Literature DB >> 23826240

In intact islets interstitial GABA activates GABA(A) receptors that generate tonic currents in α-cells.

Yang Jin1, Sergiy V Korol, Zhe Jin, Sebastian Barg, Bryndis Birnir.   

Abstract

In the rat islets γ-aminobutyric acid (GABA) is produced by the β-cells and, at least, the α-cells express the GABA(A) receptors (GABA(A) channels). In this study, we examined in intact islets if the interstitial GABA activated the GABA(A) receptors. We used the patch-clamp technique to record whole-cell and single-channel currents and single-cell RT-PCR to identify the cell-type we recorded from, in the intact rat islets. We further identified which GABA(A) receptor subunits were expressed. We determined the cell-type of 43 cells we recorded from and of these 49%, 28% and 7% were α, β and δ-cells, respectively. In the remaining 16% of the cells, mRNA transcripts of more than one hormone gene were detected. The results show that in rat islets interstitial GABA activates tonic current in the α-cells but not in the β-cells. Seventeen different GABA(A) receptor subunits are expressed with high expression of α1, α2, α4, α6, β3, γ1, δ, ρ1, ρ2 and ρ3 subunits whereas no expression was detected for α5 or ε subunits. The abundance of the GABA(A) receptor subunits detected suggests that a number of GABA(A) receptor subtypes are formed in the islets. The single-channel and tonic currents were enhanced by pentobarbital and inhibited by the GABA(A) receptor antagonist SR-95531. The single-channel conductance ranged from 24 to 105 pS. Whether the single-channel conductance is related to subtypes of the GABA(A) receptor or variable interstitial GABA concentrations remains to be determined. Our results reveal that GABA is an extracellular signaling molecule in rat pancreatic islets and reaches concentration levels that activate GABA(A) receptors on the glucagon-releasing α-cells.

Entities:  

Mesh:

Substances:

Year:  2013        PMID: 23826240      PMCID: PMC3691163          DOI: 10.1371/journal.pone.0067228

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

The pancreatic islets consist of four major cell types: the glucagon-secreting α-cells, the insulin-secreting β-cells, the somatostatin-secreting δ-cells and the polypeptide-producing PP-cells. In addition to the hormones, the cells release small molecules that may act in an auto or paracrine manner [1], [2]. Gamma-aminobutyric acid (GABA) is an extracellular signal molecule in the islets [3], [4], [5], [6]. GABA is formed by the enzyme glutamate decarboxylase (GAD) which catalyses the formation of GABA from glutamate and is located both in the cytoplasm and in synaptic-like vesicles [7], [8], [9], [10], [11]. Once released, GABA is thought to act in an auto and paracrine manner on the islet cells to modulate hormone secretion [6], [12], [13], [14], [15], [16], [17]. GABA activates ionotropic GABAA and metabotropic GABAB receptors in the plasma membrane of the islet cells [6], [14], [18]. In the rat islet, only the α-cells express the GABAA receptors (GABAA channels) [19], whereas in human pancreatic islets, the α, β and δ-cells all have GABAA receptors [12], [17]. There are many subtypes of GABAA receptors whereas only one GABAB receptor has been described so far [20]. The GABAA receptors are pentameric. The subunits are grouped into eight families (α1–6, β1–3, γ1–3, δ, ε, θ, π, ρ1–3) and the receptors commonly contain at least 3 different types of subunits: 2 αs, 2 βs and a third subunit-type. The physiological and pharmacological properties of the receptors are determined by the subunit-types that form the GABAA receptors [21]. When GABA binds to the GABAA receptor, a chloride-permeable ion channel is opened. The activation of GABAA channel is best studied in the central nervous system where the receptors evoke phasic (transient) and tonic (long-lasting) inhibition. Phasic activation is mediated by synaptic GABAA receptors and is triggered by the transient, high concentration of GABA (∼mM) released from the presynaptic terminal whereas tonic activation of the extrasynaptic receptors is evoked by the ambient GABA concentration present around the neuron [22]. In the rat β-cells, the vesicular release of GABA coincides with the release of the insulin containing granules when the cell is exposed to high glucose stimulation [11] whereas the non-vesicular release of GABA appears to take place both in high and low glucose concentration [23]. This raises the question of the mode of activation of the GABAA receptors in the pancreatic islet. So far, most of the electrophysiological studies of GABAA receptors in pancreatic islet cells have been conducted on dispersed cells [6] or transfected cells overexpressing GABAA receptors [12], [19]. These studies have, therefore, not resolved the mode of GABAA receptors activation in intact islets. One reason why physiological experiments have predominantly used dispersed cells is related to the difficulty of identifying the cell-types in intact islets. Here we have used the method of single-cell RT-PCR to distinguish the type of cell we recorded from. Our results show, in intact rat pancreatic islets, that interstitial GABA generates tonic currents in the α-cells when the islets are exposed to 20 mM glucose. The tonic current can be enhanced by pentobarbital and inhibited by SR-95531, both drugs specific for GABAA receptors.

Materials and Methods

Preparation of Pancreatic Islets

The experiments were carried out on intact rat pancreatic islets isolated from 50–52 days old Wistar rats. Care and use of animals were in accordance with local ethical guidelines and approved by the Uppsala Djurförsöksetiska Nämnd, Sweden (Uppsala’s animal ethics committee). Isolation of pancreatic islets followed a collagenase digestion procedure [24]. Islets were picked by hand with a regular pipette. Isolated islets were cultured for no more than five days in RPMI 1640 medium (Sigma, St. Louis, MO) containing 10 mM glucose, supplemented with 10% (vol/vol) fetal calf serum, benzylpenicillin (100 U/ml), and streptomycin (0.1 mg/ml). The medium was replaced every second day.

