with a four-parameter-logistic equation to calculate the IC50 using OriginPro 7.5 software. The data points are mean values and the errors observed from triplicate determinations.

Inhibition curve of displayed BmAChE.

(A), inhibition curve of displayed BmAChE for eserine; (B), inhibition curve of displayed BmAChE for CB pesticide (n = 3); and (C), inhibition curve of displayed BmAChE for OP pesticides (n = 3). B, the average absorbance at the indicated concentrations; B0, the average absorbance at zero concentration. The data were fitted with a four-parameter-logistic equation to calculate the IC50 using OriginPro 7.5 software. The data points are mean values and the errors observed from triplicate determinations.

Detection of CB and OP Pesticides Using Displayed BmAChE

The displayed BmAChE enzyme was used to detect five CB and seven OP pesticides. Measurement of enzyme activity and inhibition studies were performed as described in the experimental section. The inhibition of BmAChE with CB pesticides is shown in Fig. 6 (B). An IC50 of 1.92×10−9 M was obtained with carbofuran, while an IC50 of 1.13×10−7 M was obtained with carbosulfan, 1.11×10−8 M with isoprocarb, 6.58×10−8 M with methiocarb and 6.41×10−8 M with methomyl. Inhibition of BmAChE with seven OP pesticides is shown in Fig. 6 (C) and Table 2. Among them, trichlorphon showed the highest inhibitory effect on BmAChE activity with an IC50 of 2.40×10−7 M and a limit of detection of 3.89×10−8 M. The maximum European Union (EU) residue limit was recently set at 0.01 mg/kg (approximately 4.0×10−8 M) for pesticide residues in all agricultural products for food or animal feed [29]. Therefore, the activity of the displayed BmAChE has sufficient sensitivity for the determination of most of the selected CB and OP pesticides. As seen in Table 2, for all five tested CB pesticides (carbofuran, carbosulfan, isoprocarb, methiocarb and methomyl), the sensitivity values of the displayed BmAChE were better than those of the common housefly (Musca domestica) and those of the common fruit fly (Drosophila melanogaster) AChEs. In addition, the sensitivity of our displayed BmAChE for the representative OP pesticides (dimethoate, isocarbophos and trichlorphon) is much better than the housefly AChE [30]. For dichlorphos, the sensitivity of the displayed BmAChE was at the same level as with the Drosophila melanogaster AChE [31], but a little less than that of the Bombyx mandarina AChE [32]. Further experimental optimization of the P. pastoris displayed BmAChE enzyme is expected to meet or exceed the pesticide detection requirements and the displayed BmAChE enzyme will be used for routine monitoring of CB and OP pesticides.
Table 2

The median inhibition concentration (IC50) of displayed BmAChE for five CB and seven OP pesticides.

AnalytesDisplayed BmAChEExpressed housefly AChE [30] Expressed Drosophila melanogaster AChE [31] Expressed Bombyx mandarina AChE [32]
IC50 (M) IC50 (M) IC50 (M) IC50 (M)
Carbofuran1.92×10−9 1.85×10−3 1.02×10−6
Carbosulfan1.13×10−7
Isoprocarb1.11×10−8 7.50×10−7
Methiocarb6.58×10−8
Methomyl6.41×10−8 3.67×10−2 6.00×10−6
IC50 (M) IC50 (M) IC50 (M) IC50 (M)
Trichlorphon2.40×10−7 6.05×10−3
Dimethoate1.14×10−6 7.74×10−2
Methamidophos1.07×10−6
Isocarbophos9.10×10−7 7.10×10−2
Malathion1.41×10−6
Parathion1.13×10−6
Dichlorphos9.03×10−7 4.87×10−4 2.40×10−7
Analytical equipment-based methods typically used for the analysis of pesticides are not practicle enough to be used for simple, fast detection of large numbers of samples. Rapid assays using AChE-based methods have been proposed as an efficient and rapid method for the detection of pesticides, especially in many Asian markets [5]. Until now, most of the AChE enzymes used for the detection of pesticides have been extracted from fish and insect heads [33], [34], requiring much preparation time, resulting in high costs for enzyme purification. However, the yeast-display technology has provided an alternative means for engineering a low-cost AChE enzyme with desirable activity and the developed cells can be immobilized by chemical methods or with physical methods for development of whole-cell biosensors [35]. Also, the yeast expression system is capable of folding and glycosylating heterologous eukaryotic proteins [36], [37]. In particular, P. pastoris also has the advantage of high-density cultivation in inexpensive medium compared with other yeasts [38]. Therefore, the displayed AChE on the cell surface of P. pastoris potentially has many benefits and practical applications for pesticide detection. AChE has been most often used for the detection of pesticides because of its broad-substrate specificity. In this study the AChE gene from Bombyx mori was cloned from a constructed vector and a P. pastoris cell surface display system was developed for the first time. The surface-displayed BmAChE was evaluated with eserine, and with CB and OP pesticides. The results demonstrated that the displayed BmAChE was bioactive and highly sensitive to CB and OP pesticides. The recombinant BmAChE surface-display can be used for detection of pesticide residues in AChE-based screening methods. Nucleic acid sequence of the 2900 bp fragment. (PDF) Click here for additional data file.
  28 in total

