Literature DB >> 23802544

Identification of an intact ParaHox cluster with temporal colinearity but altered spatial colinearity in the hemichordate Ptychodera flava.

Tetsuro Ikuta1, Yi-Chih Chen, Rossella Annunziata, Hsiu-Chi Ting, Che-huang Tung, Ryo Koyanagi, Kunifumi Tagawa, Tom Humphreys, Asao Fujiyama, Hidetoshi Saiga, Nori Satoh, Jr-Kai Yu, Maria Ina Arnone, Yi-Hsien Su.   

Abstract

BACKGROUND: ParaHox and Hox genes are thought to have evolved from a common ancestral ProtoHox cluster or from tandem duplication prior to the divergence of cnidarians and bilaterians. Similar to Hox clusters, chordate ParaHox genes including Gsx, Xlox, and Cdx, are clustered and their expression exhibits temporal and spatial colinearity. In non-chordate animals, however, studies on the genomic organization of ParaHox genes are limited to only a few animal taxa. Hemichordates, such as the Enteropneust acorn worms, have been used to gain insights into the origins of chordate characters. In this study, we investigated the genomic organization and expression of ParaHox genes in the indirect developing hemichordate acorn worm Ptychodera flava.
RESULTS: We found that P. flava contains an intact ParaHox cluster with a similar arrangement to that of chordates. The temporal expression order of the P. flava ParaHox genes is the same as that of the chordate ParaHox genes. During embryogenesis, the spatial expression pattern of PfCdx in the posterior endoderm represents a conserved feature similar to the expression of its orthologs in other animals. On the other hand, PfXlox and PfGsx show a novel expression pattern in the blastopore. Nevertheless, during metamorphosis, PfXlox and PfCdx are expressed in the endoderm in a spatially staggered pattern similar to the situation in chordates.
CONCLUSIONS: Our study shows that P. flava ParaHox genes, despite forming an intact cluster, exhibit temporal colinearity but lose spatial colinearity during embryogenesis. During metamorphosis, partial spatial colinearity is retained in the transforming larva. These results strongly suggest that intact ParaHox gene clustering was retained in the deuterostome ancestor and is correlated with temporal colinearity.

Entities:  

Mesh:

Substances:

Year:  2013        PMID: 23802544      PMCID: PMC3698058          DOI: 10.1186/1471-2148-13-129

Source DB:  PubMed          Journal:  BMC Evol Biol        ISSN: 1471-2148            Impact factor:   3.260


Background

The ANTP superclass homeobox genes including Hox and ParaHox encode transcription factors that play crucial roles in many aspects of development in bilaterian animals [1]. ParaHox and Hox genes are thought to have evolved from a putative common ancestral gene complex, the ProtoHox cluster, prior to the divergence of cnidarians and bilaterians [2-4]. A recent study further proposed that distinct Hox and ParaHox loci were present in the last common ancestor of all animals [5]. On the other hand, analysis on the cnidarian Hox/ParaHox genes suggested that the ParaHox cluster formed as a result of tandem duplication rather than cluster duplication [6]. One of the best-known properties of Hox genes is the spatial and temporal colinearity between their expression patterns and their positions within clusters on a chromosome [7]. Hox genes at the 3’ end are involved in patterning the anterior of the embryo, genes in the middle of the cluster pattern the central regions of the embryo, and the genes at the 5’ end pattern the posterior of the embryo in a phenomenon called spatial colinearity [8]. Temporal colinearity refers to a situation in which anterior Hox genes are expressed earlier and posterior genes are expressed later [9]. These observations have led to the hypothesis that the physical organization of Hox genes on the chromosome is important for proper morphological differentiation along the anteroposterior axis [10]. ParaHox cluster was first identified in the amphioxus Branchiostoma floridae, in which three member genes, Gsx, Xlox, and Cdx, are linked in a genomic region with Gsx adjacent to Xlox in the same orientation, followed by Cdx on the opposite strand [11,12]. This cluster organization is conserved in Xenopus, mouse, and human [12,13]. Studies on the genomic organization of ParaHox genes in non-chordate animals are limited to only a few animal taxa and the clustering seems labile. In protostomes, for example, C. elegans has only one Cdx ortholog, pal-1, while Drosophila has Gsx (ind) and Cdx orthologs that are not linked on the chromosome [14-16]. In the annelid Platynereis dumerilii, Gsx and Xlox genes are linked together, whereas Cdx is located away from these two genes [17]. In deuterostomes, the ParaHox genes are not linked in teleost fishes [18], the ascidian Ciona intestinalis[19], and the sea urchin Strongylocentrotus purpuratus[20], although all three genes are found. Recently, an intact ParaHox cluster was found in the starfish Patiria miniata[21], suggesting that ParaHox clustering was maintained in the echinoderm ancestor and the sea urchins have modified the original arrangement. The maintenance of ParaHox clusters in chordate genomes also led to discussions about their spatial and temporal colinearity in gene expression. The expression of amphioxus ParaHox genes exhibits both temporal and spatial colinearity [11,12,22]. AmphiCdx transcript is the first among the three ParaHox genes to be detected by in situ hybridization, being expressed initially around the blastopore during mid-gastrulation and later in the larval hindgut and posterior neural tube. After gastrulation, AmphiXlox expression is detected in the posterior archenteron and neuroectoderm. In the larval stage, AmphiXlox transcripts mark the midgut-hindgut boundary. AmphiGsx is the last gene to be expressed, and its expression is restricted to a few cells in the anterior neural tube. Therefore, similar to the spatial colinearity of Hox genes along the anteroposterior axis, amphioxus ParaHox genes also exhibit spatial colinearity with Gsx expressed in the anterior neural tube, Xlox and Cdx expressed in the middle and posterior endoderm and neural tube, respectively. The temporal colinearity of amphioxus ParaHox genes is also evident, but inverted with respect to the pattern in the Hox cluster: transcript of the posterior Cdx is detected first and the anterior Gsx is expressed last [22]. Studies on the expression of ParaHox genes in other deuterostome and protostome animals including sea urchin [20], ascidian [23-26], mouse [27-29], polychaete worms [17,30,31], and gastropod [32] have also shown similar expression domains: Gsx genes are mostly expressed solely in the central nervous system (CNS) with a rostral anterior limit; Xlox genes are expressed both in the CNS and the central regions of developing guts, such as the pancreas of vertebrates; Cdx genes are expressed in more posterior regions of the CNS and gut. Temporal colinearity, on the other hand, is reversed in S. purpuratus and lost in C. intestinalis[33]. Hemichordates are the sister group of the echinoderms, which together are referred to as the Ambulacraria that is closely related to chordates. Hemichordates retain bilateral symmetric body plan throughout their life and share several morphological similarities with both echinoderms and chordates. Therefore, hemichordates have been served as a model to gain insights into the origins of chordate or deuterostome characters [34,35]. Hemichordates consist of two major groups, the solitary enteropneust acorn worms and the colonial pterobranchs. The phylogenetic relationships among pterobranchs and two of the enteropneust groups, direct-developing Harrimannidae and indirect-developing Ptychoderidae, have been uncertain. Fossils of both pterobranchs and enteropneusts were present in Middle Cambrian strata [36]. Phylogenetic analyses on 18S rDNA have placed pterobranchs as a sister group to the Harrimaniidae [37,38], making enteropneusts paraphyletic. A recent study that compared microRNA repertoires among several hemichordate and echinoderm species has unambiguously supported the monophyly of enteropneust worms [39]. The indirect-developing Ptychoderidae is of particular interest because their tornaria larvae share striking developmental and morphological similarities with echinoderm larvae [40-42]. Ptychodera flava from the Ptychoderidae has recently been shown to possess a 12-gene Hox cluster that is similar to the organization of chordate Hox clusters but with different posterior genes [43]. In this study, we investigated the genomic organization and expression of ParaHox genes in P. flava. We found that P. flava contains an intact ParaHox cluster with a similar arrangement to that of chordates. We also showed that expression of these genes exhibit temporal colinearity but lose spatial colinearity during embryogenesis. Nevertheless, partial spatial colinearity is retained in the transforming larva. These results strongly suggest that intact ParaHox gene clustering is correlated with temporal colinearity and was retained in the deuterostome ancestor.