Whole-cell Recording and Current Analysis

To record from rat islets, the intact islet was held by a holding pipette and approached by the recording pipette from the other side [17], [25]. Establishing a GΩ seal on cells was mainly attempted on the surface of the rat islets where the most α-cells are located. After establishing a whole-cell patch-clamp configuration, currents were recorded. All patch-clamp recordings were performed at room temperature (20–22°C). All drugs used were purchased from Sigma-Aldrich (Steinheim, Germany) or Ascent Scientific (Bristol, UK). Pentobarbital and SR-95531 were dissolved in the extracellular solution. For the voltage-clamped, gap-free recordings, pancreatic islets were perfused in the standard extracellular solution consisting of (mM): 138 NaCl, 5.6 KCl, 2.6 CaCl2, 1.2 MgCl2, 5 HEPES (pH 7.4 using NaOH) and 20 mM glucose. For the recording of the current-voltage (IV) relationship, 20 mM tetraethyl-ammonium (TEA) chloride replaced 20 mM NaCl in the extracellular solution. The pipette solution consisted of (mM): 125 CsCl, 30 CsOH, 1 MgCl2, 10 EGTA, 5 HEPES (pH 7.15 with HCl), and 3 Mg-ATP. The recording pipettes were made from borosilicate glass and had the resistance of 5–8 MΩ when filled with the pipette solution. Recordings were made at −70 or −90 mV. The access resistance was monitored and if it changed by more than 25%, the recording was rejected. Current-voltage (IV) recordings were done in the presence and absence of SR-95531, a GABAA receptor antagonist. The net current activated by the interstitial GABA is calculated by subtractions of current before and after application of SR-95531 (I – ISR-95531 = IGABA). To record the IV relationship, the cell was held at a holding potential of 0 mV for 200 ms and then stepped to a test potential between –80 and +80 mV in 20 mV increments for 800 ms and then returned to 0 mV for 200 ms before the next test potential was applied. Patch-clamp recordings were done using an Axopatch 200B amplifier, filtered at 2 kHz, digitized on-line at 10 kHz using an analogue-to-digital converter and analyzed with pClamp (Molecular Devices) and Sigmaplot programs. The amplitude of the tonic currents was measured as the difference in the mean holding current before and after drug application as described by Glykys and Mody [26]. The single-channel recordings were performed in the whole-cell patch-clamp configuration. The amplitude of the currents was measured either from all-point amplitude histograms or from direct measurements of the amplitude of individual currents.

Harvesting the Cytoplasm

At the end of patch-clamp recordings, the cell’s cytosome was aspirated into the recording pipette by applying a negative pressure to the pipette. Harvesting was interrupted before or as soon as the seal was lost, as described by Lambolez B et al. [27]. The content in the pipette (∼5 µl) was then expelled into a PCR tube and frozen immediately on the dry ice. The recording pipettes and the pipette solution were autoclaved and the recording electrode was cleaned with ethanol and RNAse away (Molecular Bioproduct, San Diego, CA, USA) before the experiment was started.

Single-cell RT-PCR

We examined two protocols for RT-PCR identification of gene product: the standard RT-PCR and multiplex RT-PCR. Both protocols worked for islet cell-type discrimination. For the standard RT-PCR, in the first step, the reverse transcription was performed with Verso™ cDNA synthesis kit (Thermo Scientific, Bremen, Germany) in a final volume of 20 µl. The reverse transcription reaction was incubated at 42°C for 30 min and then at 95°C for 2 min. In the second step, each 3 µl cDNA was individually amplified by specific primer pairs for insulin, glucagon, and somatostatin (Ins, Gcg-2 and Sst-2 in Table 1), by a 40 cycles PCR protocol (95°C, 15 s; 59°C, 30 s; 72°C, 60 s). 4 µl of each individual PCR reaction was examined by electrophoresis on a 1.5% agarose gel stained with SYBR Gold (Invitrogen, Carlsbad, CA, USA).
Table 1

Primers used to amplify cDNAs of rat insulin (Ins), glucagon (Gcg-1, Gcg-2), somatostatin (Sst-1, Sst-2), GABAA receptor subunits and the reference gene β-actin (ACTB).

