The tremor rat is an autosomal recessive mutant exhibiting sterility with gonadal hypoplasia in both sexes. The causative mutation tremor (tm) is known as a genomic deletion spanning >200 kb in Chr 10q24. Spermatogenesis associated 22 (Spata22) has been shown to be a vertebrate-specific gene essential for the progression of meiosis through prophase I and completion of chromosome synapsis and meiotic recombination using a mouse repro42 mutant carrying an N-ethyl-N-nitrosourea (ENU)-induced nonsense mutation in Spata22. In this study, we show that Spata22 was identified as the gene responsible for the failure of gametogenesis to progress beyond meiosis I in tm homozygous rats by a transgenic rescue experiment. Meiosis was arrested during prophase I in the mutant testis. Precise mapping of the breakage point revealed that the deleted genomic region spanned approximately 240 kb and comprised at least 13 genes, including Spata22. Rat Spata22 was predominantly expressed in the testis, and its transcription increased with the first wave of spermatogenesis, as seen in the mouse ortholog. These results suggest that Spata22 may play an important role in meiotic prophase I in rats, as seen in mice, and that the tm homozygous rat may be useful for investigating the physiological function of Spata22, as an experimental system for clarifying the effect of a null mutation, and may be an animal model for studying the pathogenesis and treatment of infertility caused by impaired meiosis.
The tremorrat is an autosomal recessive mutant exhibiting sterility with gonadal hypoplasia in both sexes. The causative mutation tremor (tm) is known as a genomic deletion spanning >200 kb in Chr 10q24. Spermatogenesis associated 22 (Spata22) has been shown to be a vertebrate-specific gene essential for the progression of meiosis through prophase I and completion of chromosome synapsis and meiotic recombination using a mouse repro42 mutant carrying an N-ethyl-N-nitrosourea (ENU)-induced nonsense mutation in Spata22. In this study, we show that Spata22 was identified as the gene responsible for the failure of gametogenesis to progress beyond meiosis I in tm homozygous rats by a transgenic rescue experiment. Meiosis was arrested during prophase I in the mutant testis. Precise mapping of the breakage point revealed that the deleted genomic region spanned approximately 240 kb and comprised at least 13 genes, including Spata22. Rat Spata22 was predominantly expressed in the testis, and its transcription increased with the first wave of spermatogenesis, as seen in the mouse ortholog. These results suggest that Spata22 may play an important role in meiotic prophase I in rats, as seen in mice, and that the tm homozygous rat may be useful for investigating the physiological function of Spata22, as an experimental system for clarifying the effect of a null mutation, and may be an animal model for studying the pathogenesis and treatment of infertility caused by impaired meiosis.
Humaninfertility extends to 15% of couples, and 60% of idiopathic infertility cases in
males have a recessive autosomal cause [9, 16]. Genetically well-defined animal models are
considered to be useful not only for understanding the pathogenesis of infertility but also
for the development of treatments for it. At present, mice are widely used as animal models
for human diseases. However, considering the effect of species variation of suitability for
animal experiments and phenotypic differences due to species differences, it is desirable to
prepare animal models of various species.Meiosis is a developmentally programmed complex process that produces haploid germ cells
from diploid parental cells in reproducing eukaryotes [20]. In vivo experimental systems are indispensable for
investigating molecular mechanisms of vertebrate meiosis because of the lack of reproducible
in vitro experimental systems. Animals exhibiting meiotic defects caused
by gene mutations may be important tools not only for investigating molecular mechanisms
underlying meiosis but also for studying humaninfertility.Spermatogenesis associated 22 (SPATA22), formally known
as NYD-SP20, was originally cloned from human testes by comprehensive
expression analysis [24], and later, novel
alternative spliced forms were reported [11].
Recently, SPATA22 has been shown to be a candidate gene for humanoligospermia or aspermia [1] and identified as the
causative gene for an N-ethyl-N-nitrosourea (ENU)-induced
autosomal recessive mutation, repro42, in mice. This mouse model exhibits
arrest of meiosis at prophase I with abnormal chromosome synapsis and double-stranded DNA
break (DSB) repair in both sexes [15].
