Literature DB >> 23826661

Comparative genome sequencing identifies a prophage-associated genomic island linked to host adaptation of Lawsonia intracellularis infections.

Fabio A Vannucci1, Molly R Kelley, Connie J Gebhart.   

Abstract

Lawsonia intracellularis is an obligate intracellular bacterium and the causative agent of proliferative enteropathy (PE). The disease is endemic in pigs, emerging in horses and has also been reported in a variety of other animal species, including nonhuman primates. Comparing the whole genome sequences of a homologous porcine L. intracellularis isolate cultivated for 10 and 60 passages in vitro, we identified a 18-kb prophage-associated genomic island in the passage 10 (pathogenic variant) that was lost in the passage 60 (non-pathogenic variant). This chromosomal island comprises 15 genes downstream from the prophage DLP12 integrase gene. The prevalence of this genetic element was evaluated in 12 other L. intracellularis isolates and in 53 infected animals and was found to be conserved in all porcine isolates cultivated for up to 20 passages and was lost in isolates cultivated for more than 40 passages. Furthermore, the prophage region was also present in 26 fecal samples derived from pigs clinically affected with both acute and chronic forms of the disease. Nevertheless, equine L. intracellularis isolates evaluated did not harbor this genomic island regardless of the passage in vitro. Additionally, fecal samples from 21 clinically affected horses and four wild rabbits trapped in horse farms experiencing PE outbreaks did not show this prophage-associated island. Although the presence of this prophage-associated island was not essential for a virulent L. intracellularis phenotype, this genetic element was porcine isolate-specific and potentially contributed to the ecological specialization of this organism for the swine host.

Entities:  

Mesh:

Year:  2013        PMID: 23826661      PMCID: PMC3716683          DOI: 10.1186/1297-9716-44-49

Source DB:  PubMed          Journal:  Vet Res        ISSN: 0928-4249            Impact factor:   3.683


Introduction

Lawsonia intracellularis is a gram-negative obligate intracellular bacterium and the etiologic agent of proliferative enteropathy (PE). The disease is characterized by thickening of the intestinal epithelium due to enterocyte proliferation which is directly associated with the presence of intracytoplasmic bacteria [1]. PE is endemic in pigs, an emerging disease in horses and is also described in various other species, including nonhuman primates, wild mammalians and ratite birds [2-4]. PE was first reported in 1931 [5], but the causative bacterium was isolated in 1991 from hamsters and in 1993 from pigs using cell culture under strict microaerophilic environmental conditions [6,7]. To date, growth of the bacteria in axenic (cell-free) media has not been reported. The fastidious properties related to the isolation and cultivation of L. intracellularis has limited molecular studies comparing bacterial isolates, so far, there are approximately 15 isolates worldwide. The whole genome of a porcine L. intracellularis isolate (PHE/MN1-00) has been sequenced and annotated (accession: PRJNA183) using Sanger-based sequencing and a total of 1 719 014 base pairs distributed into one small chromosome (1.46 Mb) and three plasmids. The presence of few potential virulence factor-encoding genes identifying by comparative sequence analysis and many hypothetical proteins suggest that this organism has adopted mechanisms of survival and pathogenesis that are unique among bacterial pathogens [1]. Non-pathogenic isolates obtained through multiple passages in cell culture have not been successful at inducing typical PE lesions or reversing virulence in experimentally-infected pigs [8]. Conversely, clinical and subclinical disease has been previously reproduced using cultivated L. intracellularis at low passages (4 to 20) in cell culture [9-12]. Vannucci et al. recently described attenuation of the virulence properties between 20 and 40 cell passages in vitro, but the molecular mechanisms responsible for this phenotype remain unclear [13]. The loss of pathophysiological properties of L. intracellularis associated with its adaptation to in vitro conditions due to mutational events at the DNA level has been speculated [13]. However, standard DNA-based typing techniques, such as pulsed field gel electrophoresis (PFGE), multilocus sequence typing (MLST) and variable number tandem repeat (VNTR) have shown identical genotypes in both pathogenic (low passage) and non-pathogenic (high passage) variants [14-16]. A more comprehensive genomic analysis of these two phenotypic variants is crucial to determine genomic variations which might potentially be associated with virulence properties. In addition, the characterization of genomic variations may reveal DNA sequence markers useful for studying genetic variations among clinical samples of L. intracellularis without requiring bacterial isolation. The present study used high-throughput DNA sequencing technology to compare and characterize genomic variations between homologous pathogenic (passage 10) and non-pathogenic (passage 60) L. intracellularis variants. The prevalence of a prophage-associated genomic island which was present in the pathogenic but not in the non-pathogenic variant was evaluated in porcine and equine isolates, as well as in fecal samples positive for the presence of L. intracellularis DNA derived from infected animals.