GenePrimerProduct size (bp)
InsF: CAGCAAGCAGGTCATTGTTCC 195
R: TTCACGACGGGACTTGGGTG
Gcg-1F: CGGAGGAGAACGCCAGATCA 133
R: CGGCGGGAGTCCAGGTATTT
Gcg-2F: GCTGGCAGCATGCCCCTCAAG 328
R: CGGCCTTTCACCAGCCAAGCA
Sst-1F: CGGGAAACAGGAACTGGCCAAG 82
R: AGGCTCCAGGGCATCGTTCT
Sst-2F: GTCCTGCCGTCTCCAGTGCG 140
R: CCAGTTCCTGTTTCCCGGTGGC
α1F: TGCCCATGCCTGCCCACTAAAA 511
R: GCCATCCCACGCATACCCTCTCT
α2F: AAAAGAGGATGGGCTTGGGA 550
R: ACGGGATGTTTTCTGCCTGTAT
α3F: TGGGAAGAACAAATCTGTGGAAGTAGC 466
R: CATCTCCAGGGCCTCTGGTACCTT
α4F: TTTAAACGAATCCCCAGGACAGAA 389
R: TGCCATTTCTCATAATTCTAA
α5F: TTATTCTTACTGGGAATGGACAATGG 350
R: TTAAACCGCAGCCTTTCATCTTTC
α6F: CAAGCTCAACTTGAAGATGAAGG 450
R: TCCATCCATAGGGAAGTTAACC
β1F: ACAGCTCCAATGAACCCAGCAA 521
R: TGCTCCCTCTCCTCCATTCCA
β2F: GGAGTGACAAAGATTGAGCTTCCT 564
R: GTCTCCAAGTCCCATTACTGCTTC
β3F: CCGTCTGGTCTCCAGGAATGTTGTC 411
R: CGATCATTCTTGGCCTTGGCTGT
γ1F: CAATAAAGGAAAAACCACCAG 374
R: TGATTATATTGGACTAAGCCAGA
γ2F: GTGAAGACAACTTCTGGTGACTATGTGGT 460
R: CATATTCTTCATCCCTCTCTTGAAGGTG
γ3F: CTGCTGCTTCTCCTCTGCCTGTTC 433
R: GGTTGGGTGTGGTGATCCAGTGA
ρ1F: TGGACAGCAGCTACAGTCACGG 209
R: AAGCAGCTGGGAAAATGATC
ρ2F: CAAGAAGCCACATTCTTCCA 133
R: TTCTGGAAGATATAGAGTCC
ρ3F: GGTGTGAGCGCCTCTATGC 70
R: GGGAGCTGACCCACATGTACA
δF: GCTCCTGCTGCTCTGCAC 100
R: GTTGGGGAGCCAGGATATTT
εF: GGCGTGAACAACAAAACTGA 154
R: AGAAGGAGACCCAGGAGAGC
θF: AGATTTTGGACAGGGTGCTG 82
R: GATACTGACACAGGCACAGGAG
πF: GTGTAGAAGCCCTAGTGTGACC 351
R: CCACCAATGAATTGACGCAAACCC
ACTBF: CCTGGCACCCAGCACAAT 144
R: GGGCCGGACTCGTCATACT
The two steps of multiplex PCR were performed essentially as described by Ruano D et al. In the first step, cytosome, RT/Platinum Taq Mix (0.4 µl, Invitrogen) and 0.67 picomole of each of the primer pairs (Ins, Gcg-1 and Sst-1 in Table 1) were added to reaction mix supplied by the manufacturer (final volume 20 µl). The set of primers were verified in jPCR program [28] to avoid dimmers or possible interactions among different primers. The reverse transcription reaction was conducted at 55°C for 30 min followed directly by 40 PCR cycles (95°C, 15 s; 59°C, 30 s; 72°C, 60 s). In the second step, 0.4 µl of the first PCR product was then used as template. Each cDNA was individually amplified using gene specific primer pair by performing 40 PCR cycles (same as described above). 4 µl of each individual PCR reaction was then electrophoresised on a 1.5% agarose gel stained with SYBR Green (Invitrogen, Carlsbad, CA).

Quantitative PCR (RT-qPCR)

Gene expression profiling of the GABAA receptor subunits in rat islets was done on total RNA from isolated rat pancreatic islets by RT-qPCR as previously described [29]. All primers are listed in Table 1.

Statistics

Data are presented as mean ± standard error of mean (SEM). Differences in expression levels were analyzed by Student’s t-test or non-parametric Mann–Whitney test. In all tests, p<0.05 was considered statistically significant. All statistical tests were performed using SPSS version 18.0 software (SPSS, Chicago, IL, USA) or Sigma Plot version 12 (Systat Software, San Jose, CA, USA).

Results

Identification of Cell-types in Intact Rat Islets by Single-cell RT-PCR

We examined the gene expression of insulin (Ins), glucagon (Gcg) or somatostatin (Sst) in islet cells using single-cell RT-PCR analysis. We did not examine the expression of the pancreatic polypepetide produced by PP cells in this study. The PP-cells constitute less than 5% of the total islet cells [30], [31]. At the end of whole-cell recordings from cells in intact islets the cytosome containing the mRNAs was collected and used for analysis. Fig. 1A shows representative results from 6 different cells. The cytosome of each cell was incubated with three different primer pairs aimed at amplifying the different transcripts encoding the three hormones. The rat islet total RNA was used as positive control and water or the pipette solution as negative controls. Based on amplification of glucagon, insulin or somatostatin gene products, the cells in Fig. 1A were identified as α-cells (n = 4), one as a β-cell and another was a δ-cell.
Figure 1

Identification of cell-types in rat pancreatic islets.

A. Hormone gene expression in single cells. Every three lanes on the gel contain RT-PCR products amplified with insulin (I), glucagon (G) and somatostatin (S) primers: Ins (195 bp), Gcg2 (328 bp) and Sst2 (140 bp), respectively (from left to right). The cell-type was identified according to which product had been detected. Positive controls were purified rat islets RNA samples and the negative control was water. B. The pie diagram illustrates the proportion of different cell-types discriminated by single-cell RT-PCR. C. Cell capacitance of α-cells (n = 18) and β-cells (n = 12). *P<0.05.

Identification of cell-types in rat pancreatic islets.