SPATA22 and the orthologs in mouse and rat encode 363-, 358- and
361-amino acid proteins, respectively. Confirmed or predicted SPATA22 protein sequences from
various vertebrates, including the human, chimpanzee, mouse, rat, dog, cattle, chicken, and
zebrafish, display evolutionarily conserved regions in their N- and C-termini [15]. SPATA22 comprises numerous putative functional sites
across the protein sequence, including phosphopeptide motifs interacting with the BRCT
domain of breast cancer 1, early onset (BRCA1), Polo-like kinase phosphorylation sites, and
phosphoinositide-3-OH kinase-related kinase (PIKK) phosphorylation motifs; however, it has
no significant homology with any other previously described proteins or functional domains
[4, 15].
Although the essential role of SPATA22 in the progression of meiosis I has
been revealed, its molecular function remains unknown.The mouse repro42 mutation is a single nucleotide substitution, resulting
in the appearance of a premature stop codon in the C-terminal conserved domain in the
deduced amino acid sequence of <span class="Gene">Spata22 [15]. The
deduced protein lacks the C-terminal 275−358-amino acid region. In testes of homozygous
mutant mice, the expression level of Spata22 mRNA is decreased, and the
Spata22 protein cannot be detected [15], suggesting
that repro42 is a loss-of-function mutation and that the resultant
phenotype is caused by the low level of expression and/or a structural defect in
Spata22.
The tremor (tm) mutation arose spontaneously in a colony
of Kyoto:Wistar rats in 1980 and was initially characterized for its recessive body tremor,
hair and whisker abnormalities, and infertility with dysgenesis of gonads in both sexes
[29]. A subsequent report indicated that
tm mutant males and females have recessive and semidominant absence-like
seizure and recessive spongiform degeneration in the central nervous system (CNS) [23]. The tremorrat had been established
as a segregating inbred strain by brother−sister inbreeding of tm
heterozygous rats. The tm mutation has been mapped to rat chromosome 10q24
and has been identified as a deletion spanning a >200-kb genomic region containing
aspartoacylase (Aspa), transient receptor
potential vanilloid 1 (Trpv1), and several genes encoding
olfactory receptors (ORs) [13]. According to the rat
genomic sequence (RGSC v3.4), the region deleted in the tm locus is
considered to comprise Spata22. In the present study, we found that
gametogenesis failed to progress beyond meiosis I in the tm homozygous rat,
and that meiosis was arrested during prophase I in the tm homozygous male
testis. We revealed that the deleted genomic region in the tm locus
comprised nearly 240 kb and harbored at least 13 genes, including Spata22.
We identified Spata22 as the causative gene of infertility and abnormal
meiosis in homozygous mutants by a transgenic rescue experiment. This is the first
description of meiotic failure caused by a null mutation of Spata22, and
the first report of infertility associated with meiotic failure caused by a naturally or
spontaneously occurring mutation of Spata22, including humaninfertility.
Materials and Methods
Animals
The tremorrat TRM/Kyo was supplied by the Institute of Laboratory
Animals, Graduate School of Medicine, Kyoto University (Kyoto, Japan), and maintained in
the Genome Dynamics Research Center at Hokkaido University. Heterozygous
(tm/+) females were mated with heterozygous (tm/+)
males to obtain the affected (tm/tm) and control
(+/+) rats used in this study. All the rats were maintained in a room
with controlled temperature and a 12-h light–dark cycle. Food and water were provided
ad libitum. All the animal experiments in this study were approved by
Institutional Animal Care and Use Committee, Hokkaido University.
Histological analysis
Testes were collected from three each of tm/tm and
wild-type rats and tm homozygous mutants carrying
<span class="Gene">Spata22 transgenes at 3 months after birth. Ovaries were collected from
two each of tm/tm and wild-type rats at 7 days after
birth. They were fixed using Bouin’s fixative solution, embedded in paraffin, cut into
5-µm-thick sections, and then stained with hematoxylin and eosin
(HE).