Results and discussion

A previous study has identified four P. flava ParaHox genes, which include PfGsx, two Xlox (PfLox1 and PfLox2), and PfCdx[44]. Our PCR analysis revealed that PfGsx, PfLox2, and PfCdx are located on a single BAC clone, PfBS11F10. However, the presence of the PfLox1 gene in the genome is questionable because a BLAST search of the P. flava genome (using shotgun sequencing; unpublished data) did not identify PfLox1. Moreover, several attempts to amplify PfLox1 from genomic DNA failed, and the expression of PfLox1 could not be detected in any developmental stages analyzed by RT-PCR and in situ hybridization. Furthermore, another indirect-developing hemichordate, Balanoglossus simodensis, contains a single Xlox gene (BsXlox) [45]. PfLox1, PfLox2, and BsXlox proteins share identical homeodomains, and the overall identity between PfLox1 and either PfLox2 or BsXlox is comparable (83% and 80%, respectively) (Additional file 1: Table S1). Thus, it is possible that, similar to other invertebrate deuterostomes [11,20,21,45], P. flava contains only one single Xlox gene (PfLox2). This conclusion may indicate that PfLox1 is an ortholog gene from a related species collected in the same area as P. flava and that the clone was obtained from a contaminated library made from pooled animals [44]. We hence renamed PfLox2 as PfXlox to represent the single Xlox gene in P. flava.

Genomic organization of P. flava ParaHox genes

The sequence data of the BAC clone PfBS11F10 was assembled into a single continuous sequence of 169 kb in length (Figure  1A). PfGsx and PfXlox are organized in the same transcriptional orientation with a 47.4 kb intergenic region, while PfCdx is located 6.2 kb away from PfXlox in a head-to-head orientation. The total genomic sequence of the P. flava ParaHox cluster occupies a region of 106.8 kb. No other protein coding genes were identified within the cluster by routine sequence searches. This cluster organization is remarkably similar to the intact chordate ParaHox clusters found in amphioxus, Xenopus, mouse, and human [13]. No intact ParaHox cluster has been found outside deuterostomes. To explore the genomic organization of ParaHox genes in protostomes, we searched several recently published spiralian genomes. In the marine polychaete Capitella teleta genome, Xlox and Cdx are on the same scaffold with three predicted genes between them and Gsx is located on a different scaffold [30,46]. Two Gsx, one Xlox, and one Cdx genes are found in the leech Helobdella robusta genome, although each is located on one of four different scaffolds [46]. In the limpet Lottia gigantea genome, the Gsx and Xlox genes are linked together but Cdx is separated on a different scaffold [46]. The Pacific oyster Crassostrea gigas genome contains three ParaHox genes, with Gsx and Xlox located on the same scaffold and Cdx on another [47]. In the pearl oyster Pinctada fucata genome, Gsx, Xlox, and Cdx are located on three different scaffolds [48]. Therefore, currently there is no evidence for the existence of intact ParaHox clusters in protostome genomes (Figure  1B). Searching the draft genome of Saccoglossus kowalevskii, a Harrimaniidae acorn worm, revealed that while the SkXlox and SkCdx genes are next to each other in the same head-to-head orientation, SkGsx is on a different scaffold. It remains unknown whether the three S. kowalevskii ParaHox genes form a cluster in the genome. Nevertheless, the close linkage of PfGsx, PfXlox, and PfCdx in P. flava suggests that ParaHox genes were clustered in the deuterostome ancestor.
Figure 1

