Literature DB >> 23785404

miR-23a targets interferon regulatory factor 1 and modulates cellular proliferation and paclitaxel-induced apoptosis in gastric adenocarcinoma cells.

Xue Liu1, Jing Ru, Jian Zhang, Li-hua Zhu, Min Liu, Xin Li, Hua Tang.   

Abstract

MicroRNAs are a class of non-coding RNAs that function as key regulators of gene expression at the post-transcriptional level. In our previous research, we found that miR-23a was significantly up-regulated in human gastric adenocarcinoma cells. In the current study, we demonstrate that miR-23a suppresses paclitaxel-induced apoptosis and promotes the cell proliferation and colony formation ability of gastric adenocarcinoma cells. We have identified tumor suppressor interferon regulator factor 1 (IRF1) as a direct target gene of miR-23a. We performed a fluorescent reporter assay to confirm that miR-23a bound to the IRF1 mRNA 3'UTR directly and specifically. The ectopic expression of IRF1 markedly promoted paclitaxel-induced apoptosis and inhibited cell viability and colony formation ability, whereas the knockdown of IRF1 had the opposite effects. The restoration of IRF1 expression counteracted the effects of miR-23a on the paclitaxel-induced apoptosis and cell proliferation of gastric adenocarcinoma cells. Quantitative real-time PCR showed that miR-23a is frequently up-regulated in gastric adenocarcinoma tissues, whereas IRF1 is down-regulated in cancer tissues. Altogether, these results indicate that miR-23a suppresses paclitaxel-induced apoptosis and promotes cell viability and the colony formation ability of gastric adenocarcinoma cells by targeting IRF1 at the post-transcriptional level.

Entities:  

Mesh:

Substances:

Year:  2013        PMID: 23785404      PMCID: PMC3677940          DOI: 10.1371/journal.pone.0064707

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Gastric cancer is a disease that is associated with a poor prognosis and a high mortality rate [1], [2]. Gastric cancer is the second leading cause of cancer death worldwide after lung cancer [3]. Approximately 90% of gastric cancers are adenocarcinomas, which originate from the glandular epithelium of the gastric mucosa [4]. Previous studies have suggested that gastric adenocarcinoma is a multifactorial disease [5]. Numerous studies have also revealed that oncogenes or tumor suppressors may play important roles in the tumorigenesis and progression of gastric cancer [6], [7]. However, the molecular mechanisms of gastric cancer development and progression remain unresolved. miRNAs are a class of small, non-coding RNAs that can regulate gene expression by either inducing the degradation of target mRNAs or by impairing the translation of their target mRNAs. miRNAs can also up-regulate gene expression by targeting the 5′ untranslated region (UTR) of their target genes. Many studies have revealed that aberrantly expressed miRNAs participate in tumorigenesis in temporal and spatial manners [8]. Some miRNAs become over-expressed in tumor cells and function as oncogenes. miR-223 has been shown to stimulate gastric cancer cell migration and invasion in vitro and in vivo [9]. miR-27a is highly expressed in gastric adenocarcinoma tissue and promotes cell growth [10], [11]. However, other miRNAs are deleted or reduced in tumor cells and act as tumor suppressor genes. The miR-200bc/429 cluster, miR-497 and miR-181b, have been shown to be down-regulated in gastric cancer cell lines [12], [13], [14], and these miRNAs have been suggested to play a role in the development of multidrug resistance by modulating apoptosis through the regulation of BCL2 [15]. Recently, several reports have demonstrated that miR-23a has diverse functions in tumor biology. miR-23a, is located in the miR-23a/24/27a cluster and regulates the TGF-β-induced epithelial–mesenchymal transition (EMT) by targeting E-cadherin in lung cancer cells [16]. The miR-23a cluster is a downstream target of PU.1 and is involved in antagonizing lymphoid cell fate [17]. miR-23a promotes colon carcinoma cell growth, invasion and metastasis through the inhibition of the MTSS gene [18]. miR-23a also targets glutaminase (GLS) mRNA and inhibits the expression of the GLS protein [19]. The miR-23a/24/27a cluster appears to function as an antiapoptotic and proliferation-promoting factor in liver cancer cells [20], and miR-23a has been shown to be significantly up-regulated in bladder cancers compared to normal bladder mucosa [21]. miR-23a was also found to act as an oncogene in gastric cancer. In a previous study that was conducted in our lab [22], we analyzed gastric adenocarcinoma-related miRNAs using miRNA microarrays, and we identified miR-23a as an oncogenic miRNA. In the current study, we show that human miR-23a can promote cell proliferation and suppress paclitaxel-induced apoptosis in gastric adenocarcinoma cell lines. We further validate interferon regulatory factor 1 (IRF1) as a target gene of miR-23a. The miR-23a-induced malignant phenotypes of gastric adenocarcinoma appear to occur through the down-regulation of IRF1 expression. An increase in miR-23a expression and a concomitant decrease in IRF1 expression in gastric adenocarcinoma cells appear to contribute to the tumorigenesis of gastric adenocarcinomas.