Chromosome analysis
The preparation of nuclei and chromosomes for light microscopy of spermatogenic cells
from two each of tm/tm and wild-type rats at 30 days
after birth and two tm homozygous mutants carrying
Spata22 transgenes at 3 months after birth was conducted using the
air-drying method [12], with the omission of
colchicine treatment. The preparations were stained with 4% Giemsa in phosphate buffer (pH
6.8).
Physical mapping
We conducted a homology search of the sequence of a breakage point (GenBank entry:
AB023434) in the mutant genome using the BLAST program (http://blast.ncbi.nlm.nih.gov).
PCR amplifications were performed with primer pairs for DNA fragments localized around
both ends of the deleted region. Sequences of six primer sets used in sequence-tagged site
(STS) analysis and map positions of their target DNA sequences on rat chromosome 10 (RGSC
v3.4) are as follows: brk1, CCCATCTCACCATCACCCCAACAGT and ACACCCCACTCTTGGAGCTGTTGAA
(60,098,543–60,098,723 bp); brk2, TTGTGCTGGGCTGGGTGCTATCTCT and TGCCGTGGGTATTAAATGAGAAGGA
(60,119,939–60,120,055 bp); brk3, GCTCTCACACTACAACAAG and GTAGTTGGAAAGGTCTCCC
(60,324,857–60,324,992 bp); brk4, TTGTAATAACAGGGATTGC and GCCCATTTACAAACCTCAG
(60,333,641–60,333,799 bp); brk5, ATTGGATAACCCAACCTGG and GGTCGTGGTCACCTAAACT
(60,345,158–60,345,336 bp); and brk6, GTTCCCACCATTTGCCTACGAATTT and
GCTCCACTATGTTCATCGCAGCCT (60,346,178–60,346,348 bp).
RT-PCR
Total RNA was extracted from various organs using TRIzol reagent (Invitrogen, Life
Technologies, Carlsbad, CA, USA), and first-strand cDNA was synthesized with oligo-dT
primers. The following primer sequences were used for PCR amplification:
<span class="Gene">Spo11, CCGAGGCCTCGTTCTTCGAC and TGTCCACCGCAGCCTGGTTC;
Spata22, TCAACTCGAAGTACAGCAGGCTGTT and GCCACCTTGGCTTCTTTTAGCGTTT;
Msh4, GCTGTGTACCATCTGGCTACA and CTCCTCAGTCTTCTCTGGAAGG; and
Gapdh, ACCACAGTCCATGCCATCAC and TCCACCACCCTGTTGCTGTA.
Generation of transgenic rats
Transgenic rats for rescue experiments were generated using the pCAGGS vector (provided
by J. Miyazaki). Full-length Spata22 cDNA was obtained by screening a rat
testis cDNA library (Takara Bio, Otsu, Shiga, Japan). Full-length Spata22
cDNA was inserted into the EcoRI site of the vector. The vector plasmid
was digested with SalI and HindIII, electrophoresed, and
then purified from agarose gel. Transgenic rats were generated by microinjection of the
transgenes into fertilized eggs from Wistar females mated with heterozygous
tm males. Two lines of transgenic rats (line 2, line 4) were obtained.
These transgenic lines were backcrossed to TRM/Kyo. Gross and histological examinations of
gonadal development were conducted mainly using line 2. Two each of 7-month-old homozygous
mutant males carrying the transgenes (tm/tm Tg/+) and
21-day-old homozygous mutant females carrying the transgenes
(tm/tm Tg/+) were used for gross examinations. Their
homozygous (tm/tm) and heterozygous
(tm/+) non-transgenic littermates were used as controls.
Accession number
Sequence data of a full-length rat Spata22 cDNA has been deposited in
DDBJ/EMBL/GenBank databases under accession number AB236891.