Genomic organizations of ParaHox genes. (A) Phylogenetic tree depicting genomic organization of the P. flava ParaHox cluster (top) compared to the clusters of amphioxus (Branchiostoma floridae) and mouse (Mus musculus) on chromosome (Chr.) 5. Blue, green, red, purple, and yellow boxes are exons of Gsx (Gsh), Xlox (Ipf1), Cdx, PRHOXNB, and Flt1, respectively. The light blue line indicates the fully sequenced PfBS11F10 BAC clone. Bent arrows indicate transcriptional orientations. The bottom line is a zoomed out view showing the neighboring Flt1 gene located near the mouse ParaHox cluster. (B) Evolution of the ParaHox cluster in bilateria. The phylogenetic tree represents the genomic organization of ParaHox genes in several bilateria, including protostomes (Pr) and deuterostomes (De). Protostomes can be further divided into lophotrochozoa (Lo) and ecdysozoa (Ed). The following lophotrochozoa animals were included in the analysis: two polychaete species (Platynereis dumerilii and Capitella teleta) and one leech species (Helobdella robusta) belonging to the Phylum Annelida (An); limpet (Lottia gigantea) and two oyster species (Crassostrea gigas and Pinctada fucata) in the Phylum Mollusca (Mo). Two ecdysozoa species fruit fly Drosophila melanogaster and nematode Caenorhabditis elegans do not contain the full complement of ParaHox genes. In deuterostomes, Phylum Echinodermata (Ec), including sea urchin Strongylocentrotus purpuratus and starfish Patiria miniata, and Phylum Hemichordata (He), including Ptychodera flava and Saccoglossus kowalevskii, constitute Ambulacraria (Am) that is closely related to Phylum Chordata (Ch). ParaHox gene organizations of the three chordate species, amphioxus Branchiostoma floridae, ascidian Ciona intestinalis, and mouse Mus musculus, are presented. IDs of the scaffolds (Sc) on which ParaHox genes are located are indicated beneath the illustrated scaffolds found in the genome databases. Blue, green, and red triangles indicate the orientations of Gsx, Xlox, and Cdx, respectively, in the genome. Double slashes between two genes indicate that although the genes are located on the same chromosome or scaffold they are separated by intervening genes. Species names shown in red contain intact ParaHox clusters.

Genomic organizations of ParaHox genes. (A) Phylogenetic tree depicting genomic organization of the P. flava ParaHox cluster (top) compared to the clusters of amphioxus (Branchiostoma floridae) and mouse (Mus musculus) on chromosome (Chr.) 5. Blue, green, red, purple, and yellow boxes are exons of Gsx (Gsh), Xlox (Ipf1), Cdx, PRHOXNB, and Flt1, respectively. The light blue line indicates the fully sequenced PfBS11F10 BAC clone. Bent arrows indicate transcriptional orientations. The bottom line is a zoomed out view showing the neighboring Flt1 gene located near the mouse ParaHox cluster. (B) Evolution of the ParaHox cluster in bilateria. The phylogenetic tree represents the genomic organization of ParaHox genes in several bilateria, including protostomes (Pr) and deuterostomes (De). Protostomes can be further divided into lophotrochozoa (Lo) and ecdysozoa (Ed). The following lophotrochozoa animals were included in the analysis: two polychaete species (Platynereis dumerilii and Capitella teleta) and one leech species (Helobdella robusta) belonging to the Phylum Annelida (An); limpet (Lottia gigantea) and two oyster species (Crassostrea gigas and Pinctada fucata) in the Phylum Mollusca (Mo). Two ecdysozoa species fruit fly Drosophila melanogaster and nematode Caenorhabditis elegans do not contain the full complement of ParaHox genes. In deuterostomes, Phylum Echinodermata (Ec), including sea urchin Strongylocentrotus purpuratus and starfish Patiria miniata, and Phylum Hemichordata (He), including Ptychodera flava and Saccoglossus kowalevskii, constitute Ambulacraria (Am) that is closely related to Phylum Chordata (Ch). ParaHox gene organizations of the three chordate species, amphioxus Branchiostoma floridae, ascidian Ciona intestinalis, and mouse Mus musculus, are presented. IDs of the scaffolds (Sc) on which ParaHox genes are located are indicated beneath the illustrated scaffolds found in the genome databases. Blue, green, and red triangles indicate the orientations of Gsx, Xlox, and Cdx, respectively, in the genome. Double slashes between two genes indicate that although the genes are located on the same chromosome or scaffold they are separated by intervening genes. Species names shown in red contain intact ParaHox clusters. It has been suggested that the ParaHox cluster of the chordate ancestor is flanked by CHIC and PRHOXNB genes [12]. The 5’ flanking region of PfGsx in PfBS11F10 is too short to confirm if CHIC is located there in P. flava. Using a BLAST search against the whole genome, we identified a genomic contig containing P. flava PRHOXNB gene but found that this contig was not located on PfBS11F10, suggesting that the P. flava ParaHox cluster is not flanked by PRHOXNB. On the other hand, FLT1, the ortholog of which has been shown to be a neighbor of human and mouse ParaHox clusters [12], was found next to PfCdx (Figure  1A). Therefore, as in the single mammalian ParaHox cluster, genomic reorganizations have occurred around the P. flava ParaHox cluster but not within it.