A. Hormone gene expression in single cells. Every three lanes on the gel contain RT-PCR products amplified with insulin (I), glucagon (G) and somatostatin (S) primers: Ins (195 bp), Gcg2 (328 bp) and Sst2 (140 bp), respectively (from left to right). The cell-type was identified according to which product had been detected. Positive controls were purified rat islets RNA samples and the negative control was water. B. The pie diagram illustrates the proportion of different cell-types discriminated by single-cell RT-PCR. C. Cell capacitance of α-cells (n = 18) and β-cells (n = 12). *P<0.05. We collected cytosomes from 95 cells and detected expression of a hormone in 43 of those cells. The majority of the cells were α-cells expressing glucagon (21 cells, 49%, Fig. 1B). 12 cells were β-cells (28%, Fig. 1B) expressing insulin and another 3 cells were δ-cells (7%, Fig. 1B) expressing somatostatin. The remaining 7 cells (16%) expressed somatostatin together with either insulin or glucagon (Fig. 1B). The cell surface area, which is proportional to the cell membrane capacitance, has been used to aid in determining the cell-type. Electrophysiological studies on single islet cells have shown that the β-cells have, on the average, significantly larger cell capacitance than the α-cells [25], [32], [33]. We, therefore, examined the relationship between the cell capacitance and the cell-type we had determined by using RT-PCR. In agreement with previous report Fig. 1C shows that the average cell capacitance was significantly larger for the β-cells (5.6±0.6 pF, n = 12) as compared to the α-cells (4.2±0.3 pF, n = 18). However, since there is a significant overlap between the capacitance of α-cells and β-cells, single-cell RT-PCR further aids in distinguishing the cell-type and may be particularly important in intact islets where cells may be electrically connected.

mRNA Expression of GABAA Receptor Subunits in Rat Islets

In order to determine which subtypes of GABAA receptors might be expressed in the rat islets, we examined expression of the 19 GABAA receptor subunit isoforms by RT-qPCR and the results are shown in Fig. 2. Seventeen subunits were detected in the islets (α1, α2, α3, α4, α6, β1–3, γ1, γ2, γ3, δ, θ, π and ρ1–3) with the β3 subunit most prominently expressed and relatively high expression of the α1, α2, α4, α6, γ1, δ and ρ subunits. Interestingly, the α5 and the ε subunits were not expressed.
Figure 2

Gene expression of GABAA receptor subunits in rat pancreatic islets.

Seventeen GABAA receptor subunits were detected with the most prominent expression level for α1, α2, α4, α6, β3, γ1, δ and ρ1, ρ2, ρ3 subunits. The data is the average expression in islets from 6 rats.

Gene expression of GABAA receptor subunits in rat pancreatic islets.

Seventeen GABAA receptor subunits were detected with the most prominent expression level for α1, α2, α4, α6, β3, γ1, δ and ρ1, ρ2, ρ3 subunits. The data is the average expression in islets from 6 rats.

Interstitial GABA Activates GABAA Receptors and Generates Tonic Currents in Intact Rat Islets

To-date the interstitial GABA concentration in rat islets has not been determined but we know that GABA is released by both vesicular and nonvesicular release processes [11], [23] and in high concentrations of glucose, at least the vesicular release is stimulated [11]. We, therefore, used 20 mM glucose to evoke GABA release from the β-cells and thereby maximize the interstitial GABA concentration in the islets during our experiments. The highest concentration is expected to be around the β-cells release sites from where it then diffuses to the rest of the islet. We examined if the interstitial GABA activated GABAA receptors in the islet cells and the results are shown in Fig. 3. Although no GABA was added experimentally, whole-cell currents were reduced by SR-95531, a GABAA receptor specific antagonist. SR-95531 reduced the baseline current but increased again when SR-95531 was withdrawn. The difference in the whole-cell current level in the presence and absence of SR-95531 revealed the level of the GABA-activated tonic current in the cell (Fig. 3A, B) which was 5.3 pA in the cell shown (Vp = −90 mV, Fig. 3B). In eight different cells the average tonic current level was 5.2±2.5 pA (n = 8, Vp = −90 mV). The current-voltage (IV) relation of the GABA-activated current was outwardly rectifying (Fig. 3C) demonstrating that more current passes through the GABAA receptors at depolarized as compared to hyperpolarized potentials in rat pancreatic islets. In another four cells the tonic current was significantly larger (Fig. 3D and E, 21 pA, Vp = −90 mV; Fig 3F). Whether the larger current level is due to more GABAA receptors in the plasma membrane or different subpopulations of GABAA receptors expressed in the cells is not known. However, insulin promotes insertion of GABAA receptors into the plasma membrane [34]. As insulin is released in high glucose this might have happened in some of the cells and we captured it in the four cells with the larger currents before the receptor number decreased again in the plasma membrane.
Figure 3

Interstitial GABA activates tonic GABAA receptor currents in rat pancreatic islets.

A. A representative trace showing GABA-activated tonic current, recorded from a cell in an intact rat islet (Vp = −90 mV). The current was activated by interstitial GABA and inhibited by application of SR-95531, causing a clear outward shift in the holding current (line 1 to line 2). B. Gaussian fits to all-points histogram derived from 20 s current recordings in (A) before (1) and after (2) application of SR-95531. SR-95531 insensitive current was subtracted for analysis. The difference between the peaks of the Gaussian fits denotes the mean tonic current (5.3 pA). C. Whole-cell current-voltage (IV) relationship of GABA-activated current in rat islet cells (n = 3). The current activated by the interstitial GABA (I – ISR-95531 = IGABA) is plotted. The IV relation shows outward rectification. D. A representative current showing GABA-activated tonic current (21 pA, Vp = −90 mV) that is significantly larger than the current shown in (A). E. Gaussian fits to all-points histogram derived from 20 s current recordings in (D) before (1) and after (2) application of SR-95531. SR-95331 insensitive current was subtracted for analysis. F. Whole-cell IV relationship of GABA-activated current in rat islet cells (n = 3). The IV relation shows outward rectification.

Interstitial GABA activates tonic GABAA receptor currents in rat pancreatic islets.