Results
Mutant gonads displayed arrest of meiosis I
Testis weights of mutants were markedly reduced; average testis weights (mean ± SD) were
391 ± 44 mg in three tm/tm adult males, 1,228 ± 254 mg
in three wild type adult males, and 1,395 ± 198 mg in three tm/+ adult
males. The average testis weight of the tm homozygous mutants was
significantly less than those of the wild types (t-test,
P<0.001) and the heterozygotes (t-test,
P<0.001). Average testis weights were not significantly different
between the wild types and the heterozygotes (t-test,
P>0.05). Average ratios (mean ± SD) of testis weight (mg) to body
weight (g) were 1.21 ± 0.15 in the homozygous mutants, 4.23 ± 1.08 in the wild-types, and
3.84 ± 0.39 in the heterozygotes. Pathological examination of the testes from adult mutant
males demonst<span class="Species">rated the accumulation of spermatocytes and depletion of spermatids and
spermatozoa, as shown in Figs. 1A, 1B, 1C,
and 1D. The ovaries from juvenile homozygous mutant females
(tm/tm) had depleted primordial follicles, with many
degenerated oocyte nuclei (Figs. 1E, 1F, 1G,
and 1H). Adult mutant females lacked
discernible ovarian structures (data not shown). These observations indicated the arrest
of meiosis I during gametogenesis in mutant gonads. Subsequent cytogenetic examination of
mutant meiosis was carried out using spermatogenic cells.
Fig. 1.
Abnormal gametogenesis in mutant rats. Upper panels, wild-type. Lower panels,
homozygous mutant. Hematoxylin and eosin (HE)-stained sections of seminiferous
tubules at 3 months after birth (A–D) and ovaries at 7 days after birth (E–H).
Accumulation of spermatocytes and depletion of spermatids and spermatozoa were
observed in adult homozygous mutants (C and D). Oocyte was depleted in juvenile
homozygous mutants (G and H). Arrows indicate degenerated nuclei. Scale bar: 100
µm in A, C, E, and G and 25 µm in B, D, F, and
H.
Abnormal gametogenesis in mutant rats. Upper panels, wild-type. Lower panels,
homozygous mutant. Hematoxylin and eosin (HE)-stained sections of seminiferous
tubules at 3 months after birth (A–D) and ovaries at 7 days after birth (E–H).
Accumulation of spermatocytes and depletion of spermatids and spermatozoa were
observed in adult homozygous mutants (C and D). Oocyte was depleted in juvenile
homozygous mutants (G and H). Arrows indicate degenerated nuclei. Scale bar: 100
µm in A, C, E, and G and 25 µm in B, D, F, and
H.
Mutant male meiosis failed to progress beyond early prophase I
To examine meiotic progression in mutants, we observed spreads of nuclei and chromosomes
of spermatocytes. In 30-day-old control testes, zygotene, late zygotene or early
pachytene, midpachytene, and metaphase I spermatocyte nuclei were observed (Fig. 2A). In 30-day-old homozygous mutant testes (tm/tm),
no normal nuclei that had progressed into midpachytene were observed, whereas nuclei that
had nucleus sizes and chromosome morphologies similar to those of control spermatocytes at
zygotene and late zygotene or early pachytene stages and many degenerated nuclei were
observed (Fig. 2B), indicating that meiosis
progressed into the zygotene stage and was arrested at the zygotene or pachytene stage in
mutants. This spermatogenesis phenotype, known as the “meiotic arrest” phenotype, is
similar to that of the repro42 homozygous mouse, which carries a nonsense
mutation in Spata22 [15], and has
been previously found in many types of sterile mutant mice and rats for genes related to
synaptonemal complex formation, meiotic homologous recombination repair, and regulation of
DNA damage checkpoint [2, 8, 10, 21].
Fig. 2.