Temporal colinearity of P. flava ParaHox genes

To investigate the temporal order of P. flava ParaHox gene expression, we performed quantitative PCR (QPCR) at different embryonic stages (Figure  2). None of the ParaHox genes were detected in the unfertilized egg as maternal transcripts. The PfCdx transcript was first detected at the blastula stage (16 hours post fertilization; hpf) and peaked at the late gastrula stage (43 hpf). PfXlox transcript was barely detected in the blastula and early gastrula (22 hpf) stage and the expression level increased at the late gastrula stage. The PfGsx transcript was detected at a low level a few hours after PfXlox was expressed, and the transcript could not be detected at the tornaria larva stage (65 hpf). These results suggested that the first ParaHox gene to be expressed in P. flava is PfCdx, followed by PfXlox, and finally by PfGsx. As observed in amphioxus, the activation of P. flava ParaHox genes retains temporal colinearity.
Figure 2

Temporal expression profiles of ParaHox genes. Transcript levels of ParaHox genes were measured by QPCR at different embryonic stages including unfertilized egg (0 hpf), early blastula (12 hpf), late blastula (16 hpf), early gastrula (24 hpf), late gastrula (43 hpf), and tornaria larva (65 hpf). The Y-axis is the transcript level normalized to the 18S rRNA level at the same stage.

Temporal expression profiles of ParaHox genes. Transcript levels of ParaHox genes were measured by QPCR at different embryonic stages including unfertilized egg (0 hpf), early blastula (12 hpf), late blastula (16 hpf), early gastrula (24 hpf), late gastrula (43 hpf), and tornaria larva (65 hpf). The Y-axis is the transcript level normalized to the 18S rRNA level at the same stage.

Spatial expression patterns of P. flava ParaHox genes

The spatial expression domains of the three ParaHox genes were determined by in situ hybridization (Figure  3). Similar to its ortholog AmphiCdx in amphioxus, PfCdx transcript was the first among the three ParaHox genes to be detected by in situ hybridization around the blastopore at the early gastrula stage (Figure  3C, white arrow). In the mid-gastrula stage, after the mesoderm forms at the tip of the archenteron, PfCdx was strongly expressed around the blastopore and the posterior archenteron (Figure  3D-E, white arrows). Later, at the tornaria larva stage, PfCdx expression persisted in the ectoderm around the blastopore and the hindgut until at least 21 dpf (days post fertilization) (Figure  3F-H). The anterior boundary of the PfCdx expression domain demarcated the midgut-hindgut boundary (Figure  3F-H, black arrows). PfXlox expression was detected around the blastopore at the mid- and late gastrula stage (Figure  3L-M, black arrowheads). Expression of PfXlox became weaker in the tornaria larva but remained in the same ectodermal domain surrounding the blastopore and the posterior endoderm (Figure  3N-P, black arrowheads). PfGsx expression was restricted to a few cells around the blastopore in the late gastrula stage and disappeared in the tornaria larva (Figure  3T-X, white arrowheads). To analyze spatial expression domains in detail, we performed double fluorescent in situ hybridization of PfXlox with either PfCdx or PfGsx (Figure  4). PfCdx transcript can be clearly observed around the blastopore at the mid-gastrula (MG) stage (Figure  4A-C). In the late gastrula embryo (LG) and tornaria larva (TL), the expression domains of PfCdx and PfXlox in the posterior ectoderm domain mostly overlapped (Figure  4D-I). PfCdx expression in the posterior endoderm extended to the midgut-hindgut boundary whereas PfXlox only expressed in the most posterior endoderm. The expression pattern of PfCdx in the developing gut conforms to the generally conserved feature as observed for its ortholog genes in other animals. On the other hand, PfXlox expression around the blastopore and the most posterior endoderm is different from the conserved expression pattern in the middle endoderm. The restricted expression of PfGsx also resided within the ectodermal domain around the blastopore with no detectable anterior staining (Figure  4J-L). These data indicated that expression of the P. flava ParaHox genes lose their spatial colinearity during the embryonic stages. The anterior boundary of the posterior PfCdx gene expression domain is relatively more anterior than that of the anterior PfGsx and middle PfXlox genes.
Figure 3

Expression patterns of ParaHox genes. In situ hybridization analyses of PfCdx (A-H), PfXlox (I-P), and PfGsx (Q-X) were performed on unfertilized egg (UF), blastula (B), early gastrula (EG), mid-gastrula (MG), late gastrula (LG), and tornaria larva (TL) at different time points (hpf, hours post fertilization; dpf, days post fertilization). White and black arrows indicate the expression of PfCdx and the midgut-hindgut boundary, respectively. Black and white arrowheads denote the expression of PfXlox and PfGsx, respectively. The observed views are indicated at the bottom right corner of the panels in the first row. Unless otherwise indicated, the observed views of subsequent panels are the same as the first panel in each column. DV, dorsal view; LV, lateral view; VV, ventral view. The scale bar is 50 μm. Panels T’ and U’ are the blastopore view (BV) of panels T and U, respectively.