Materials and methods

L. intracellularis isolate and growth conditions

The porcine L. intracellularis isolate PHE/MN1-00 previously obtained from a pig with the hemorrhagic form of PE was used [10]. A previous study using experimentally-infected pigs confirmed the pathogenic and non-pathogenic properties of these two variants [13]. Murine fibroblast-like McCoy cells were grown in Dulbecco’s Modified Eagles Medium with 1% L-glutamine, 7% fetal bovine serum and 0.5% amphotericin B without antibiotics [17]. Pure culture of the bacteria at passage 6 (pathogenic variant) and 56 (non-pathogenic variant) was thawed and grown in McCoy cells (ATCC CRL 1696) for three continuous passages in order to allow the bacteria to recover from the frozen storage. T75 cell culture flasks containing one-day-old McCoy cells (30% confluence) were infected with bacterial suspensions containing approximately 104 L. intracellularis organisms. After a recovery period, pure cultures of L. intracellularis at passages 10 and 60 were prepared and used for DNA sequencing. Inoculated cultures were placed in an anaerobic chamber which was evacuated to 500 mmHg and refilled with hydrogen gas. Infected cultures were then incubated for seven days in a Tri-gas incubator with 83.2% nitrogen gas, 8.8% carbon dioxide, 8% oxygen gas and a temperature of 37°C, as previously described [6]. During each passage, the cell culture infection was monitored by counting the number of heavily infected cells (HIC) using immunoperoxidase staining with polyclonal antibody specific for L. intracellularis[18]. All procedures used in the present study were approved by the Institutional Sponsored Projects Administration of the University of Minnesota.

DNA preparation and genome sequencing

Bacterial cultures were prepared for extraction and sequencing using the supernatants of infected cell cultures in order to minimize the presence of eukaryotic DNA and enhance the purity of the bacterial suspension for DNA extraction. Briefly, cell culture supernatants were passed t through 0.8 μm sterile filters to remove potential detached McCoy cells present in the cell monolayer supernatant. Filtered bacterial suspensions were then pelleted by centrifugation at 8000 for 20 min. The pellets were used for DNA extraction using DNeasy Blood & Tissue Kit® (Qiagen, Valencia, CA, USA), according to the manufacturer’s instructions. The sequencing procedures were conducted through the core facility of the Biomedical Genomics Center at the University of Minnesota. Following quantification using the PicoGreen Assay of the DNA generated in the library preparation, the samples were loaded on the Illumina® Genome Analyzer GA IIx platform with paired reads of 76 bp. Base calling and quality filtering were performed following the manufacturer’s instructions (Illumina® GA Pipeline, San Diego, CA, USA).

Genome assembly and comparison

The sequence contigs were generated using Velvet assembly software [19] followed by alignment onto the reference genome using the Sequencer® 5.0 (Gene Codes Corporation, Ann Arbor, MI, USA). The assembly visualization was performed using Table software which allowed comparative genome analysis, evaluation of the genome coverage and the identification of single nucleotide substitutions (SNPs), insertions and deletions (indels) [20]. Based on the sequence visualization, manual annotation, manipulation and comparison were performed between both variants. Indels and SNPs previously identified in the comparative visualization analysis were confirmed by Sanger-based sequencing of directed PCR amplicons generated from the corresponding regions.

Prevalence of the prophage-associated genomic island L. intracellularis isolates

The presence of the prophage-associated genomic island identified by whole-genome sequencing in the pathogenic variant (passage 10) of the porcine L. intracellularis isolate PHE/MN1-00 but not in the non-pathogenic variant (passage 60) was evaluated in 12 other isolates from our collection at low and high passages (Table 1). Additionally, a total of 53 fecal samples submitted to the Minnesota Veterinary Diagnostic Laboratory from different states of the United States, which had previously tested positive for the presence of L. intracellularis DNA by PCR, were evaluated. The positivity of these samples was confirmed concurrently with the PCR analysis to determine the presence of the prophage genes. A total of 26 fecal samples were collected from naturally infected pigs in seven states (Iowa, Illinois, Minnesota, Missouri, Nebraska, Oklahoma and North Carolina), along with samples from 21 naturally infected horses from eight states (Florida, California, Iowa, Kentucky, Minnesota, Tennessee, Texas and Virginia) and four wild rabbits captured in a California horse breeding farm experiencing clinical cases of L. intracellularis infections.
Table 1

Summary of the isolates used in the study to evaluate the presence of the prophage-associated genomic island