Failure of meiotic progression during prophase I in the mutant testis. A:
Giemsa-stained preparation of testicular cell nuclei or chromosomes from 30-day-old
wild-type rats indicating the presence of spermatocytes at zygotene (Zy), late
zygotene or early pachytene (LZ/EP), midpachytene (MP), and metaphase I (MI) stages.
B: Giemsa-stained preparation of testicular cell nuclei or chromosomes from
30-day-old homozygous mutant rats showing the presence of spermatocyte nuclei
similar to control spermatocyte nuclei at zygotene (Zy) and late zygotene or early
pachytene (LZ/EP) stages. Many degenerated nuclei were observed (asterisks), whereas
no normal midpachytene nuclei were present. Scale bar: 50 µm.
Failure of meiotic progression during prophase I in the mutant testis. A:
Giemsa-stained preparation of testicular cell nuclei or chromosomes from 30-day-old
wild-type rats indicating the presence of spermatocytes at zygotene (Zy), late
zygotene or early pachytene (LZ/EP), midpachytene (MP), and metaphase I (MI) stages.
B: Giemsa-stained preparation of testicular cell nuclei or chromosomes from
30-day-old homozygous mutant rats showing the presence of spermatocyte nuclei
similar to control spermatocyte nuclei at zygotene (Zy) and late zygotene or early
pachytene (LZ/EP) stages. Many degenerated nuclei were observed (asterisks), whereas
no normal midpachytene nuclei were present. Scale bar: 50 µm.
The mutant genome lacked a nearly 240-kb genomic region that comprises at least 13
genes, including Spata22
To identify the gene responsible for the abnormal gametogenesis, we determined the
precise location of ends of the deleted region on rat chromosome 10 by searching for the
DNA fragment (AB023434) containing the tm breakage point using the BLAST
program. We verified these results by PCR analysis using STS markers around both ends of
the deleted region (Figs. 3A and 3B). The centromere-proximal end of the deleted region was mapped inside the 7th exon
of sedoheptulokinase (Shpk), and the centromere-distal
end was located within a LINE1 element downstream of Olr1472. Within the
determined 240-kb deleted region (60,098,741−60,339,238 bp, RGSC v3.4), entire transcribed
regions of 12 genes besides part of the 7th exon of Shpk were localized:
transient receptor potential vanilloid 1 and 3
(Trpv1/3); Aspa; the Spata22
ortholog; seven OR genes, Olr1466, Olr1467,
Olr1468, Olr1469, Olr1470,
Olr1471, and Olr1472; and one hypothetical gene,
LOC100359760 (Fig. 3A).
Fig. 3.
Positions of ends of the genomic deletion in the tm locus and
expression analysis of Spata22. A: Schematic diagram of the
tm critical region of rat chromosome 10 (RNO10) indicating
positions of the genomic deletion, Spata22, and other genes within
the deleted region. The breakage sites are mapped to sedoheptulokinase
(Shpk) and an L1 retrotransposon element in the large
cluster of olfactory receptor genes, respectively. The distance between the breakage
sites is approximately 240 kb. Arrows above gene names represent approximate gene
size and indicate the direction of transcription. Positions of STS markers
(brk1–brk6) used in PCR analysis are shown below the chromosome. Map positions in Mb
are shown above the chromosome. B: Comparison of PCR amplification of
sequence-tagged site (STS) markers between genomic DNA of control and homozygous
mutant rats demonstrating loss of PCR amplification of STS makers (brk2–brk4) within
the predicted deleted region in mutants. C: mRNA expression of
Spata22 and Gapdh in various organs of adult
controls and testes of adult homozygous mutants showing enhanced expression of
Spata22 in control testes. Weak expression was detected in other
organs when the number of PCR cycles was increased. D: mRNA expression of
Spata22, Spo11, Msh4, and
Gapdh in testes of wild-type rats between the ages of 4 and 37
days and in testes of adult wild-type rats. Spata22 expression
begins to increase between the ages of 8 days and 14 days, as shown for
Spo11 and Msh4.