Materials and Methods

Human cancer tissue samples and RNA isolation

Fresh frozen human gastric adenocarcinoma tissue samples and matched normal gastric tissue samples were obtained from the Tumor Bank Facility of Tianjin Medical University Cancer Institute and Hospital and from the National Foundation for Cancer Research. The detailed information of gastric samples is shown in Table S1. The subtype of each tumor was confirmed by histological analysis. All human materials were used in accordance with the policies of our Institutional Review Board. RNA extraction from cells or tissue samples was performed by using the mirVana miRNA Isolation Kit (Ambion), according to the manufacturer's instructions. Large RNAs (larger than 200 nt) and small RNAs (smaller than 200 nt) were separated and purified by this procedure. The integrity of the large RNAs was confirmed by 1% denatured agarose gel electrophoresis.

Plasmid construction

The construction of the pcDNA3/pri-miR-23a (pri-miR-23a) plasmid was described in our previous published study [22]. We also commercially synthesized a 2′-O-methyl-modified antisense oligonucleotide for miR-23a (ASO-23a) (GenePharm, Shanghai, China). The sequence of the ASO-23a construct used in this study was listed in Table 1. The enhanced green fluorescence protein (EGFP) expression vector (pcDNA3/EGFP) was provided by our lab. The 3′UTR fragment of the IRF1 gene containing the predicted miR-23a binding site was amplified by PCR using the primers listed in Table 1. PCR products were cloned into the pcDNA3/EGFP plasmid between the BamHI and EcoRI restriction sites. The resulting vector was named pcDNA3/EGFP - IRF1 3′UTR. Moreover, a mutant fragment of the IRF1 3′UTR, containing a mutated miR-23a binding site, was amplified by PCR site-directed mutagenesis and was cloned into the pcDNA3/EGFP plasmid between the BamHI and EcoRI restriction sites (pcDNA3/EGFP - IRF1 3′UTR-mut). All insertions were confirmed by sequencing. To construct the pSilencer/shRNA-IRF1 (sh-IRF1) vector, a 70-bp double-stranded fragment, which was designed to contain BamHI and HindIII restriction sites at the ends, was obtained via an annealing step using the two single-stranded sequences listed in Table 1. The fragment was then cloned into the pSilencer2.1/neo vector (Ambion) between the BamHI and HindIII sites. The pcDNA3 vector was used to generate an IRF1 over-expression plasmid. The full-length human IRF1 cDNA sequence (GenBank TM, NM_017423.2) was amplified by PCR using cDNA isolated from HL60 cells in which IRF1 expression is rich,as the template and the primers listed in Table 1, and then the IRF1 cDNA gene was cloned into the EcoRI and XhoI restriction sites.
Table 1

Oligonucleotides used in this study.

nameSequence (5′---- 3′)
pri-miR-23a forward5′ – GCGAGATCTGGCTCCTGCATATGAG – 3′
pri-miR-23a reverse5′ – GATGAATTCCAGGCACAGGCTTCGG – 3′
ASO-23a5′ – GGAAATCCCTGGCAATGTGAT – 3′
ASO-NC5′ – GTGGATATTGTTGCCATCA – 3′
IRF1-3′UTR-S5′ – CGCGGATCCAGAAAAGCATAACACCAATCC – 3′
IRF1-3′UTR-A5′ – CGGAATTCGTGGCAAGATCCACACCGA – 3′
IRF1-3′UTR-MS5′ – CCAAAGCCAGTGATAAGAGTGAAAGTGGG – 3′
IRF1-3′UTR-MA5′ – CCCACTTTCCTACTCTTATCACTGGCTTTGG – 3′
IRF1-S-EcoRI5′ – CGGAATTCGCCAACATGCCCATCACTCGG – 3′
IRF1-AS-XhoI5′ – CCAGGCTCGAGGCTACGGTGCACAGGGAATG – 3′
IRF1-qPCR-S:5′ ACATTCCTGTCATAGGAAC 3′
IRF1-qPCR-AS:5′ GCCTCAAAACTTAACACTC 3′
IRF1-siR-Top5′ – GATCCGCTGAGGACATCATGAAGCTTTCAAGAGAAGCTTCATGATGTCCTCAGTTTTTTGGAAA – 3′
IRF1-siR-Bot5′ – AGCTTTTCCAAAAAACTGAGGACATCATGAAGCTTCTCTTGAAAGCTTCATGATGTCCTCAGCG – 3′
β-Actin-S5′ – CGTGACATTAAGGAGAAGCTG – 3′
β-Actin-A5′ – CTAGAAGCATTTGCGGTGGAC – 3′
miR-23a-RT5′ – GTCGTATCCAGTGCAGGGTCCGAGGTGCACTGGATACGACGGAAATCC – 3′
miR-23a forward5′ – TGCGGATCACATTGCCAGG – 3′
U6 RT5′ – GTCGTATCCAGTGCAGGGTCCGAGGTGCACTGGATACGACAAAATATGG – 3′
U6 forward5′ – TGCGGGTGCTCGCTTCGGCAGC – 3′
U6 Reverse5′ – CCAGTGCAGGGTCCGAGGT – 3′
GAPDH-S5′ – GCGAATTCCGTGTCCCCACTGCCAACGTGTC – 3′
GAPDH-AS5′ – GCTACTCGAGTTACTCCTTGGAGGCCATGTGG – 3′