Strain ID
Origin of the strains
Number of passage
Presence of prophage
 Host speciesCountry*  
PHE/MN1-00
Swine
USA
10
+
 
 
 
20
+
 
 
 
40
-
NWumn05
Swine
USA
20
+
 
 
 
40
-
VPB4
Swine
USA
10
+
 
 
 
>150
-
GBI06
Swine
USA
10
+
DBumn06
Swine
USA
10
+
D15540
Swine
DK
20
+
PHE-BR
Swine
BR
10
+
963/3
Swine
UK
80
-
916/91
Swine
UK
60
-
LR189/5/83
Swine
UK
90
-
Foal96
Equine
USA
> 100
-
E40504
Equine
USA
10
-
Ham1HamsterUSA> 100-

* USA, United States of America, DK, Denmark, BR, Brazil, UK, United Kingdom.

Summary of the isolates used in the study to evaluate the presence of the prophage-associated genomic island * USA, United States of America, DK, Denmark, BR, Brazil, UK, United Kingdom. Specific primers targeting all 15 genes included in the prophage-associated genomic island and the two flanking genes present immediately before and after the prophage region were designed (Table 2). DNA from fecal samples was extracted using QIAamp® DNA Stool Mini kit (Qiagen) and the protocol was performed according to the manufacturer’s instructions. PCR reactions were performed in a 25 μL volume using HotStar®Taq DNA polymerase (Qiagen) and 0.6 μM of each primer under the following conditions: 95°C for 15 min, 35 cycles (94°C/30 s, 52°C/60 s, 72°C/30 s) and final extension at 72°C for 10 min.
Table 2

Primers targeting the prophage-associated genomic island of porcine isolates and the two flanking genes

GeneGene productEntrez gene IDPrimers (5′ → 3′)
LI0172*
Hypothetical protein
4059866
ATTGATGCTCCTGTCCCACG
 
ACCACATGGTGGATTCGTCC
LI0173
Prophage DLP12 integrase
4059867
CGTCGTATTCTGCGCTTTGG
 
ATCATCAGCTACACGAGCGG
LI0174
Hypothetical protein
4059868
CAGGAAGATGCTGTGTGGCT
 
ATTCGCTTTCGCAATACGGC
LI0175
Hypothetical protein
4059869
CCCACGGACGAAGACTTTGA
 
TCAGCTTTCGGGCATGGATT
LI0176
Hypothetical protein
4059870
ACAGACCTCTATGCTCCCGT
 
TCAGCGTCTTGGGGCTTTAG
LI0177
Hypothetical protein
4059871
ACACCACCATTACCACTGCT
 
ACACCACCATTACCACTGCT
LI0178
Hypothetical protein
4059872
TTCCTCCTGCGTGTCGTAAC
 
ATTTCTCCCTGGCTCTGCAC
LI0179
Ribosomal protection tetracycline resistance protein
4059813
CGTCAGCAAAGCGGAAACAA
 
AAACGGCCTTGGCATTCAAC
LI0180
Hypothetical protein
4059873
GAACCGGTGAGCCAAGTGTA
 
TTCCTTCGGGAGTCGAGGAT
LI0181
Endonuclease I
4059874
AGGCTAAGCGCATACTGCAA
 
CAGCATTGACAGACCCGACT
LI0182
Recombination protein-phage associated
4059875
TGGATTTCCAGCACAGCCAT
 
TGAACCGTCCTGAAGCTCAC
LI0183
Hypothetical protein
4060170
CTCTCGACGCATCTTCCCTC
 
TCCATTCCGCCGTCATGAAA
LI0184
Hypothetical protein
4060171
TTGGACTGGCTCTTACGCAG
 
GATGAAGCCCACGTCAGGAA
LI0185
MoxR-like ATPases
4060172
GTCATGCGTCAGAACATCGC
 
CCTGTTTGGAGAGAGGCTGG
LI0186
Hypothetical protein
4060173
CCTTCCTGGGCCAACATCAT
 
CACGCTTGGGCATATTTCCG
LI0187
Hypothetical protein
4060174
ATCGGTTCTTCGGATACCGC
 
GAATCCTGCGTAGATCGGCA
LI0188*
ATP-dependent Zn proteases (ftsH)
4059755
GAGCTGTAGCTGGTGAAGCA
   ACGTGCAACAAGTGCATGTC

* Flanking genes located before and after the prophage-associated genomic island.

Primers targeting the prophage-associated genomic island of porcine isolates and the two flanking genes * Flanking genes located before and after the prophage-associated genomic island.