Positions of ends of the genomic deletion in the tm locus and
expression analysis of Spata22. A: Schematic diagram of the
tm critical region of rat chromosome 10 (RNO10) indicating
positions of the genomic deletion, Spata22, and other genes within
the deleted region. The breakage sites are mapped to sedoheptulokinase
(Shpk) and an L1 retrotransposon element in the large
cluster of olfactory receptor genes, respectively. The distance between the breakage
sites is approximately 240 kb. Arrows above gene names represent approximate gene
size and indicate the direction of transcription. Positions of STS markers
(brk1–brk6) used in PCR analysis are shown below the chromosome. Map positions in Mb
are shown above the chromosome. B: Comparison of PCR amplification of
sequence-tagged site (STS) markers between genomic DNA of control and homozygous
mutant rats demonstrating loss of PCR amplification of STS makers (brk2–brk4) within
the predicted deleted region in mutants. C: mRNA expression of
Spata22 and Gapdh in various organs of adult
controls and testes of adult homozygous mutants showing enhanced expression of
Spata22 in control testes. Weak expression was detected in other
organs when the number of PCR cycles was increased. D: mRNA expression of
Spata22, Spo11, Msh4, and
Gapdh in testes of wild-type rats between the ages of 4 and 37
days and in testes of adult wild-type rats. Spata22 expression
begins to increase between the ages of 8 days and 14 days, as shown for
Spo11 and Msh4.
High expression of Spata22 that increased with the first meiotic wave
As shown in a previous gene expression analysis [15], RT-PCR analysis revealed that the Spata22 ortholog was
predominantly expressed in the testis tissue (Fig.
3C). The expression levels of mRNA and protein of Spata22 in
mouse testes began to increase with the first wave of spermatogenesis [15]. In laboratory rats, the first meiotic wave begins
at 13–14 days after birth [18]. RT-PCR analysis
indicated that ortholog expression began to increase between 8 and 14 days after birth, as
seen in two other meiosis-related genes, Spo11 [3, 22] and Msh4
[14] (Fig.
3D). These results suggest that rat Spata22 may be involved in
the regulation of meiosis I and that the function of this gene may be conserved between
the two rodent species: the rat and mouse.
Spata22 overexpression recovered the reproductive phenotype in homozygous
mutants
To verify that Spata22 underlies the mutant reproductive phenotype, we
performed transgenic rescue experiments with the minigene (Fig. 4A). All homozygous mutant rats (tm/tm) carrying the
transgenes at the fifth generation of backcross (=N5) were rescued from sterility: one
male and two females in one of the two transgenic lines (line 2) and one male in the other
transgenic line (line 4), although they were not rescued from the anomalies in hair,
whiskers (Figs. 4B and 4C), and the CNS or from body tremor (data not shown).
Spata22 overexpression induced no apparent changes in developmental,
morphological, and behavioral phenotypes in homozygous mutants, except for those in the
reproductive phenotype. Testes and ovaries of the transgenic rats showed normal
development upon gross examination (Figs. 4B
and 4C). Histological analysis consistently
showed that spermatogenesis proceeded normally in the rescued transgenic rats (Fig. 4D). Cytogenetic examination of meiotic
progression also confirmed that meiosis was recovered in homozygous mutant males carrying
the transgenes (Fig. 4E). These results indicate
that Spata22 is the causative gene for infertility and abnormal
gametogenesis in the homozygous mutant rat.
Fig. 4.