Real-time PCR

Real-time PCR was performed to detect the level of miR-23a in the tissue samples. Two micrograms of small RNA extracted from the tissue samples were reverse transcribed to cDNA using M-MLV reverse transcriptase (Promega, Madison, WI), and the primers (miR-23a RT and U6 RT), which can fold into a stem-loop structure, are shown in Table 1. The cDNA was used for the amplification of mature miR-23a and an endogenous control U6 snRNA through PCR. The PCR cycling conditions used were as follows: 94°C for 3 min followed by 40 cycles of 94°C for 30 s, 56°C for 30 s, and 72°C for 30 s. To quantify IRF1 gene expression, 5 µg of RNA extracted from cells or tissue samples was reverse transcribed to cDNA using the M-MLV reverse transcriptase. The cDNA was used for the PCR amplification of IRF1 and the endogenous control gene β-actin. The PCR cycling conditions used were as follows: 94°C for 3 min followed by 40 cycles of 94°C for 30 s, 58°C for 30 s, and 72°C for 30 s. The SYBR Premix Ex Taq™ kit (TaKaRa, Otsu, Shiga, Japan) was used to measure the amplified DNA, and real-time PCR was performed using an iQ5 real-time PCR detection system (Bio-Rad). The relative gene expression levels were calculated using the 2−ΔΔct method [23]. All primers were purchased from AuGCT, Inc. (Beijing, China), and the sequences of the primers used are shown in Table 1.

Cell culture and transfection

The human gastric adenocarcinoma cell lines MGC803 and BGC823 were obtained commercially from the Cell Bank of Type Culture Collection of Chinese Academy of Sciences, Shanghai Institute of Cell Biology, Chinese Academy of Sciences. They were maintained in RPMI1640 (GIBCO BRL, Grand Island, NY, USA) and were supplemented with 10% fetal bovine serum (FBS), 100 IU/mL penicillin and 100 µg/mL streptomycin. The cell lines were incubated at 37°C in a humidified chamber supplemented with 5% CO2. Transient transfections were performed in this study using the Lipofectamine 2000 Reagent (Invitrogen, Carlsbad, CA, USA), according to the manufacturer's suggested protocol. Oligonucleotides were used at a final concentration of 100 nM, and plasmids were used at a final concentration of 5 ng/ µL. Approximately 2×104 cells were seeded in a 48-well plate one day before transfection. Cells were approximately 65% confluent at the time of transfection. Both oligonucleotides and plasmids were incubated in antibiotic-free Opti-MEM medium (Invitrogen, Carlsbad, CA, USA). To monitor the transfection efficiency, we transfected pcDNA3-EGFP as well as the control pcDNA3 into the two cell lines and observed the cells for EGFP expression 48 h after transfection by fluorescence microscopy. When we used more than one construct, we used the total amount of DNA as a reference to determine the transfection efficiency. As expected, the transfection efficiency was approximately 60–70%.

Fluorescent report assay

MGC803 cells (approximately 2×104 cells) were transfected in 48-well plates with 0.2 µg per well of the IRF1 EGFP reporter vector with wild-type or mutated 3′UTR. The cells were also cotransfected with 20 pmol of miR-23a ASO or 0.2 µg of pcDNA3/pri-23a per well. The assay was normalized to cells transfected with 0.05 µg per well of the red fluorescent protein expression vector pDsRed2-N1 (Clontech, Mountain View, CA, USA). Forty-eight hours after transfection, cells that were approximately 80–90% confluence were lysed in lysis buffer (0.15 M NaCl, 0.05 M Tris-HCl pH 7.2, 1% Triton X-100, and 0.1% SDS). Each experimental group was conducted in triplicate. The fluorescence intensities of EGFP and the red fluorescent protein were detected using a Fluorescence Spectrophotometer F-4500 (Hitachi, Tokyo, Japan).