Results

Genome comparison between porcine L. intracellularis isolate (PHE/MN1-00) at low and high passages

The present study resequenced the isolate PHE/MN1-00 which was used to generate the reference genome of L. intracellularis available at the National Center for Biotechnology Information (NCBI accession: PRJNA61575) using Sanger-based sequencing. Although there is no information available regarding the number of passages in vitro used in this first sequencing project, our results showed identical DNA contents using the passage 10. This strongly indicates that the first genome project used low passage-cultivated bacteria. The whole genome sequencing generated 83 999 466 and 128 258 573 millions of bp for L. intracellularis cultivated at 10 and 60 passages in vitro, respectively. For the passage 10, the average coverage of 42X was assembled with mean contig length of 11 845 bp (minimum: 2175 and maximum: 112 744) and 14.1% of unused data which represented eukaryotic-derived DNA. The data from the passage 60 (NCBI accession: PRJNA61575) generated an average coverage of 66X assembled with mean contig length of 10 674 bp (minimum: 1189 and maximum: 119 534) and 11.3% of eukaryotic -derived DNA. The comparative analysis between homologous pathogenic (passage 10) and non-pathogenic (passage 60) L. intracellularis variants reveals a major deletion of 18,086 base pairs (bp) in the passage 60 which includes 15 genes starting from the prophage DLP12 integrase gene (LI0173). General features of the genome comparison are summarized in Table 3. In addition to the prophage region, only four single nucleotide polymorphisms (SNPs) were identified in the chromosome and one in the plasmid C of the passage 60 variant (Table 4). DNA sequences from plasmids A and B were identical in both the passage 10 and 60 variants.
Table 3

General characteristics of the two homologous variants

L. intracellularis PHE/MN1-00Passage 10Passage 60
Chromosome size
1 457 619
1 439 533
G° + °C content (%)
33.3
33.1
Total number of protein-coding genes
1183
1168
Prophage element
1 (18.1 Kb)
0
Plasmids
3
3
Variant-specific genes150
Table 4

Single nucleotide substitutions in passage 10 and passage 60 of the porcine isolate PHE/MN1-00

Gene locus (Position)
Description
Amino acid change
Substitution
  Passage 10Passage 60 
Chromosome
 
 
 
 
LI0064 (86 203)
Transcriptional regulator
Glutamic acid
Lysine
Non-synonymous
(GAA)
(AAA)
LI0473 (577°207)
DNA methylase
Lysine
Glutamic acid
Non-synonymous
(AAA)
(GAA)
LI0532-LI0533 (651°651)
Intergenic region
 
 
 
LI0905 (1°129°621)
DNA-directed RNA polymerase
Lysine
Glutamic acid
Non-synonymous
(AAG)
(GAG)
Plasmid C
 
 
 
 
LIC103 (190°854)
Methyl-accepting chemotaxis
Cysteine
Cysteine
Synonymous
  (TGC)(TGT) 

Bold underline letters: Single nucleotide substitution from passage 10 to passage 60.

General characteristics of the two homologous variants Single nucleotide substitutions in passage 10 and passage 60 of the porcine isolate PHE/MN1-00 Bold underline letters: Single nucleotide substitution from passage 10 to passage 60.

Characterization of the L. intracellularis prophage-associated genomic island

A prophage-associated genomic island located in the chromosome represented the major genomic deletion identified in the porcine L. intracellularis isolate PHE/MN1-00 at passage 60. This deletion is located at the position 218 578 to 236 664 and comprises 15 genes starting from the prophage DLP12 integrase gene (Figure 1). Besides this prophage integrase, four more genes with known function have been annotated within the region: ribosomal protection tetracycline resistance protein (LI0179); endonuclease (LI0181); recombination protein-phage associated (LI0182) and MoxR-like ATPases (LI0185). The other ten genes were predicted to encode hypothetical proteins. Sequence analyses of these genes using the Kyoto Encyclopedia of Genes and Genomes (KEGG) database reveals the presence of six motif sequences: three proteins (LI0177, LI0184 and LI0186) with unknown functions but previously reported in other bacterial organisms; ferric reductase NAD binding domain (LI0174); RNA polymerase III subunit RPC82 helix-turn-helix domain (LI0175) and cobalamin biosynthesis protein CobT (LI0187).
Figure 1

Prophage DLP12-associated genomic island. (A) Chromosome map of the porcine L. intracellularis isolate PHE/MN1-00 at passage 10 showing the genomic location of the prophage element. (B) Genetic organization of the prophage region (from prophage DLP12 integrase to LI0187 gene). Loci between LI0172 and ftsH gene from where the prophage excised and is no longer present in the equine and rabbit-derived isolates and in the porcine L. intracellularis isolate PHE/MN1-00 at passage 60.