Recovery of spermatogenesis by transgenic rescue. A: Transgenic vector constructed
by insertion of full-length rat Spata22 cDNA into pCAGGS. B and C:
Gross examination of 7-month-old testis (B) and 21-day-old ovary (C) in mutants
carrying the transgenes. Upper panels: dorsal views of animals. Lower panels: gross
morphologies of gonads, oviducts, and uteri. In each panel, the genotypes of the
animals and the organs are as follows: tm/+ (left),
tm/tm (middle), and
tm/tm Tg/+ (right). The homozygous mutant testis
was small, and the homozygous mutant ovary could not be found despite the presence
of oviducts and uteri. The testis and the ovary of the
tm/tm Tg/+ rats appeared to develop normally,
whereas the wavy coat phenotype of the tm/tm Tg/+
rats was similar to that of the tm/tm littermates
in both sexes. Scale bar: 2 cm in upper panels, 1 cm in lower panels. D: Hematoxylin
and eosin (HE)-stained section of testes from adult homozygous mutants that carry
the transgenes, showing normal morphology of the seminiferous epithelium. Scale bar:
100 µm and 25 µm for the low- and
high-magnification images, respectively. E: Giemsa-stained preparation of testicular
cells, cell nuclei, or chromosomes from adult homozygous mutants carrying the
transgenes, showing normal progression of meiosis. Spermatocyte nuclei at
midpachytene and metaphase I stages and a spermatozoon head are indicated by MP, MI,
and Sp, respectively. Scale bar: 50 µm.
Recovery of spermatogenesis by transgenic rescue. A: Transgenic vector constructed
by insertion of full-length rat Spata22 cDNA into pCAGGS. B and C:
Gross examination of 7-month-old testis (B) and 21-day-old ovary (C) in mutants
carrying the transgenes. Upper panels: dorsal views of animals. Lower panels: gross
morphologies of gonads, oviducts, and uteri. In each panel, the genotypes of the
animals and the organs are as follows: tm/+ (left),
tm/tm (middle), and
tm/tm Tg/+ (right). The homozygous mutant testis
was small, and the homozygous mutant ovary could not be found despite the presence
of oviducts and uteri. The testis and the ovary of the
tm/tm Tg/+ rats appeared to develop normally,
whereas the wavy coat phenotype of the tm/tm Tg/+
rats was similar to that of the tm/tm littermates
in both sexes. Scale bar: 2 cm in upper panels, 1 cm in lower panels. D: Hematoxylin
and eosin (HE)-stained section of testes from adult homozygous mutants that carry
the transgenes, showing normal morphology of the seminiferous epithelium. Scale bar:
100 µm and 25 µm for the low- and
high-magnification images, respectively. E: Giemsa-stained preparation of testicular
cells, cell nuclei, or chromosomes from adult homozygous mutants carrying the
transgenes, showing normal progression of meiosis. Spermatocyte nuclei at
midpachytene and metaphase I stages and a spermatozoon head are indicated by MP, MI,
and Sp, respectively. Scale bar: 50 µm.
Discussion
In the present study, we have shown that infertility with abnormal gonadal development was
associated with the arrest of meiosis I in the tm homozygous rat. Meiotic
cell division was blocked during the zygotene or pachytene stage of prophase I in the
tm homozygous male rat, similar to the findings in mutant mice and rats
for genes related to chromosome synapsis, meiotic recombination, and cell cycle control
[2, 8, 10, 21] as well as
the repro42 homozygous mouse, which carries a nonsense mutation in
Spata22 [15]. Analysis of
progression of meiosis in the mutant ovary will be the subject of future study. We revealed
that an approximately 240-bp genomic region comprising at least 13 genes, including
Spata22, which is known to be a candidate gene for humanaspermia or
oligospermia and an essential gene for the progression of meiosis I, was lost in the
tm genome. Using a transgenic complementation test, we showed that
Spata22 is responsible for infertility and abnormal gametogenesis.A previous study on the repro42 mutant mouse has shown that testicular
weights of mutant males are markedly reduced; the average testis weight of
repro42 homozygous adults is approximately 20% of that of wild type
littermates [15]. Histological analysis of adult
repro42 mutant testes showed complete lack of spermatids and spermatozoa
despite presence of spermatogonia and spermatocytes [15]. Histological analysis of 10 dpp repro42 mutant ovaries
revealed an almost complete depletion of oocytes and presence of degenerating or degenerated
oocyte-containing follicles [15]. These findings are
quite similar to our present findings concerning the gonadal phenotype of
tm mutant rats. In most patients with Canavan disease, point mutations in
ASPA are causative [5]. Deletion
mutations comprising ASPA and adjacent genes, such as the
tm mutation, have been reported in a few cases [5, 27, 30], and gonadal phenotypes of Canavanpatients carrying such mutations
have not been reported. The similarity in gonadal phenotype between repro42
mutant mice and tm mutant rats suggests that genomic deletion involving
lack of SPATA22 in humans may induce gametogenic failure as seen in these
mutants.Concerning the 12 genes other than Spata22 in the deleted region, targeted
disruption of Trpv1, Trpv3, and Aspa has
no apparent effect on the reproductive system in mice [6, 19, 26], while Trpv3- and Aspa-deficientmice
exhibit an abnormal coat and skin [7] and spongiform
degeneration in the CNS [26], respectively. Whether
the loss of Shpk [28], seven OR
genes [25], and a function-unknown gene,
LOC100359760, affects the reproductive system has not been known.