MTT and colony formation assays

Cells were transfected with 100 nM ASO or 5 ng/µL of each plasmid as described above. Cells were then trypsinized, counted, and seeded 24 h after transfection in a 96-well plate at a concentration of 4000 cells per well in 100 µL of cell culture medium. The cells were incubated at 37°C in the presence of 5% CO2. After incubation for 48 h and 72 h, the cells reached approximately 40–50% confluence and were incubated with 10 µL of MTT (at a final concentration of 0.5 mg/mL) at 37°C for 4 h. The medium was removed and the precipitated formazan was dissolved in 100 µL of DMSO. After shaking for 10 min, the absorbance at 570 nm was detected using an lQuant Universal Microplate Spectrophotometer (Bio-tek Instruments). Each group was repeated in triplicate. After transfection with 100 nM of ASO or 5 ng/µL of each plasmid, the cells were trypsinized, counted, and seeded for a colony formation assay in 12-well plates at concentrations of 300 BGC823 cells and 200 MGC803 cells per well. During colony growth, the culture medium was replaced every three days. A colony was counted if it was composed of more than 50 cells, and the number of colonies was determined on the 10th day for MGC803 and the 14th day for BGC823 after seeding. Before counting, 300 µL of crystal violet staining solution was added to each well to stain the colonies purple. Each group was repeated in triplicate.

TUNEL assay

The terminal deoxynucleotidyl transferase-mediated dUTP nick end-labeling (TUNEL) assay was carried out using the In-Situ Cell Death Detection Kit (Roche Diagnostics Corporation, Indianapolis, IN, USA). Cells were transfected with 100 nM ASO or 5 ng/µL of each plasmid, as described previously. Cells were then trypsinized, counted, and seeded at 5000 cells per well 24 h after transfection in 14-well plates. Each group was conducted in triplicate. Then, the cells (approximately 70–80% confluence) were treated with 0.5 ppc paclitaxel for 1 h and were fixed with paraformaldehyde (4% in PBS, pH 7.4). The cells were then incubated in permeabilization solution (0.1% TritonX-100 in 0.1% sodium citrate) for 2 minutes on ice. After washing the cells, 4 µL of the TUNEL reaction mixture (3.6 µL of the labeling solution and 0.4 µL of the enzyme solution) was added to each well. The slide was incubated for 60 minutes at 37°C in the dark, and then TUNEL reactions were then performed according to the manufacturer's suggested protocol. DAPI (4, 6- diamidino-2- phenylindole, Dojindo Molecular Technologies, Inc., Japan) was used to stain the nuclei. Fluorescence images were observed using a Nikon Digital sight DS-U1 scanning microscope (Nikon, Tokyo, Japan). The images were superimposed using NIS Elements F 2.20 imaging software (Nikon, Tokyo, Japan).

Western blot analysis

Cells were transfected with 100 nM ASO or 5 ng/µL of each plasmid, and 72 h later, the cells (approximately 80%–90% confluence) were lysed with RIPA lysis buffer and the proteins were harvested. The protein concentration of cell lysates was determined using BCA regents from Promega. Approximately 25 ug/lane of proteins was resolved by SDS-denatured polyacrylamide gel electrophoresis and was then transferred onto a nitrocellulose membrane. Membranes were incubated overnight at 4°C with anti-IRF1 (1∶200) and anti-tubulin (1∶1000). Membranes were washed and incubated with horseradish peroxidase (HRP)-conjugated goat anti-rabbit secondary antibodies (1∶1000). Protein expression was observed by incubating the membranes with enhanced chemiluminescence and exposing the membranes to autoradiographic film. LabWorks™ Image Acquisition and Analysis Software (UVP) were used to quantify the band intensities. The rabbit anti-IRF1 and anti-Tubulin antibodies were purchased from Saier Inc. (Tianjin, China).

Bioinformatics methods and statistical analysis

The miRNA targets predicted by computer-aided algorithms were obtained from PicTar (http://pictar.bio.nyu.edu/cgi-bin/PicTar_vertebrate.cgi) and TargetScan Release 4.0 (http://www.targetscan.org). The two-tailed Student's t test was used to assess statistical significance where appropriate. The threshold for statistical significance was set at a p-value less than 0.05.

Results

miR-23a promotes cell proliferation and suppresses paclitaxel-induced apoptosis of gastric adenocarcinoma cells

Human gastric adenocarcinoma cells were transfected with pcDNA3, pri-miR-23a, ASO-23a or ASO-NC. In BGC823 cells quantitative real-time PCR was performed to validate the efficiency of pri-miR-23a or ASO-23a compared to the controls, pcDNA3 and ASO-NC (Fig. 1A). The MTT assay was performed to determine the effects of miR-23a on cell viability. We observed that pri-miR-23a could increase cell viability by 24%±0.6% (p = 0.0003) and 20%±2.1% (p = 0.0014) in MGC803 and BGC823 cells, respectively, compared to the control pcDNA3 group. In contrast, ASO-23a reduced the cell viability of MGC803 cells to 71%±3.2% (p = 0.0415) and reduced that of BGC823 cells to 83%±7.3% (p = 0.0456) (Fig. 1B). To determine the effects of miR-23a on the long-term and independent growth activity, we performed colony formation assays. Compared with the control group, the colony formation ability of MGC803 cells showed a 1.33-fold (p = 0.0037) increase in the pri-miR-23a group and a 77%±3.8% (p = 0.0004) decrease in the ASO-23a group (Fig. 1C). In consonance with these findings, we observed the same effect in BGC823 cells. The colony formation ability of BGC823 cells was increased 1.81-fold (p = 0.0312) in the pri-miR-23a group and that of BGC823 cells was reduced to 52%±4.7% (p = 0.0065) in the ASO-23a group (Fig. 1C). Given that miR-23a can promote cell growth viability and colony formation ability, we also performed TUNEL assays to determine the effect of miR-23a expression on paclitaxel-induced apoptosis.
Figure 1