Figure 4

Double fluorescent hybridization of with or . DNP-labeled PfXlox probe and DIG-labeled PfCdx probe were used for in situ hybridization on mid-gastrula (A-C), late gastrula (D-F), and tornaria larva (G-I). The arrows and arrowheads indicate the anterior boundaries of the PfCdx and PfXlox expression domain, respectively. Double stainings of PfGsx and PfXlox transcripts were performed on the late gastrula embryos (J-L).

Expression patterns of ParaHox genes. In situ hybridization analyses of PfCdx (A-H), PfXlox (I-P), and PfGsx (Q-X) were performed on unfertilized egg (UF), blastula (B), early gastrula (EG), mid-gastrula (MG), late gastrula (LG), and tornaria larva (TL) at different time points (hpf, hours post fertilization; dpf, days post fertilization). White and black arrows indicate the expression of PfCdx and the midgut-hindgut boundary, respectively. Black and white arrowheads denote the expression of PfXlox and PfGsx, respectively. The observed views are indicated at the bottom right corner of the panels in the first row. Unless otherwise indicated, the observed views of subsequent panels are the same as the first panel in each column. DV, dorsal view; LV, lateral view; VV, ventral view. The scale bar is 50 μm. Panels T’ and U’ are the blastopore view (BV) of panels T and U, respectively. Double fluorescent hybridization of with or . DNP-labeled PfXlox probe and DIG-labeled PfCdx probe were used for in situ hybridization on mid-gastrula (A-C), late gastrula (D-F), and tornaria larva (G-I). The arrows and arrowheads indicate the anterior boundaries of the PfCdx and PfXlox expression domain, respectively. Double stainings of PfGsx and PfXlox transcripts were performed on the late gastrula embryos (J-L). The adult body plan of indirect developing acorn worms, such as P. flava, develops from a feeding tornaria larva that undergoes metamorphosis [34]. We further investigated the expression pattern of P. flava ParaHox genes in the transforming larva collected from plankton tows. PfCdx expression was detected in the posterior endoderm (Figure  5A-C, arrows) in a pattern similar to its expression at the tornaria larva stage (Figure  3). Surprisingly, during transformation of the competent larva, PfXlox was expressed in the middle part of the endoderm (Figure  5D-F, arrowheads). This expression pattern is similar to that of Xlox genes in other animals. The PfGsx transcript, however, could not be detected in the transforming larva. These data indicated that the expression patterns of PfXlox and PfCdx in the endoderm of the transforming larva conform to the spatial colinearity that is conserved with other animals. Thus, we conclude that the spatial colinearity in the P. flava ParaHox cluster is altered during the embryonic stages, but remained in the transforming larva.
Figure 5

Expression of and in transforming larvae. Whole mount (A, D) and sagittal sections (B, E) of the transforming larvae hybridized with antisense probes against PfCdx (A-C) or PfXlox (D-F). Panels C and F are higher magnifications of panel B and E, respectively. Arrows and arrowheads indicate the in situ hybridization signals of PfCdx and PfXlox, respectively. The scale bar is 200 μm.

Expression of and in transforming larvae. Whole mount (A, D) and sagittal sections (B, E) of the transforming larvae hybridized with antisense probes against PfCdx (A-C) or PfXlox (D-F). Panels C and F are higher magnifications of panel B and E, respectively. Arrows and arrowheads indicate the in situ hybridization signals of PfCdx and PfXlox, respectively. The scale bar is 200 μm.

Evolution of the P. flava ParaHox cluster

We have demonstrated that in the hemichordate P. flava, expression of the three ParaHox genes exhibits temporal colinearity during embryogenesis. However, despite having an intact ParaHox cluster, the spatially staggered expression pattern of these genes is lost in embryogenesis but partially maintained in the transforming larva. These results reinforce the idea that regulatory mechanisms controlling temporal colinearity are the major constraints that maintain an intact ParaHox cluster [7]. Spatial colinearity, on the other hand, seems to be independent of clustering. The Cdx expression pattern in the posterior endoderm is extremely conserved in bilateria regardless of whether Cdx is located within the cluster or not. Thus, the cis-regulatory module (CRM) that controls posterior endoderm expression of Cdx must be closely associated with Cdx genes during animal evolution. The embryonic expression of PfXlox and PfGsx, on the other hand, represent novel patterns. Both the conserved neuroectoderm and middle endoderm expression of Xlox genes are not detected in P. flava embryos; instead, embryonic expression of PfXlox is in the ectodermal cells around the blastopore. We hypothesize that this novel expression pattern is due to a new CRM generated during evolution. Compared to the genomic structures of the chordate Xlox genes, the relatively long intron between the two exons of the PfXlox gene provides the possibility for generating the novel CRM (Figure  1A). The conserved CRM controlling PfXlox expression in the midgut is still retained as this expression domain is maintained in the transforming larva. Further studies on the cis-regulatory analysis of PfXlox will be required to test this hypothesis. A widely held view is that Hox genes are primarily used in larval cells destined to become parts of the adult body rather than in the development of larva-specific structures [33]. A similar idea, however, has not been discussed with respect to ParaHox genes. Our data show that the temporal colinearity of ParaHox genes is observed during embryogenesis whereas spatial features are more conserved in transforming larvae than during embryogenesis. These data seem to support the idea that ParaHox genes are used similarly to Hox genes in patterning anteroposterior axis for adult structures. Nevertheless, the expression of sea urchin ParaHox genes exhibits spatial colinearity in embryonic gut despite having a broken cluster [20]. Further investigation on the roles of ParaHox genes in indirect-developers may help to solve this issue.