1.  Surface display of active lipase in Pichia pastoris using Sed1 as an anchor protein.

Authors:  Guo-dong Su; Xi Zhang; Ying Lin
Journal:  Biotechnol Lett       Date:  2010-04-10       Impact factor: 2.461

2.  Production of a novel recombinant Drosophila melanogaster acetylcholinesterase for detection of organophosphate and carbamate insecticide residues.

Authors:  Songci Xu; Aibo Wu; Haode Chen; Yang Xie; Yuquan Xu; Lei Zhang; Jie Li; Dabing Zhang
Journal:  Biomol Eng       Date:  2006-12-22

3.  Microbial biosensors.

Authors:  Yu Lei; Wilfred Chen; Ashok Mulchandani
Journal:  Anal Chim Acta       Date:  2006-01-18       Impact factor: 6.558

4.  Transformation.

Authors:  J M Cregg; K A Russell
Journal:  Methods Mol Biol       Date:  1998

5.  Cell surface expression of a GPI-anchored form of mouse acetylcholinesterase in Klpmr1Delta cells of Kluyveromyces lactis.

Authors:  Daniela Uccelletti; Antonella De Jaco; Francesca Farina; Patrizia Mancini; Gabriella Augusti-Tocco; Stefano Biagioni; Claudio Palleschi
Journal:  Biochem Biophys Res Commun       Date:  2002-11-08       Impact factor: 3.575

6.  Cloning and characterization of acetylcholinesterase 1 genes from insecticide-resistant field populations of Liposcelis paeta Pearman (Psocoptera: Liposcelididae).

Authors:  Shuang Wu; Ming Li; Pei-An Tang; Gary W Felton; Jin-Jun Wang
Journal:  Insect Biochem Mol Biol       Date:  2010-04-10       Impact factor: 4.714

7.  Use of automated direct sample introduction with analyte protectants in the GC-MS analysis of pesticide residues.

Authors:  Tomás Cajka; Katerina Mastovská; Steven J Lehotay; Jana Hajslová
Journal:  J Sep Sci       Date:  2005-06       Impact factor: 3.645

Review 8.  Recent developments in yeast cell surface display toward extended applications in biotechnology.

Authors:  Tsutomu Tanaka; Ryosuke Yamada; Chiaki Ogino; Akihiko Kondo
Journal:  Appl Microbiol Biotechnol       Date:  2012-06-01       Impact factor: 4.813

9.  Cloning and expression of carp acetylcholinesterase gene in Pichia pastoris and characterization of the recombinant enzyme.

Authors:  Ryohei Sato; Toru Matsumoto; Norio Hidaka; Yasuko Imai; Katsumasa Abe; Shouji Takahashi; Ryo-Hei Yamada; Yoshio Kera
Journal:  Protein Expr Purif       Date:  2008-12-13       Impact factor: 1.650

10.  Purification and characterization of acetylcholinesterase from cotton aphid (Aphis gossypii Glover).

Authors:  Fei Li; Zhaojun Han
Journal:  Arch Insect Biochem Physiol       Date:  2002-09       Impact factor: 1.698

View more
  2 in total

1.  A mechanism-based 3D-QSAR approach for classification and prediction of acetylcholinesterase inhibitory potency of organophosphate and carbamate analogs.

Authors:  Sehan Lee; Mace G Barron
Journal:  J Comput Aided Mol Des       Date:  2016-04-07       Impact factor: 3.686

2.  Enhanced Secretory Expression and Surface Display Level of Bombyx mori Acetylcholinesterase 2 by Pichia pastoris Based on Codon Optimization Strategy for Pesticides Setection.

Authors:  Jiadong Li; Xi Xie; Jun Cai; Hong Wang; Jinyi Yang
Journal:  Appl Biochem Biotechnol       Date:  2021-06-23       Impact factor: 2.926

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.