Biological effects of the over-expression or knockdown of miR-23a in human gastric adenocarcinoma cells.

Cells were transfected with pcDNA3, pri-miR-23a, ASO-NC or ASO-23a. (A) RNA was extracted from the transfected BGC823 cells, and the expression of miR-23a was measured by real-time PCR (n = 3, * p<0.05). (B) The cell viability of MGC803 and BGC823 cells was determined by MTT assay 72 h after transfection (n = 3, * p<0.05; *** p<0.001). (C) Cell clonogenicity was measured by the colony formation assay. MGC803 cells were cultivated for 10 days, and BGC823 cells were cultivated for 14 days. The photos depict the stained colonies (n = 3,* p<0.05; ** p<0.01; *** p<0.001).

Biological effects of the over-expression or knockdown of miR-23a in human gastric adenocarcinoma cells.

Cells were transfected with pcDNA3, pri-miR-23a, ASO-NC or ASO-23a. (A) RNA was extracted from the transfected BGC823 cells, and the expression of miR-23a was measured by real-time PCR (n = 3, * p<0.05). (B) The cell viability of MGC803 and BGC823 cells was determined by MTT assay 72 h after transfection (n = 3, * p<0.05; *** p<0.001). (C) Cell clonogenicity was measured by the colony formation assay. MGC803 cells were cultivated for 10 days, and BGC823 cells were cultivated for 14 days. The photos depict the stained colonies (n = 3,* p<0.05; ** p<0.01; *** p<0.001). Cells were transfected with pcDNA3, pri-miR-23a, ASO-23a or ASO-NC. The over-expression of miR-23a suppresses paclitaxel-induced apoptosis of MGC803 and BGC823 cells (Fig. 2A and 2B). Conversely, blocking miR-23a promotes paclitaxel-induced apoptosis in MGC803 and BCG823 cells (Fig. 2A and 2B). Compared with the control group, the induced-apoptosis index of MGC803 cells was reduced to approximately 62%±0.8% (p<0.05) in the pri-miR-23a group, and the induced-apoptosis index was increased 1.69-fold (p<0.01) in the ASO-23a group. As expected, we obtained consistent results in BGC823 cells. The induced-apoptosis index of BGC823 cells was reduced to 54%±1% (p<0.05) in the pri-miR-23a group and was increased to 1.78-fold (p<0.01) in the ASO-23a group (Fig. 2C). These results indicate that miR-23a can repress paclitaxel-induced apoptosis and promote cell viability, which are the long-term growth ability and the independent growth ability of MGC803 and BGC823 cells.
Figure 2

The effects of over-expression or knockdown of miR-23a in MGC803 and BGC823 cells on paclitaxel-induced apoptosis.

MGC803 (A) and BGC823 (B) cells were transfected with pcDNA3, pri-miR-23a, ASO-NC or ASO-23a. Paclitaxel (0.5 ppc) was added to the cells to induce cell apoptosis, and apoptotic cells were detected by the TUNEL assay 48 h after transfection. (C) The induced-apoptosis indexes were expressed quantitatively (n = 3, *p<0.05, **p<0.01).

The effects of over-expression or knockdown of miR-23a in MGC803 and BGC823 cells on paclitaxel-induced apoptosis.

MGC803 (A) and BGC823 (B) cells were transfected with pcDNA3, pri-miR-23a, ASO-NC or ASO-23a. Paclitaxel (0.5 ppc) was added to the cells to induce cell apoptosis, and apoptotic cells were detected by the TUNEL assay 48 h after transfection. (C) The induced-apoptosis indexes were expressed quantitatively (n = 3, *p<0.05, **p<0.01).