Prophage DLP12-associated genomic island. (A) Chromosome map of the porcine L. intracellularis isolate PHE/MN1-00 at passage 10 showing the genomic location of the prophage element. (B) Genetic organization of the prophage region (from prophage DLP12 integrase to LI0187 gene). Loci between LI0172 and ftsH gene from where the prophage excised and is no longer present in the equine and rabbit-derived isolates and in the porcine L. intracellularis isolate PHE/MN1-00 at passage 60. The presence of all 15 genes included in the prophage-associated genomic island was confirmed by PCR and Sanger-based sequencing (Figure 2A). The loss of this genomic island in the passage 60 was confirmed by the absence of amplified products from all 15 genes and the presence of the amplified product targeting the flanking regions immediately before and after the prophage region (Figure 2B). The prevalence of the prophage-associated island in L. intracellularis isolates and infected animals was evaluated based on the PCR panel targeting all 15 genes within the genomic region described in Figure 2. In those bacterial isolates or infected animals that harbor this genomic island all 15 genes were found. Its absence was represented by an absence of the entire region. This observation characterizes the chromosomal island as a mobile genetic element.
Figure 2

PCR detection of the prophage DLP12-associated genomic island. (A) PCR panel for detection of all 15 genes included in the prophage region and the two flanking genes. Porcine L. intracellularis isolate PHE/MN1-00 at passage 10 showing the presence of all prophage-associated genes (above). Loss of the prophage element at passage 60 showing the presence of flanking genes (below). (B) Absence of the entire prophage-associated island confirmed in the porcine isolate PHE/MN1-00 at passage 60 and infected horse and rabbit isolates by obtaining PCR products from the amplification of a primer pair targeting the regions immediately before and after the prophage region (forward: 5′-TCGTGAGAAACTTGTATCAATCCA-3′ and reverse: 5′-TGACAATGTTAGAGCAATGACTTTTTA3-3′).

PCR detection of the prophage DLP12-associated genomic island. (A) PCR panel for detection of all 15 genes included in the prophage region and the two flanking genes. Porcine L. intracellularis isolate PHE/MN1-00 at passage 10 showing the presence of all prophage-associated genes (above). Loss of the prophage element at passage 60 showing the presence of flanking genes (below). (B) Absence of the entire prophage-associated island confirmed in the porcine isolate PHE/MN1-00 at passage 60 and infected horse and rabbit isolates by obtaining PCR products from the amplification of a primer pair targeting the regions immediately before and after the prophage region (forward: 5′-TCGTGAGAAACTTGTATCAATCCA-3′ and reverse: 5′-TGACAATGTTAGAGCAATGACTTTTTA3-3′).

Prevalence of the prophage-associated genomic island in L. intracellularis isolates

The presence of the prophage-associated genomic island was evaluated in a total of 13 L. intracellularis isolates, ten from pigs, two from horses and one from a hamster (Table 1). Regardless of the origin of the bacterial isolate (North America, South America or Europe), porcine isolates at low passages in vitro (up to 20) show the presence of the prophage-associated island. However, this genetic element was entirely lost in all porcine isolates passed more than 40 times in cell culture (Table 1). A distinct scenario was observed in the two equine isolates (low and high passage) which do not harbor this genomic island regardless of the number of passages in vitro. Although the pathogenicity of the equine isolate at low passage (E40504) has been demonstrated in previous studies [21,22], the prophage island was not found even in lower passages (four, six and eight) of this isolate (data not shown).

Prevalence of the prophage-associated genomic island in infected animals

A total of 26 porcine samples that previously tested positive for the presence of L. intracellularis DNA in the feces were evaluated, derived from seven states of the United States (Iowa, Illinois, Minnesota, Missouri, Nebraska, Oklahoma and North Carolina). Twenty-two samples were derived from pigs affected with the chronic form of PE and four from pigs affected with the acute form of the disease, known as proliferative hemorrhagic enteropathy (PHE). Regardless of the clinical presentation of the disease or the state of origin, all the porcine-derived samples consistently exhibited the prophage-associated island characterized by the presence of all 15 genes within the chromosomal region. Twenty-one horse samples that were positive for L. intracellularis by fecal PCR from eight states (Florida, California, Iowa, Kentucky, Minnesota, Tennessee, Texas and Virginia) were evaluated. None of the genomic island genes were present in any equine-derived samples, confirming the observations from the two equine isolates previously described in this study. The absence of the prophage island also was observed in samples obtained from four wild rabbits captured in a horse breeding farm experiencing clinical cases of PE.