Conclusions

It is generally proposed that ParaHox and Hox genes have evolved from a common ancestral ProtoHox cluster. However, unlike the widespread existence of Hox clusters in the animal kingdom, intact ParaHox clusters have only been found in chordates and recently in a starfish. Here we find that the hemichordate P. flava contains an intact ParaHox cluster without any intervening genes and the organization of the cluster matches that of chordates and the starfish. Our finding suggests that both the ancestral Ambulacraria and ancestral deuterostome possessed intact ParaHox clusters (Figure  1B). The current status of the protostome genome assemblies could not provide definitive evidence for the presence of a scaffold containing all three ParaHox genes. Improvement of the current genome assemblies or sequencing other protostome genomes will be required to reveal whether protostomes contain intact ParaHox clusters. The intact P. flava ParaHox cluster represents a special case in the discussion of temporal and spatial colinearity. The expression of these genes exhibit temporal colinearity but spatial colinearity is modified. Our data suggest that gene clustering is correlated with temporal, not spatial, colinearity. These findings may encourage more intensive studies on the regulatory mechanisms for maintaining gene clusters. These results, together with the recent finding that Hox cluster of P. flava has similar organization to the chordate Hox clusters [43], reinforce the idea of using P. flava to gain insights into the origins of deuterostome and chordate body plans.

Methods

Construction of BAC libraries

We constructed two sets of Ptychodera flava BAC libraries (PfBS and PfBH) estimated to represent the 4 (PfBS) or 5 (PfBH) × genome coverage for each library. BAC libraries were constructed according to the procedures as described previously [49]. Briefly, genomic DNA was prepared from sperm of a single P. flava individual collected at the sand bar, Kaneohe bay, Oahu, Hawaii. Genomic DNA was partially digested with Sac I (for PfBS) or Hind III (for PfBH) and subjected to pulsed-field gel electrophoresis. The DNA fragments corresponding to 110 (for PfBS) or 135 (for PfBH) kb were isolated and ligated into the pKS145 (for PfBS) or pKS200 (for PfBH) vector. Transformation was carried out by electroporation using E. coli DH10B as a host strain. Ampicillin-resistant transformants were collected and then stored in 384-format plates at −80°C.

Screening of BAC libraries

To facilitate screening by PCR, BAC clones were organized in three-dimensional pools using Biomek FX. DNA was prepared from each pool using Kurabo PI-200 and PI-1100. Specific primers for each ParaHox gene were designed based on the homeobox sequences. Initially, the pools of the PfBS library were screened by PCR using PfCdx-specific primers and two positive clones were identified. Subsequently, DNA prepared from the isolated BAC clones was used as a template, and PCR was performed to determine the presence of P. flava ParaHox genes in the clones.

BAC DNA sequencing and assembly

One P. flava BAC clone, PfBS11F10, containing three ParaHox genes, PfGsx, PfXlox, and PfCdx, was sequenced using standard shotgun procedures at the National Institute of Genetics, Japan. Individual BAC DNA was isolated using Kurabo PI-200. End sequences of the shotgun library were analyzed in an Applied Biosystems 3730xl capillary sequencer, and reads were assembled using the Phrap–Consed suite programs.

Identification of ParaHox genes in genome databases

ParaHox gene searches were conducted using available genome databases. We used P. flava ParaHox sequences as queries to search the genomes of Capitella teleta (JGI v1.0), Helobdella robusta (JGI v1.0), Lottia gigantea (JGI v1.0), Crassostrea gigas (GigaDB), Pinctada fucata (Genome Ver 1.00), and Saccoglossus kowalevskii (NCBI Skow1.1).

Animals, embryos, and larval collection

Adult acorn worms (Ptychodera flava) were collected from the Penghu Islands, an archipelago off the western coast of Taiwan. Animals were induced to spawn using the temperature shift method as described [50]. Eggs were washed extensively with filtered seawater before fertilization [51]. Embryos were cultured at 23°C and fed with Rhodomonas lens after they hatched from the fertilization envelope. Transforming larvae were collected by plankton tows at Sand Island offshore, Honolulu, Hawaii. Our experimental research was approved by Academia Sinica Biosafety Review & Biomaterials and Lab Biosafety Information System (certificate number BSF0410-00002036).

Quantitative PCR (QPCR)

Total RNA was extracted from several embryonic stages using Trizol reagent (Invitrogen). Ten micrograms of Trizol-extracted RNA was further purified using the RNeasy Micro Kit (Qiagen) to remove genomic DNA. One microgram of the purified RNA was reverse transcribed using the iScript cDNA synthesis kit (Bio-Rad). The resulting cDNA was used as a template for QPCR. Levels of 18S rRNA were used to normalize samples. QPCR analysis was performed on a Roche LightCycler 480 with the LightCycler 480 SYBR Green I Master (Roche). The QPCR primers used in this study were designed based on the published sequences [44,52], and the primer sequences were as follows: PfGsx-QF: 5’- CGCTGTCAACAGTGCCTTAG -3′; PfGsx-QR: 5′- CACCTTCGCAGAGAGAGGAA -3′; PfXlox-QF: 5′-GGCGGACAACAAGAACACTT-3′; PfXlox-QR: 5′-CCCGCAGAAAGACTGACTTC-3′; PfCdx-QF: 5′-ACTTTCGTCACGGCAGACTT-3′; PfCdx-QR: 5′-GTCCGAATGGTGAGCTTGTT-3′; Pf18S-QF: 5′-CCTGCGGCTTAATTTGACTC-3′; Pf18S-QR: 5′-AACTAAGAACGGCCATGCAC-3′.