IRF1 is directly targeted by miR-23a

The up-regulated miRNAs, such as miR-23a, may function as oncogenes and may promote tumor growth by suppressing their target genes. Therefore, we used bioinformatic analysis methods to predict potential target genes that could mediate the cell growth functions of miR-23a. In our previous study, we demonstrated that IL6R is a target gene of miR-23a [22]. The tumor suppressor IRF1 appears to be another possible target gene of miR-23a, which is consistent with a model whereby miR-23a is an oncogenic miRNA that promotes tumor development by targeting and negatively regulating tumor suppressors. The 3′UTR of IRF1 mRNA contains miR-23a complementary binding sites, and these binding sites are conserved among several species (Fig. 3A). To determine whether miR-23a represses IRF1 expression by binding directly to its 3′UTR, we first used various algorithms to predict potential miR-23a binding sites in the 3′UTR of IRF1 (Fig. 3A). To confirm whether miR-23a can bind to the target site in IRF1 3′UTR directly, we constructed an enhanced green fluorescence protein reporter vector (EGFP-IRF1 3′UTR), in which the predicted target regions were inserted downstream of the EGFP coding region. MGC803 cells were co-transfected with the reporter vector and either pcDNA3, pri-miR-23a, ASO-NC or ASO-23a. As shown in Figure 3B, the relative intensity of EGFP was increased in the ASO-23a-transfected cells and was decreased in the pri-miR-23a group relative to the negative control group. Similarly, we constructed another EGFP reporter vector (EGFP-IRF1 3′UTR mutant) containing mutations in the miR-23a binding sites (Fig. 3A). Our results show that neither ASO-23a nor pri-miR-23a affects the intensity of the EGFP-IRF1 3′UTR mutant (Fig. 3C). These observations suggest that miR-23a binds directly to the 3′UTR of IRF1 and represses IRF1 expression.
Figure 3

IRF1 is directly repressed by miR-23a.

(A) As predicted by the TargrtScan and PicTar database, the IRF1 3′UTR contained a miR-23a binding site. The mutated IRF1 3′UTR containing several mutated nucleotides within the miR-23a binding site is shown. (B) The direct interaction of miR-23a and IRF1 3′UTR was confirmed by using a fluorescent reporter assay. MGC803 cells were transfected with the EGFP-IRF1 3′UTR reporter gene together with pcDNA3, pri-miR-23a, ASO-NC or ASO-23a. The cells were lysed 72 h after transfection, and the EGFP intensity was measured by spectrophotometry (n = 3, * p<0.05). (C) MGC803 cells were transfected with the EGFP vector, the IRF1 3′UTR reporter or the mutant EGFP-3′UTR reporter in addition to pcDNA3, pcDNA3/pri-miR-23a, ASO-NC or ASO-23a. The fluorescence intensity was detected through the method described previously (n = 3, * p<0.05). (D) MGC803 and BGC823 cells were transfected with pcDNA3, pcDNA3/pri-miR-23a, ASO-NC or ASO-23a. RNA was extracted from the transfected cells, and the expression of IRF1 mRNA was measured by real-time PCR (n = 3, * p<0.05). (E) We determined the protein expression level of IRF1 in MGC803 and BGC823 cells by western blot. The numerals above the western blot image show the ratios of the densitometry of IRF1 and GAPDH when compared with the control group.

IRF1 is directly repressed by miR-23a.

(A) As predicted by the TargrtScan and PicTar database, the IRF1 3′UTR contained a miR-23a binding site. The mutated IRF1 3′UTR containing several mutated nucleotides within the miR-23a binding site is shown. (B) The direct interaction of miR-23a and IRF1 3′UTR was confirmed by using a fluorescent reporter assay. MGC803 cells were transfected with the EGFP-IRF1 3′UTR reporter gene together with pcDNA3, pri-miR-23a, ASO-NC or ASO-23a. The cells were lysed 72 h after transfection, and the EGFP intensity was measured by spectrophotometry (n = 3, * p<0.05). (C) MGC803 cells were transfected with the EGFP vector, the IRF1 3′UTR reporter or the mutant EGFP-3′UTR reporter in addition to pcDNA3, pcDNA3/pri-miR-23a, ASO-NC or ASO-23a. The fluorescence intensity was detected through the method described previously (n = 3, * p<0.05). (D) MGC803 and BGC823 cells were transfected with pcDNA3, pcDNA3/pri-miR-23a, ASO-NC or ASO-23a. RNA was extracted from the transfected cells, and the expression of IRF1 mRNA was measured by real-time PCR (n = 3, * p<0.05). (E) We determined the protein expression level of IRF1 in MGC803 and BGC823 cells by western blot. The numerals above the western blot image show the ratios of the densitometry of IRF1 and GAPDH when compared with the control group. To examine whether miR-23a antagonizes endogenous IRF1 expression, quantitative real-time PCR and western blot analyses were performed to detect IRF1 mRNA and protein expression. We transfected MGC803 and BGC823 cells with pri-miR-23a, ASO-23a, pcDNA3 or ASO-NC. When miR-23a expression was inhibited, IRF1 mRNA levels increased, whereas when miR-23a was over-expressed, IRF1 mRNA levels were decreased relative to the control group (Fig. 3D). To confirm the results obtained above, we also analyzed the protein expression level of IRF1 in the above four groups. As expected, the results of the protein expression analysis were consistent with the quantitative real-time PCR results. The IRF1 protein level of pri-miR-23a-transfected cells decreased 0.56 fold in MGC803 cells and 0.66 fold in BGC823 cells relative to the control-transfected cells (Fig. 3E). Conversely, IRF1 expression in ASO-23a-transfected cells showed a 1.55-fold increase in MGC803 cells and a 1.44-fold increase in BGC823 cells relative to the ASO-NC groups (Fig. 3E). Collectively, these results suggest that miR-23a regulates endogenous IRF1 expression at the post-transcriptional level.