Discussion

Comparing the whole genome sequences of a porcine L. intracellularis isolate cultivated for 10 and 60 passages in vitro, we identified the loss of a prophage-associated genomic island in the passage 60. This chromosomal deletion comprises a total of 15 genes (18 086 bp) starting in the defective prophage DLP12 (a defective lambdoid prophage at the 12th minute of the chromosome) previously described in E. coli[23]. The full length of the prophage DLP12 in E. coli K-12 contains 22 genes included in a region of 21 302 bp [24]. From an evolutionary perspective, this evidence suggests that the element was partially acquired by L. intracellularis or underwent a partial deletion once integrated into the L. intracellularis genome. While DLP12 genes in E. coli encoding a two-component lysis cassette (holing-endolysin) are responsible for inducing lysis of the host bacterial cell, this cassette was not found in the prophage DLP12-associated island of L. intracellularis. As a result, this defective prophage integrated into L. intracellularis may have lost a function essential for lytic growth and can no longer liberate infectious particles. Although the impact of the prophage DLP12 in cell physiology and virulence remains unclear, studies have associated the presence of this integrated prophage with resistance to environmental stress and biofilm formation [24,25]. Rhodius et al. showed activation of DLP12 genes mediated by the transcription regulatory factor σE during the stress response [26]. A recent study demonstrated the role of the DLP12 genes in maintenance of the bacterial cell wall and in biofilm development by curli-producing E. coli[25]. To date, no information has been presented regarding the ability of L. intracellularis to produce biofilm. However, empiric observations of recurrent clinical infections in certain swine production systems may support future investigations regarding biofilm production, based on the potential persistence of L. intracellularis in swine installations and/or fomites. Previous studies did not identify expression of the 15 genes included in the prophage-associated island by L. intracellularis in the host cytoplasm in vitro or in vivo [27,28]. Therefore, similar to curli-producing E. coli, the expression of the DLP12 genes in L. intracellularis is likely to occur during the stationary phase of the extracellular life cycle. The authors identified the persistence of the prophage DLP12-associated element for at least 20 passages in vitro in two porcine isolates and its loss after 40 passages in cell monolayer (Table 1). The low excision frequency reported for this prophage in E. coli K-12 (<1 per 100 000 cells) may explain the gradual loss of this genetic element during L. intracellularis cultivation in cell monolayer [24]. During the cultivation of L. intracellularis in vitro the infection is passed weekly [6], which gives the prophage DLP12 a stability of at least 20 weeks. The excision rate of integrated phages is directly related to the adverse conditions encountered by the host bacterial cells followed by the induction of SOS response in the bacteria and conversion of the phage from its lysogenic to lytic form [29]. However, prophage DLP12 in E. coli lost the ability to excise and form phage particles on SOS response challenge [24]. This defective prophage may now suffer the same fate as its host. The beneficial impact of defective prophages on cell physiology includes enhancing nutrient utilization and increasing the host’s tolerance to general environmental stress and antibiotics. Therefore, the loss of this element does not compromise essential host physiological functions and it becomes dispensable under standard culturing conditions [24]. Additionally, the role of the DLP12 genes in cell wall maintenance and composition suggests an important means for bacteria to improve their fitness. It has been theorized that introduction of novel genes by phages can confer beneficial phenotypes that allow the exploitation of competitive environments [30]. A gene encoding ribosomal protection protein associated with tetracycline resistance was found in this prophage-associated island. Although the wide use of antimicrobials in the swine industry over the years has been speculated to select resistant and/or virulent bacterial strains [31,32], the phenotypic consequence of this tetracycline resistance gene in L. intracellularis infections is unclear. Wattanaphansak et al. evaluated the antimicrobial activity in vitro of chlortetracycline against ten porcine L. intracellularis isolates which originated from North America and Europe [33]. Regardless of the geographical origin and the number of passages in culture, which ranged from 7 to 170, the authors found a large variation among these bacterial isolates in regard to their susceptibilities to chlortetracycline [33]. Though resistance to chlortetracycline in low passages could be due to the presence of the tetracycline resistance gene in the prophage island, low passage isolates tested in that study did not consistently demonstrate resistance to chlortetracycline. This study also