In situ hybridization

cDNA clones of PfGsx and PfCdx were obtained from library screening [44]. PCR cloning was used to construct a PfXlox cDNA clone from embryonic cDNA that was amplified with PfXlox-F (5′-CCAACATGGAGAGTTCTAATCC-3′) and PfXlox-R (5′-GCGGTCTGTCTTTGTCAGAT-3′) primers. Antisense riboprobes were synthesized from these cDNA clones using digoxigenin (DIG) RNA Labeling Mix (Roche) with T7 or SP6 RNA polymerases (Promega). For double fluorescent in situ hybridization, dinitrophenol (DNP) labeled probes were made using the LabelIT DNP Labeling Kit (Mirus). Embryos were fixed and dehydrated as described [42]. After embryos were rehydrated in phosphate buffer saline containing 0.1% Tween-20 (PBST), they were digested with 10 μg/ml Proteinase K for 5 min, washed twice with 0.2% glycine, and fixed with 4% paraformaldehyde in PBST for 1 hr. Embryos were then washed sequentially with 0.1 M triethanolamine, 0.25% acetic anhydride, and 0.5% acetic anhydride. After washing extensively with PBST, hybridization was performed and the embryos were imaged as previously described [53]. For in situ hybridization of transforming larvae, similar procedures were applied except that the larvae were digested with 10 μg/ml Proteinase K for 20 to 30 min and the antibody was preabsorbed with adult powder [51]. The stained competent larvae were embedded in Tissue-Tek Optimal Cutting Temperature (O.C.T.) compound (Sakura, Japan) and cryosectioned at 10 μm.

Abbreviations

ANTP: Antennapedia; BAC: Bacterial artificial chromosome; BLAST: Basic local alignment search tool; CNS: Central nervous system; CRM: Cis-regulatory module; DIG: Digoxigenin; DNP: Dinitrophenol; dpf: Days post fertilization; hpf: Hours post fertilization; PBST: Phosphate buffer saline with Tween-20; PCR: Polymerase chain reaction; QPCR: Quantitative polymerase chain reaction; RT-PCR: Reverse transcription-polymerase chain reaction.

Competing interest

The authors declare that they have no competing interests.

Authors’ contributions

YHS, MIA, JKY, HS, and NS conceived and supervised the project. TI carried out sequence analysis. YCC performed gene expression analyses. RA performed double florescent in situ hybridizations on the Hawaiian acorn worm embryos. HCT and CHT participated in molecular cloning and larval culture, respectively. KT and TH collected fecund animals and transforming larvae from Hawaii. RK assembled the P. flava draft genome. AF established the P. flava BAC libraries. TI and YHS wrote the manuscript. All authors read and approved the final manuscript.

Additional file 1: Table S1

Comparison of PfLox1 to other ambulacraria Xlox proteins. Accession number: Ptychodera flava Lox1 (PfLox1), AY436762. Ptychodera flava Lox2 (PfLox2), AY436763. Balanoglossus simodensis Xlox (BsXlox), AB506760. Saccoglossus kowalevskii Xlox (SkXlox), XM_002741106. Strongylocentrotus purpuratus Lox (SpLox), NM_214650. Click here for file
  53 in total

1.  Isolation of Hox and Parahox genes in the hemichordate Ptychodera flava and the evolution of deuterostome Hox genes.

Authors:  Kevin J Peterson
Journal:  Mol Phylogenet Evol       Date:  2004-06       Impact factor: 4.286

2.  Gene expression profiles of transcription factors and signaling molecules in the ascidian embryo: towards a comprehensive understanding of gene networks.

Authors:  Kaoru S Imai; Kyosuke Hino; Kasumi Yagi; Nori Satoh; Yutaka Satou
Journal:  Development       Date:  2004-07-21       Impact factor: 6.868

Review 3.  Hemichordate embryos: procurement, culture, and basic methods.

Authors:  Christopher J Lowe; Kuni Tagawa; Tom Humphreys; Marc Kirschner; John Gerhart
Journal:  Methods Cell Biol       Date:  2004       Impact factor: 1.441

4.  Genetic organization and embryonic expression of the ParaHox genes in the sea urchin S. purpuratus: insights into the relationship between clustering and colinearity.

Authors:  Maria I Arnone; Francesca Rizzo; Rosella Annunciata; R Andrew Cameron; Kevin J Peterson; Pedro Martínez
Journal:  Dev Biol       Date:  2006-08-04       Impact factor: 3.582

5.  The Spawning and Early Development of the Hawaiian Acorn Worm (Hemichordate), Ptychodera flava.

Authors:  K Tagawa; A Nishino; T Humphreys; N Satoh
Journal:  Zoolog Sci       Date:  1998-01-01       Impact factor: 0.931

6.  The ParaHox gene cluster is an evolutionary sister of the Hox gene cluster.

Authors:  N M Brooke; J Garcia-Fernàndez; P W Holland
Journal:  Nature       Date:  1998-04-30       Impact factor: 49.962

7.  Ghost loci imply Hox and ParaHox existence in the last common ancestor of animals.

Authors:  Olivia Mendivil Ramos; Daniel Barker; David E K Ferrier
Journal:  Curr Biol       Date:  2012-09-27       Impact factor: 10.834

8.  Ventralization of an indirect developing hemichordate by NiCl₂ suggests a conserved mechanism of dorso-ventral (D/V) patterning in Ambulacraria (hemichordates and echinoderms).

Authors:  E Röttinger; M Q Martindale
Journal:  Dev Biol       Date:  2011-04-03       Impact factor: 3.582

Review 9.  The taxonomy of developmental control in Caenorhabditis elegans.