A. A representative trace showing GABA-activated tonic current, recorded from a cell in an intact rat islet (Vp = −90 mV). The current was activated by interstitial GABA and inhibited by application of SR-95531, causing a clear outward shift in the holding current (line 1 to line 2). B. Gaussian fits to all-points histogram derived from 20 s current recordings in (A) before (1) and after (2) application of SR-95531. SR-95531 insensitive current was subtracted for analysis. The difference between the peaks of the Gaussian fits denotes the mean tonic current (5.3 pA). C. Whole-cell current-voltage (IV) relationship of GABA-activated current in rat islet cells (n = 3). The current activated by the interstitial GABA (I – ISR-95531 = IGABA) is plotted. The IV relation shows outward rectification. D. A representative current showing GABA-activated tonic current (21 pA, Vp = −90 mV) that is significantly larger than the current shown in (A). E. Gaussian fits to all-points histogram derived from 20 s current recordings in (D) before (1) and after (2) application of SR-95531. SR-95331 insensitive current was subtracted for analysis. F. Whole-cell IV relationship of GABA-activated current in rat islet cells (n = 3). The IV relation shows outward rectification. Pentobarbital modulates GABAA receptors resulting in enhanced current response to GABA [21]. We examined if pentobarbital potentiated the tonic GABA-activated currents in cells in the intact islet and the results are shown in Fig. 4A and B. The application of 100 µM pentobarbital enhanced the tonic current by 12.4 pA (171 pS, Vp = –70 mV) and significantly increased the current baseline noise. Similar results were obtained in another 3 cells where pentobarbital increased the GABAA receptors conductance (111.8±21.6 pS, n = 4). The cytosome of the cell from which the current was recorded (Fig. 4A) was harvested and the cell shown to be an α-cell (Fig. 4C). GABA-activated currents were recorded in another 7 α-cells. For the twelve identified β-cells, successful whole-cell current recordings were obtained in seven of these cells but in none of them was GABA-evoked current detected (n = 7, Fig. 4D, E, F).
Figure 4

Pentobarbital (PB) enhances interstitial GABA-activated currents in pancreatic islet α-cells.

A. A representative current trace shows interstitial GABA-activated tonic current (2) that was potentiated by pentobarbital (1) and then inhibited by SR-95531 (3) (Vp = -70 mV). B. Gaussian fits to all-points histogram derived from 20 s current recordings in (A) before (2) and after application of (1) pentobarbital and (3) SR-95531 SR-95531 insensitive current was subtracted for analysis. The difference between the peaks of the Gaussian fits shows the evoked (5 pA, (2) – (3)) and the enhanced (17 pA, (1) – (3)) tonic currents. C. Electrophoresis image of single-cell RT-PCR products from the cell in (A). Every three lanes on the gel contain amplified RT-PCR products: insulin (primer: Ins), glucagon (primer: Gcg1) or somatostatin (primer: Sst1). The cell-type was identified as an α-cell. Positive controls were purified rat islets RNA samples and the negative control was water. D. A representative current recording showing whole-cell current that did not respond to pentobarbital or SR-95531 (Vp = −70 mV). E. Gaussian fits to all-points histogram derived from 20 s current recordings in (D) before and after application of pentobarbital and SR-95531. SR-95531 insensitive current was subtracted for analysis. F. Electrophoresis image of single-cell RT-PCR products from the cell in (D). Every three lanes on the gel contain amplified RT-PCR products: insulin (primer: Ins), glucagon (primer: Gcg2) or somatostatin (primer: Sst2). The cell-type was identified as a β-cell. Positive controls were purified rat islets RNA samples and the negative control was water.

Pentobarbital (PB) enhances interstitial GABA-activated currents in pancreatic islet α-cells.

A. A representative current trace shows interstitial GABA-activated tonic current (2) that was potentiated by pentobarbital (1) and then inhibited by SR-95531 (3) (Vp = -70 mV). B. Gaussian fits to all-points histogram derived from 20 s current recordings in (A) before (2) and after application of (1) pentobarbital and (3) SR-95531 SR-95531 insensitive current was subtracted for analysis. The difference between the peaks of the Gaussian fits shows the evoked (5 pA, (2) – (3)) and the enhanced (17 pA, (1) – (3)) tonic currents. C. Electrophoresis image of single-cell RT-PCR products from the cell in (A). Every three lanes on the gel contain amplified RT-PCR products: insulin (primer: Ins), glucagon (primer: Gcg1) or somatostatin (primer: Sst1). The cell-type was identified as an α-cell. Positive controls were purified rat islets RNA samples and the negative control was water. D. A representative current recording showing whole-cell current that did not respond to pentobarbital or SR-95531 (Vp = −70 mV). E. Gaussian fits to all-points histogram derived from 20 s current recordings in (D) before and after application of pentobarbital and SR-95531. SR-95531 insensitive current was subtracted for analysis. F. Electrophoresis image of single-cell RT-PCR products from the cell in (D). Every three lanes on the gel contain amplified RT-PCR products: insulin (primer: Ins), glucagon (primer: Gcg2) or somatostatin (primer: Sst2). The cell-type was identified as a β-cell. Positive controls were purified rat islets RNA samples and the negative control was water.

Single-channel Recordings of GABAA Receptor Currents in Intact Rat Pancreatic Islets

Under our experimental conditions, the membrane resistance of the cells in the whole-cell patch-clamp configuration was often in the GΩ range indicating that very few channels were open in the cell membrane. In this situation, the whole-cell can be regarded as an unusually large outside-out membrane patch and ideally suited for single-channel recordings. In Fig. 5, four representative current recordings are shown where the interstitial-GABA activated single-channel currents in cells in intact islets. The most prominent single-channel conductances were 65 pS (Fig. 5A, Vp = −90 mV), 24 pS (Fig. 5B, Vp = −70 mV), 40 pS (Fig. 5C, Vp = −70 mV) and 105 pS (Fig. 5D, Vp = −70 mV). When the islets were perfused with 100 µM SR-95531, the single-channel currents shown in Fig. 5 were inhibited. A current trace on a slow time scale (s, Fig. 5A, the top current trace) demonstrates the SR-95531 inhibition of the channels in one of the cells. The average conductance of native rat GABAA receptors recorded at the holding potential of −70 or −90 mV was 42±7 pS (n = 13).
Figure 5

Interstitial GABA activates single-channel currents in intact islets.