showed a higher antimicrobial activity of chlortetracycline against intracellular L. intracellularis compared with extracellular organisms. Associating this information with the lack of expression of this tetracycline resistance gene by Lawsonia, especially by intracellular organisms, and the properties of DLP12 prophage to cope with environmental stress (previously discussed), it is possible that this gene may be expressed extracellularly and contribute to a higher antimicrobial tolerance during the extracellular stage. However, this hypothesis needs to be specifically addressed in a future study. Despite the limited number of L. intracellularis isolates available worldwide, our results showed the presence of the entire prophage region in ten porcine isolates at low passage in vitro indicating the consistent adaptation and specificity of this genomic island to porcine-derived isolates, regardless of the clinical form (acute or chronic) of the disease. The absence of this genomic island in the equine isolate at low passage reveals an important genomic variation related to species-specificity of L. intracellularis isolates. The availability of only one hamster isolate that has been cultivated over 100 times in vitro restricts a more confident conclusion regarding the prevalence of the prophage in this species. Nevertheless, this is the first study describing a significant genomic variation among L. intracellularis isolates, since to date L. intracellularis has been considered a monotypic organism [34]. In addition to the porcine isolates, the presence of the prophage DLP12-associated genomic island was confirmed in fecal samples from PE-affected pigs and its absence confirmed in horses and rabbits infected with L. intracellularis. Despite the fact that the loss of this genetic element was coincident with the loss of virulent phenotype in one porcine isolate (PHE/MN1-00) [13], the consistent lack of this island in infected horses shows that this prophage-associated island is not essential for virulence in L. intracellularis infections. However, our results show that this genomic region is indeed associated with host-adapted L. intracellularis variants. Supporting the genotypic variation among the species origin of the bacterial isolate described here, a previous study phenotypically demonstrated the host adaptation of L. intracellularis in pigs and horses [35]. In a cross-species experimental model using pure culture of L. intracellularis at low passages, pigs and foals infected with their species-specific isolates shed the bacterium in the feces for longer periods of time and exhibited stronger serologic immune responses compared with foals infected with the porcine isolate and pigs infected with the equine isolate. While the porcine isolate in the referred study harbors the prophage, the equine isolate does not have this genetic element. This evidence of host adaptation in pigs and horses seems to extend to experimental infection models using hamsters and rabbits [36]. Sampieri et al. showed that rabbits are more susceptible to equine-derived isolates than to porcine variants and hamsters more susceptible to porcine-derived isolates than to equine variants [36]. These results suggest that L. intracellularis variants evolved to be adapted to more than one host species. The evolutionary ecology responsible for driving host-adapted variants remains to be determined. Although our study failed to specifically associate the prophage DLP12 genomic region with virulent phenotype, we hypothesize that this genetic element contributes to the adaptation of L. intracellularis in the porcine host. Based on evidence showing the role of this defective prophage in helping E. coli cope with adverse environment and form biofilms, this genetic element may drive an ecological specialization in pig-adapted L. intracellularis variants. In a future perspective, the whole genome sequencing of horse isolates could allow a more comprehensive conclusion regarding the genetic traits related to the host-adapted L. intracellularis variants. Recently, the analysis of whole genome sequences of Staphylococcus aureus ST398 strains derived from livestock and humans showed the presence of the prophage φ3 in human but not animal-derived isolates [37]. The authors suggest that these differences at the genome level are able to drive host-specific adaptation in the ST398 strains. Additionally, the prophage φ3 seems to be lost after jumping from humans to livestock. In summary, the present study showed a prophage-associated genomic island present specifically in pathogenic porcine L. intracellularis isolates. The identification of this genetic element may be applied as a molecular marker to determine the species origin of the bacterial isolates and to trace the evolutionary history related to the host species in L. intracellularis infections. Finally, this first study showing significant genomic variation in L. intracellularis isolates associated with the previously reported host-adapted phenotype may support the characterization of novel L. intracellularis subspecies or species-specific genotypes.