Although the functions of the seven OR genes are unknown, olfactory receptors are known to
be responsible for the recognition and G protein-mediated transduction of odorant signals in
cells, such as olfactory receptor neurons and sperms [25]. Therefore, it is not likely that loss of the seven OR genes affects
spermatogenesis seriously. In this study, the transgenic rescue experiment showed that
deficiencies in Trpv1, Trpv3, and Aspa,
partial deletion of Shpk, loss of the other eight genes, and genomic
deletion at the tm locus per se had no apparent effect on
meiosis. These findings, taken together with a finding that the meiotic phenotype in the
tm homozygous rat is similar to a meiotic phenotype caused by only a
single nonsense mutation induced in Spata22 in the repro42
homozygous mouse [15], suggest that the deleted
genes, except for Spata22, may have no effect or minor effects on the
meiotic arrest phenotype caused by the loss of Spata22.As shown in a previous study on mouseSpata22 [15], the rat Spata22 ortholog was highly expressed in
the testis, and its expression level began to be enhanced in conjunction with the initiation
of meiosis. Together with the meiotic phenotype in the mutant rat, these results suggested
that, like mouseSpata22, rat Spata22 has an important
role in the regulation of meiotic prophase I [15].
Despite its importance in the progression of meiosis through prophase I, the molecular
function of Spata22 has been poorly understood. The
Spata22 allele of the tm genome is a null mutation
resulting from complete removal of the gene from the genome. Therefore, the
tremorrat (tm/tm) could contribute to
further functional analysis of Spata22, as a null mutant, in conjunction
with the transgenic rescued mutant.This is the first report of a deletion mutation of Spata22, which leads to
infertility and abnormal gametogenesis. However, in some patients with Canavan disease,
which is caused by ASPA deficiency, large genomic deletions involving loss
of several genes, including ASPA, were found at Chr 17p13 [5, 27, 30]. In two types of such deletions, approximately 190 kb
and 439 kb in size, SPATA22 is located in the deleted regions and seems
likely to be removed from the genome with ASPA, although the gonadal
phenotypes in the patients were not reported. The sequences around ends of the deleted
region in the tm genome have no significant homology with each other,
suggesting that the genomic loss may be caused by a nonhomologous recombination event, such
as a 190-kb-sized deletion in human Chr 17p13 [27].
The genomic region around the SPATA22 locus comprises no known chromosomal
fragile site [17]. Although it is unclear whether
these large genomic deletions found at nearly the same map position in Canavanpatients and
the tremorrat are caused by a common mechanism, similar deletions could
also occur in other mammalian species as well as humans and rats. Therefore, the
tremorrat could be a useful animal model for studying diseases resulting
from such deletions around the Spata22 locus.
Authors: Marco D'Aurora; Alberto Ferlin; Andrea Garolla; Sara Franchi; Laura D'Onofrio; Oriana Trubiani; Giandomenico Palka; Carlo Foresta; Liborio Stuppia; Valentina Gatta Journal: Sci Rep Date: 2017-03-31 Impact factor: 4.379