Single-channel currents that were later inhibited by 100 µM SR-95531 were recorded in four different cells (A, B, C and D) in intact rat islets. A. A representative current trace (top trace, slow time scale, s) showing GABA-activated single-channel currents and inhibition by 100 µM SR-95531. The solid line shows the time when the extracellular solution containing SR-95531 was perfused through the recording chamber. The broken lines indicate from where in the recording the current trace on the faster time scale (ms) was obtained. The glucose concentration was 20 mM and the holding potential was −90 mV (A), −70 mV (B–D). The most prominent single-channel conductance in the cells in A, B, C and D were 65 pS, 24 pS, 40 pS and 105 pS, respectively. For all four cells, the currents were recorded in the whole-cell patch-clamp configuration from cells in intact islets and were activated by interstitial GABA and inhibited by application of SR-95531 (100 µM).

Interstitial GABA activates single-channel currents in intact islets.

Single-channel currents that were later inhibited by 100 µM SR-95531 were recorded in four different cells (A, B, C and D) in intact rat islets. A. A representative current trace (top trace, slow time scale, s) showing GABA-activated single-channel currents and inhibition by 100 µM SR-95531. The solid line shows the time when the extracellular solution containing SR-95531 was perfused through the recording chamber. The broken lines indicate from where in the recording the current trace on the faster time scale (ms) was obtained. The glucose concentration was 20 mM and the holding potential was −90 mV (A), −70 mV (B–D). The most prominent single-channel conductance in the cells in A, B, C and D were 65 pS, 24 pS, 40 pS and 105 pS, respectively. For all four cells, the currents were recorded in the whole-cell patch-clamp configuration from cells in intact islets and were activated by interstitial GABA and inhibited by application of SR-95531 (100 µM).

GABA-activated Single-channel Currents Decrease Gradually in 100 µM SR-95531

The current recordings in Fig. 6 (Vp = −90 mV) show that SR-95531 gradually decreases the channel conductance in intact islets. The all-points histograms are from 20 s current episodes and include the corresponding current trace. Before exposure to SR-95331, the maximum channel conductance was 105 pS (Fig 6A and Aa) but after about 1 min in 100 µM SR-95531, the conductance had decreased to 35 pS (Fig 6A and Ab) and 30 s later the channel was no longer detectable (Fig 6A and Ac).
Figure 6

SR-95531 gradually inhibits the GABA-activated single-channel currents.

A. A current trace at a slow time scale (s) showing GABA-activated single-channel currents at the beginning of an experiment and then inhibition by 100 µM SR9553 (Vp = −90 mV). The solid line shows the time when the SR-95531 was applied to the islet. The currents on a faster time scale is shown in a, b and c and the all-points histograms (20 s) include the corresponding current trace. The channel activity was completely abolished by 100 µM SR 95531 after 90 s perfusion.

SR-95531 gradually inhibits the GABA-activated single-channel currents.

A. A current trace at a slow time scale (s) showing GABA-activated single-channel currents at the beginning of an experiment and then inhibition by 100 µM SR9553 (Vp = −90 mV). The solid line shows the time when the SR-95531 was applied to the islet. The currents on a faster time scale is shown in a, b and c and the all-points histograms (20 s) include the corresponding current trace. The channel activity was completely abolished by 100 µM SR 95531 after 90 s perfusion.

Pentobarbital Enhances the GABA-activated Single-channel Currents

An example of the effect of 100 µM pentobarbital on GABA-activated single-channels in the intact islets is shown in Fig. 7. Before the application of pentobarbital, the receptors had an average current amplitude of 1.6 pA (23 pS, Vp = −70 mV, Fig. 7A) and a low open probability as shown by the all-points histogram (15 s) to the right of the current trace. Following exposure to pentobarbital (Fig. 7B), both the single-channel current and the open probability increased as manifested in channel current of 2.7 pA (38 pS, Vp = −70 mV) and the skewed all-points histogram. Similar results were obtained in another four experiments where the pentobarbital-enhanced average conductance was 38±6 pS. 100 µM SR-95531 inhibited the GABA-activated, pentobarbital-enhanced currents (Fig 7C).
Figure 7

Pentobarbital (PB) enhances the GABA-activated single-channel current.

Single-channel currents recorded from the same cell is shown in A, B and C (Vp = −70 mV) and the all-points histograms (20 s) include the corresponding current trace. The solid line shows the time when the extracellular solution containing drug was perfused through the recording chamber. 100 µM pentobarbital potentiated and 100 µM SR-95531 inhibited the GABA-activated currents.

Pentobarbital (PB) enhances the GABA-activated single-channel current.

Single-channel currents recorded from the same cell is shown in A, B and C (Vp = −70 mV) and the all-points histograms (20 s) include the corresponding current trace. The solid line shows the time when the extracellular solution containing drug was perfused through the recording chamber. 100 µM pentobarbital potentiated and 100 µM SR-95531 inhibited the GABA-activated currents.