Competing interests

The authors declare they have no competing interests.

Authors’ contributions

Conceived and designed the experiments: FAV, MRK, CJG. Performed the experiments and analyzed the data: FAV, MRK, CJG. Wrote the paper: FAV, MRK. Coordinated and helped to draft the manuscript: CJG. All authors read and approved the final manuscript.
  32 in total

1.  Validation of an immunoperoxidase monolayer assay as a serologic test for porcine proliferative enteropathy.

Authors:  Roberto M C Guedes; Connie J Gebhart; John Deen; Nathan L Winkelman
Journal:  J Vet Diagn Invest       Date:  2002-11       Impact factor: 1.279

2.  Velvet: algorithms for de novo short read assembly using de Bruijn graphs.

Authors:  Daniel R Zerbino; Ewan Birney
Journal:  Genome Res       Date:  2008-03-18       Impact factor: 9.043

3.  Isolation of an intracellular bacterium from hamsters (Mesocricetus auratus) with proliferative ileitis and reproduction of the disease with a pure culture.

Authors:  H F Stills
Journal:  Infect Immun       Date:  1991-09       Impact factor: 3.441

Review 4.  Prophage genomics.

Authors:  Carlos Canchaya; Caroline Proux; Ghislain Fournous; Anne Bruttin; Harald Brüssow
Journal:  Microbiol Mol Biol Rev       Date:  2003-06       Impact factor: 11.056

5.  Role of DLP12 lysis genes in Escherichia coli biofilm formation.

Authors:  Faustino A Toba; Mitchell G Thompson; Bryan R Campbell; Lauren M Junker; Karl-Gustav Rueggeberg; Anthony G Hay
Journal:  Microbiology (Reading)       Date:  2011-03-17       Impact factor: 2.777

Review 6.  Proliferative enteropathy: a global enteric disease of pigs caused by Lawsonia intracellularis.

Authors:  Jeremy J Kroll; Michael B Roof; Lorraine J Hoffman; James S Dickson; D L Hank Harris
Journal:  Anim Health Res Rev       Date:  2005-12       Impact factor: 2.615

7.  Tablet--next generation sequence assembly visualization.

Authors:  Iain Milne; Micha Bayer; Linda Cardle; Paul Shaw; Gordon Stephen; Frank Wright; David Marshall
Journal:  Bioinformatics       Date:  2009-12-04       Impact factor: 6.937

8.  Cryptic prophages help bacteria cope with adverse environments.

Authors:  Xiaoxue Wang; Younghoon Kim; Qun Ma; Seok Hoon Hong; Karina Pokusaeva; Joseph M Sturino; Thomas K Wood
Journal:  Nat Commun       Date:  2010       Impact factor: 14.919

9.  Identification of a highly transmissible animal-independent Staphylococcus aureus ST398 clone with distinct genomic and cell adhesion properties.

Authors:  Anne-Catrin Uhlemann; Stephen F Porcella; Sheetal Trivedi; Sean B Sullivan; Cory Hafer; Adam D Kennedy; Kent D Barbian; Alex J McCarthy; Craig Street; David L Hirschberg; W Ian Lipkin; Jodi A Lindsay; Frank R DeLeo; Franklin D Lowy
Journal:  mBio       Date:  2012-02-28       Impact factor: 7.867

10.  Conserved and variable functions of the sigmaE stress response in related genomes.

Authors:  Virgil A Rhodius; Won Chul Suh; Gen Nonaka; Joyce West; Carol A Gross
Journal:  PLoS Biol       Date:  2006-01       Impact factor: 8.029

View more
  7 in total

1.  Comparative analysis of prophage-like elements in Helicobacter sp. genomes.

Authors:  Xiangyu Fan; Yumei Li; Rong He; Qiang Li; Wenxing He
Journal:  PeerJ       Date:  2016-05-05       Impact factor: 2.984

2.  Draft Genome Sequence of Lawsonia intracellularis Strain E40504, Isolated from a Horse Diagnosed with Equine Proliferative Enteropathy.

Authors:  Nandita S Mirajkar; Molly R Kelley; Connie J Gebhart
Journal:  Genome Announc       Date:  2017-05-11

Review 3.  Lawsonia intracellularis: Revisiting the Disease Ecology and Control of This Fastidious Pathogen in Pigs.

Authors:  Anbu K Karuppannan; Tanja Opriessnig
Journal:  Front Vet Sci       Date:  2018-08-09

4.  Draft Genome Sequences of Lawsonia intracellularis Swine Strains Causing Proliferative Enteropathy in Japan.

Authors:  Sayaka Nishikawa; Yohsuke Ogawa; Masahiro Eguchi; Anura Rambukkana; Yoshihiro Shimoji
Journal:  Microbiol Resour Announc       Date:  2018-09-06

5.  Novel Moraxella catarrhalis prophages display hyperconserved non-structural genes despite their genomic diversity.

Authors:  Amir Ariff; Michael J Wise; Charlene M Kahler; Chin Yen Tay; Fanny Peters; Timothy T Perkins; Barbara J Chang
Journal:  BMC Genomics       Date:  2015-10-24       Impact factor: 3.969

6.  Metagenomic sequencing of clinical samples reveals a single widespread clone of Lawsonia intracellularis responsible for porcine proliferative enteropathy.

Authors:  Rebecca J Bengtsson; Bryan A Wee; Gonzalo Yebra; Rodrigo Bacigalupe; Eleanor Watson; Roberto M C Guedes; Magdalena Jacobson; Tomasz Stadejek; Alan L Archibald; J Ross Fitzgerald; Tahar Ait-Ali
Journal:  Microb Genom       Date:  2020-04-02

Review 7.  Lawsonia intracellularis infection and proliferative enteropathy in foals.

Authors:  Nicola Pusterla; Connie Gebhart
Journal:  Vet Microbiol       Date:  2013-07-06       Impact factor: 3.293

  7 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.