Authors:  G Ruvkun; O Hobert
Journal:  Science       Date:  1998-12-11       Impact factor: 47.728

10.  Do cnidarians have a ParaHox cluster? Analysis of synteny around a Nematostella homeobox gene cluster.

Authors:  Jerome H L Hui; Peter W H Holland; David E K Ferrier
Journal:  Evol Dev       Date:  2008 Nov-Dec       Impact factor: 1.930

View more
  15 in total

1.  BMP controls dorsoventral and neural patterning in indirect-developing hemichordates providing insight into a possible origin of chordates.

Authors:  Yi-Hsien Su; Yi-Chih Chen; Hsiu-Chi Ting; Tzu-Pei Fan; Ching-Yi Lin; Kuang-Tse Wang; Jr-Kai Yu
Journal:  Proc Natl Acad Sci U S A       Date:  2019-06-12       Impact factor: 11.205

Review 2.  On a possible evolutionary link of the stomochord of hemichordates to pharyngeal organs of chordates.

Authors:  Noriyuki Satoh; Kunifumi Tagawa; Christopher J Lowe; Jr-Kai Yu; Takeshi Kawashima; Hiroki Takahashi; Michio Ogasawara; Marc Kirschner; Kanako Hisata; Yi-Hsien Su; John Gerhart
Journal:  Genesis       Date:  2014-11-04       Impact factor: 2.487

3.  Evidence from oyster suggests an ancient role for Pdx in regulating insulin gene expression in animals.

Authors:  Fei Xu; Ferdinand Marlétaz; Daria Gavriouchkina; Xiao Liu; Tatjana Sauka-Spengler; Guofan Zhang; Peter W H Holland
Journal:  Nat Commun       Date:  2021-05-25       Impact factor: 14.919

Review 4.  Time is of the essence for ParaHox homeobox gene clustering.

Authors:  Myles Garstang; David E K Ferrier
Journal:  BMC Biol       Date:  2013-06-26       Impact factor: 7.431

5.  Intact cluster and chordate-like expression of ParaHox genes in a sea star.

Authors:  Rossella Annunziata; Pedro Martinez; Maria Ina Arnone
Journal:  BMC Biol       Date:  2013-06-27       Impact factor: 7.431

6.  Nodal signaling is required for mesodermal and ventral but not for dorsal fates in the indirect developing hemichordate, Ptychodera flava.

Authors:  Eric Röttinger; Timothy Q DuBuc; Aldine R Amiel; Mark Q Martindale
Journal:  Biol Open       Date:  2015-05-15       Impact factor: 2.422

7.  The ParaHox gene Gsx patterns the apical organ and central nervous system but not the foregut in scaphopod and cephalopod mollusks.

Authors:  Tim Wollesen; Sonia Victoria Rodríguez Monje; Carmel McDougall; Bernard M Degnan; Andreas Wanninger
Journal:  Evodevo       Date:  2015-12-29       Impact factor: 2.250

8.  Bivalve-specific gene expansion in the pearl oyster genome: implications of adaptation to a sessile lifestyle.

Authors:  Takeshi Takeuchi; Ryo Koyanagi; Fuki Gyoja; Miyuki Kanda; Kanako Hisata; Manabu Fujie; Hiroki Goto; Shinichi Yamasaki; Kiyohito Nagai; Yoshiaki Morino; Hiroshi Miyamoto; Kazuyoshi Endo; Hirotoshi Endo; Hiromichi Nagasawa; Shigeharu Kinoshita; Shuichi Asakawa; Shugo Watabe; Noriyuki Satoh; Takeshi Kawashima
Journal:  Zoological Lett       Date:  2016-02-18       Impact factor: 2.836

9.  The TALE face of Hox proteins in animal evolution.

Authors:  Samir Merabet; Brigitte Galliot
Journal:  Front Genet       Date:  2015-08-18       Impact factor: 4.599

10.  Hemichordate genomes and deuterostome origins.

Authors:  Oleg Simakov; Takeshi Kawashima; Ferdinand Marlétaz; Jerry Jenkins; Ryo Koyanagi; Therese Mitros; Kanako Hisata; Jessen Bredeson; Eiichi Shoguchi; Fuki Gyoja; Jia-Xing Yue; Yi-Chih Chen; Robert M Freeman; Akane Sasaki; Tomoe Hikosaka-Katayama; Atsuko Sato; Manabu Fujie; Kenneth W Baughman; Judith Levine; Paul Gonzalez; Christopher Cameron; Jens H Fritzenwanker; Ariel M Pani; Hiroki Goto; Miyuki Kanda; Nana Arakaki; Shinichi Yamasaki; Jiaxin Qu; Andrew Cree; Yan Ding; Huyen H Dinh; Shannon Dugan; Michael Holder; Shalini N Jhangiani; Christie L Kovar; Sandra L Lee; Lora R Lewis; Donna Morton; Lynne V Nazareth; Geoffrey Okwuonu; Jireh Santibanez; Rui Chen; Stephen Richards; Donna M Muzny; Andrew Gillis; Leonid Peshkin; Michael Wu; Tom Humphreys; Yi-Hsien Su; Nicholas H Putnam; Jeremy Schmutz; Asao Fujiyama; Jr-Kai Yu; Kunifumi Tagawa; Kim C Worley; Richard A Gibbs; Marc W Kirschner; Christopher J Lowe; Noriyuki Satoh; Daniel S Rokhsar; John Gerhart
Journal:  Nature       Date:  2015-11-18       Impact factor: 49.962

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.