Inverse expression of miR-23a and IRF1 in gastric adenocarcinoma tissues

In a previous study from our lab, we showed that miR-23a is up-regulated in gastric adenocarcinomas based on oligonucleotide microarrays. To further confirm the up-regulation of miR-23a in gastric adenocarcinomas, quantitative real-time PCR was applied to detect the expression level of miR-23a in 9 pairs of gastric adenocarcinoma tissue samples and matched normal gastric tissue samples. The results showed that miR-23a was remarkably up-regulated in gastric adenocarcinoma tissue samples (Fig. 4A). The relative expression levels of miR-23a in 9 pairs of gastric adenocarcinoma tissue samples were 7.89, 2.22, 2.06, 37.44, 7.09, 5.49, 7.09, 0.64 and 0.76 (p<0.05), respectively, compared to matched normal gastric tissue samples (Fig. 4A). We also detected the expression level of IRF1 mRNA in these samples. Fig. 4B shows that IRF1 mRNA is consistently down-regulated in gastric adenocarcinoma tissue samples when compared with the matched normal gastric tissue samples. The relative expression levels of IRF1 mRNA in 9 pairs of gastric adenocarcinoma tissue samples were 0.17, 1.14, 0.27, 0.19, 0.20, 0.84, 0.38, 1.00 and 0.03 (p<0.05), respectively, compared with the matched normal gastric tissue samples (Fig. 4B). To further confirm the IRF1 level in tissues, we utilized an immunohistochemistry assay to detect the IRF1 expression level in these tissues. As shown in Figure 4C, the expression levels of IRF1 in cancer tissues were significantly lower than those in matched normal tissues. Thus, these results provide strong evidence that miR-23a is prominently over-expressed in gastric adenocarcinomas, and the expression of IRF1 in gastric adenocarcinomas is much lower than normal, which supports the hypothesis that miR-23a negatively regulates IRF1 in gastric adenocarcinoma tissues.
Figure 4

Differential expressions of miR-23a and IRF1 in gastric adenocarcinoma tissues and matched normal tissues.

(A) The expression of miR-23a was detected by real-time PCR in 9 pairs of gastric adenocarcinoma tissue and the corresponding adjacent normal tissue. U6 RNA was included as an endogenous housekeeping gene, and the relative miR-23a expression is shown (n = 9, p<0.05). (B) The expression of IRF1 mRNA was detected by real-time PCR, and β-actin was used as an endogenous control (n = 9, p<0.05). (C) The expression of IRF1 in gastric adenocarcinoma tissues and matched normal tissues by immunohistochemistry (n = 9, p<0.05).

Differential expressions of miR-23a and IRF1 in gastric adenocarcinoma tissues and matched normal tissues.

(A) The expression of miR-23a was detected by real-time PCR in 9 pairs of gastric adenocarcinoma tissue and the corresponding adjacent normal tissue. U6 RNA was included as an endogenous housekeeping gene, and the relative miR-23a expression is shown (n = 9, p<0.05). (B) The expression of IRF1 mRNA was detected by real-time PCR, and β-actin was used as an endogenous control (n = 9, p<0.05). (C) The expression of IRF1 in gastric adenocarcinoma tissues and matched normal tissues by immunohistochemistry (n = 9, p<0.05).

IRF1 represses cell proliferation and promotes paclitaxel-induced apoptosis in gastric adenocarcinoma cells

Previous studies have shown that IRF1 plays an important role in suppressing tumor cell proliferation and functions as a tumor suppressor. Accordingly, to further confirm that miR-23a promotes the growth of gastric adenocarcinoma cells by down-regulating IRF1, we constructed pSilencer/sh-IRF1 plasmids to knockdown the expression of IRF1. We also constructed the expression vector pCD3/IRF1, which lacks a 3′UTR and is thus not subjected to miR-23a regulation. Quantitative real-time PCR and western blot analysis were used to confirm IRF1 expression in transfected MGC803 and BGC823 cells. Our results show that pSilencer/sh-IRF1 effectively suppresses both the mRNA and protein expression of IRF1. The IRF1 mRNA level of sh-IRF1-transfected cells decreased to 62%±2% (p<0.05) in MGC803 cells and 52%±1.5% (p<0.05) in BGC823 cells relative to the control cells (Fig. 5A). The knockdown of IRF1 caused a 45%±1.2% (p<0.01) or 55%±2.1% (p<0.01) reduction in the protein expression of IRF1, respectively, in MGC803 cells and BGC823 cells (Fig. 5B). Furthermore, pcDNA3/IRF1 significantly increased the protein expression level of IRF1. The over-expression of IRF1 caused a 1.88-fold (p<0.01) increase in IRF1 protein expression in MGC803 cells and a 1.44-fold (p<0.01) increase in IRF1 protein expression in BGC823 cells (Fig. 5B).
Figure 5

Knockdown or over-expression of IRF1 alters the growth and colony formation ability of gastric adenocarcinoma cells.