Discussion

Our results demonstrate that GABA acts as a paracrine signaling molecule in the intact rat pancreatic islets. The results show that the interstitial GABA concentrations activate GABAA receptors generating tonic currents that are only present in the glucagon-releasing α-cells in rat islets. The results are consistent with the observation that antagonists of GABAA receptors inhibit glucagon secretion in both rat and human islets [17], [19]. Identification of the types of cells the recordings were made from in the intact islets was done by the single-cell RT-PCR. The single-channel conductance of GABAA receptors ranged from 24 to 105 pS. Both the whole-cell and the single-channel currents were enhanced by pentobarbital and inhibited by GABAA receptors antagonist SR-95531. The success rate of identifying the cells we recorded from, in the intact islets, was about 45% using the single-cell RT-PCR technique. About 50% of the cells were α-cells although they represent only 20% of all the cells in a pancreatic islet. This result is related to the way the experiments were executed as we most commonly record from cells on the surface of the islets. Most of the surface cells in rat islets are non-β cells [25], [30]. We, nevertheless, were also able to record from the β-cells, about 30% of the identified cells, which make up the core of the rat islet and represent 60–70% of the islet cells [25], [30]. The β-cells were, on the average, significantly larger than the α-cells as determined by the cell-capacitance and the results are consistent with what has been reported previously in mouse islets [25], [33]. We did, nevertheless, observe significant scatter in size for both the α- and β-cells highlighting the need for an alternative method, the single-cell RT-PCR, to determine the cell-type in islets. Although the presence of the GABAA receptors in pancreatic islets has been known since the late 1980s [6], only recently was it shown that the interstitial GABA in the islets activates the native GABAA receptors [17]. GABAA receptors can be supersensitive to GABA and respond when the GABA concentration is as low as pM to nM [35], [36]. In this study, no external GABA was added but tonic, GABA-generated currents were recorded. The GABA must, therefore, have originated from cells within the islets. Furthermore, since the GABA-activated current was enhanced by pentobarbital, the interstitial GABA concentration must have been sub-saturating [17], [35], [36]. GABAA receptors normally contain two αs, two βs plus a third type of subunit in the receptor complex [21]. In the rat islets, we detected 17 of the total 19 possible GABAA receptor subunit genes. The highest expression level was detected for the β3 subunit and a very low expression level for β2, γ2, γ3 and π. The α5 and ε subunits were not expressed. Clearly a number of different GABAA receptor subtypes can be expressed in the rat islets and is in accord with earlier reports that have examined the expression of the subunits in rodents [19], [34]. Interestingly, in human islets, both the α5 and π subunits are prominently expressed [12], [17]. As the subunit composition determines both the physiological and the pharmacological properties of the receptors, it can be expected that although GABA signaling takes place both in human and rodent islets, the pharmacological profile of the response will vary somewhat between species [21], [37]. The type of α subunits influences the GABA affinity of the receptors [21]. A number of different GABAA receptor α subunits are expressed in the islets potentially forming receptors that differ in their sensitivities to GABA and other drugs [21], [35], [36], [37]. The whole-cell IV curves showed outward rectification. GABAA receptors have been shown to have either linear or outwardly rectifying IV, both at the single-channel level and at the whole-cell current level [36], [38], [39], [40]. At the single channel level, the outward rectification is the property of the ion channel molecule whereas at the whole-cell current level it can be either due to intrinsic properties of the ion channels or that the open probability of the channels is lower at hyperpolarized potentials as compared to depolarized potentials. The tonic conductance varied significantly in magnitude, which might be related to different density of the GABAA receptors expressed in the cell plasma membrane, the concentration of interstitial GABA or the subtypes of GABAA receptors in the plasma membrane. At the single-channel level, GABAA receptors were gradually blocked by SR-95531 and potentiated by pentobarbital. Whether the single-channel conductances we determined in this study are related to different GABAA receptor subtypes or activation of a specific GABAA receptor-type by different GABA concentrations remains to be examined. In the central nervous system, GABA-activated tonic current has an important physiological function in regulating overall excitability of neural networks [22]. Similarly, it is possible that tonic activation of GABAA receptors in pancreatic islets have a role not only in suppressing the membrane potential but even synchronizing the population of the α-cells, in addition, to coordinate their activities with that of the β-cells. GABA is known to exert inhibitory effect on glucagon release [6], [17], [34]. Clearly, extracellular GABA signaling in pancreatic islets is of physiological and potentially pharmacological significance for glucose homeostasis. Our results demonstrate that GABA signaling can be studied in identified cells in intact islets by combining the single-cell RT-PCR method with patch-clamp recordings.
  40 in total

1.  γ-Aminobutyric acid (GABA) signalling in human pancreatic islets is altered in type 2 diabetes.

Authors:  J Taneera; Z Jin; Y Jin; S J Muhammed; E Zhang; S Lang; A Salehi; O Korsgren; E Renström; L Groop; B Birnir
Journal:  Diabetologia       Date:  2012-04-27       Impact factor: 10.122

2.  Java web tools for PCR, in silico PCR, and oligonucleotide assembly and analysis.

Authors:  Ruslan Kalendar; David Lee; Alan H Schulman
Journal:  Genomics       Date:  2011-05-03       Impact factor: 5.736

3.  Increased GABA(A) channel subunits expression in CD8(+) but not in CD4(+) T cells in BB rats developing diabetes compared to their congenic littermates.

Authors:  Suresh Kumar Mendu; Lina Akesson; Zhe Jin; Anna Edlund; Corrado Cilio; Ake Lernmark; Bryndis Birnir
Journal:  Mol Immunol       Date:  2010-11-26       Impact factor: 4.407

Review 4.  The 'ABC' of GABA receptors: a brief review.

Authors:  M Chebib; G A Johnston
Journal:  Clin Exp Pharmacol Physiol       Date:  1999-11       Impact factor: 2.557

Review 5.  Paracrine interactions within islets of Langerhans.

Authors:  Duk-Su Koh; Jung-Hwa Cho; Liangyi Chen
Journal:  J Mol Neurosci       Date:  2012-04-13       Impact factor: 3.444

6.  Voltage-gated and resting membrane currents recorded from B-cells in intact mouse pancreatic islets.

Authors:  S Göpel; T Kanno; S Barg; J Galvanovskis; P Rorsman
Journal:  J Physiol       Date:  1999-12-15       Impact factor: 5.182

Review 7.  Regulation of glucagon secretion by glucose: paracrine, intrinsic or both?

Authors:  J N Walker; R Ramracheya; Q Zhang; P R V Johnson; M Braun; P Rorsman
Journal:  Diabetes Obes Metab       Date:  2011-10       Impact factor: 6.577

Review 8.  GABA A receptors: subtypes provide diversity of function and pharmacology.

Authors:  Richard W Olsen; Werner Sieghart
Journal:  Neuropharmacology       Date:  2008-08-08       Impact factor: 5.250

9.  The main source of ambient GABA responsible for tonic inhibition in the mouse hippocampus.

Authors:  Joseph Glykys; Istvan Mody
Journal:  J Physiol       Date:  2007-05-24       Impact factor: 5.182

10.  Insulin reduces neuronal excitability by turning on GABA(A) channels that generate tonic current.

Authors:  Zhe Jin; Yang Jin; Suresh Kumar-Mendu; Eva Degerman; Leif Groop; Bryndis Birnir
Journal:  PLoS One       Date:  2011-01-14       Impact factor: 3.240

View more
  11 in total

Review 1.  Steroids, steroid associated substances and gestational diabetes mellitus.

Authors:  M Hill; A Pařízek; P Šimják; M Koucký; K Anderlová; H Krejčí; D Vejražková; L Ondřejíková; A Černý; R Kancheva
Journal:  Physiol Res       Date:  2021-12-30       Impact factor: 2.139

2.  Prenatal stress increased γ2 GABAA receptor subunit gene expression in hippocampus and potentiated pentylenetetrazol-induced seizure in rats.

Authors:  Morteza Bagheri; Ehsan Saboory; Mehrdad Nejatbakhsh; Shiva Roshan-Milani; Leila Derafshpour; Hojjat Sayyadi; Yousef Rasmi
Journal:  Iran J Basic Med Sci       Date:  2020-06       Impact factor: 2.699

3.  Compartmentalization of GABA synthesis by GAD67 differs between pancreatic beta cells and neurons.

Authors:  Jamil Kanaani; Chiara Cianciaruso; Edward A Phelps; Miriella Pasquier; Estelle Brioudes; Nils Billestrup; Steinunn Baekkeskov
Journal:  PLoS One       Date:  2015-02-03       Impact factor: 3.240

4.  The GLP-1 Receptor Agonist Exendin-4 and Diazepam Differentially Regulate GABAA Receptor-Mediated Tonic Currents in Rat Hippocampal CA3 Pyramidal Neurons.

Authors:  Sergiy V Korol; Zhe Jin; Bryndis Birnir
Journal:  PLoS One       Date:  2015-04-30       Impact factor: 3.240

5.  Fusion pore regulation by cAMP/Epac2 controls cargo release during insulin exocytosis.

Authors:  Alenka Guček; Nikhil R Gandasi; Muhmmad Omar-Hmeadi; Marit Bakke; Stein O Døskeland; Anders Tengholm; Sebastian Barg
Journal:  Elife       Date:  2019-05-20       Impact factor: 8.140

6.  Specific Expression of KCC2 in the α Cells of Normal and Type 1 Diabetes Model Mouse Pancreatic Islets.

Authors:  Chigusa Shimizu-Okabe; Shigeki Okada; Shiki Okamoto; Hiroaki Masuzaki; Chitoshi Takayama
Journal:  Acta Histochem Cytochem       Date:  2022-02-22       Impact factor: 1.938

Review 7.  Integrating the inputs that shape pancreatic islet hormone release.

Authors:  Glyn M Noguchi; Mark O Huising
Journal:  Nat Metab       Date:  2019-12-13

8.  Functional Characterization of Native, High-Affinity GABAA Receptors in Human Pancreatic β Cells.

Authors:  Sergiy V Korol; Zhe Jin; Yang Jin; Amol K Bhandage; Anders Tengholm; Nikhil R Gandasi; Sebastian Barg; Daniel Espes; Per-Ola Carlsson; Derek Laver; Bryndis Birnir
Journal:  EBioMedicine       Date:  2018-03-22       Impact factor: 8.143

9.  GABAA Receptor-Mediated Currents and Hormone mRNAs in Cells Expressing More Than One Hormone Transcript in Intact Human Pancreatic Islets.

Authors:  Sergiy V Korol; Zhe Jin; Bryndis Birnir
Journal:  Int J Mol Sci       Date:  2020-01-17       Impact factor: 5.923

10.  Altered Steroidome in Women with Gestational Diabetes Mellitus: Focus on Neuroactive and Immunomodulatory Steroids from the 24th Week of Pregnancy to Labor.

Authors:  Leona Ondřejíková; Antonín Pařízek; Patrik Šimják; Daniela Vejražková; Marta Velíková; Kateřina Anderlová; Michala Vosátková; Hana Krejčí; Michal Koucký; Radmila Kancheva; Michaela Dušková; Markéta Vaňková; Josef Bulant; Martin Hill
Journal:  Biomolecules       Date:  2021-11-23
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.