The two cell lines MGC803 and BGC823 were transfected with pSilencer/sh-IRF1, pcDNA3/IRF1 or the appropriate control vectors. (A) Real-time PCR was performed to detect the efficiency of pSilencer/sh-IRF1 (n = 3, * p<0.05). RNA was extracted 48 h after transfection. (B) The IRF1 protein expression level of the transfected MGC803 and BGC823 cells was detected by western blot analysis. The numerals above the western blot image show the ratio of the densitometry of IRF1 and GAPDH when compared with the control. (C) The cell growth viability of the two cell lines was determined by the MTT assay 72 h after transfection (n = 3, *** p<0.001). (D) Cell clonogenicity was measured by colony formation assay. MGC803 cells were grown for 10 days, and BGC823 cells were grown for 14 days. The images represent the stained colonies (n = 3,* p<0.05).

Knockdown or over-expression of IRF1 alters the growth and colony formation ability of gastric adenocarcinoma cells.

The two cell lines MGC803 and BGC823 were transfected with pSilencer/sh-IRF1, pcDNA3/IRF1 or the appropriate control vectors. (A) Real-time PCR was performed to detect the efficiency of pSilencer/sh-IRF1 (n = 3, * p<0.05). RNA was extracted 48 h after transfection. (B) The IRF1 protein expression level of the transfected MGC803 and BGC823 cells was detected by western blot analysis. The numerals above the western blot image show the ratio of the densitometry of IRF1 and GAPDH when compared with the control. (C) The cell growth viability of the two cell lines was determined by the MTT assay 72 h after transfection (n = 3, *** p<0.001). (D) Cell clonogenicity was measured by colony formation assay. MGC803 cells were grown for 10 days, and BGC823 cells were grown for 14 days. The images represent the stained colonies (n = 3,* p<0.05). The MTT assay was used to determine the effect of IRF1 expression on cell viability. The knockdown of IRF1 showed an increase in cell viability, whereas the over-expression of IRF1 decreased the cell viability (Fig. 5C). The cell viability of sh-IRF1-transfected cells increased 1.39-fold (p = 0.0004) in MGC803 cells and 1.66-fold (p<0.0001) in BGC823 cells relative to the control cells. Conversely, the cell viability of IRF1-transfected cells showed a 0.86-fold (p = 0.0003) decrease in MGC803 cells and a 0.80-fold (p = 0.0008) decrease in BGC823 cells relative to the pcDNA3 groups (Fig. 5C). The colony formation assay was performed to detect the long-term and independent cell growth ability of these cells upon modulating IRF1 expression. The knockdown of IRF1 expression showed a 1.39-fold (p = 0.0238) increase in MGC803 cells and a 1.66-fold (p = 0.0002) increase in BGC823 cells, whereas the over-expression of IRF1 caused a 51%±5.7% (p = 0.0028) decrease in the clonogenicity of MGC803 cells and a 59%±3.4% (p = 0.0001) decrease in that of BGC823 cells (Fig. 5D). Next, the TUNEL assay was used to detect paclitaxel-induced apoptosis in gastric adenocarcinoma cell lines. Compared to the control group, the over-expression of miR-23a suppressed paclitaxel-induced apoptosis in MGC803 and BGC823 cells, whereas the knockdown of miR-23a caused the opposite results (Fig. 6A and 6B). The induced-apoptosis index of MGC803 cells was reduced 37%±5.1% (p<0.01) in the sh-IRF1 group and increased 2.32-fold (p<0.01) in the IRF1 group. Similar results were observed in BGC823 cells. Compared with the control group, the induced-apoptosis index of BGC823 cells was reduced 59%±1.2% (p<0.05) in the sh-IRF1 group and was increased 1.84-fold (p<0.05) in the IRF1 group (Fig. 6C). These data indicate that IRF1 represses cell proliferation and promotes paclitaxel-induced apoptosis in gastric adenocarcinoma cell lines. Ultimately, IRF1 appears to play the role of a tumor suppressor in the tumorigenesis of gastric adenocarcinomas.
Figure 6

The effects of the over-expression or knockdown of IRF1 in gastric adenocarcinoma cells on paclitaxel-induced apoptosis.

Gastric adenocarcinoma cells were transfected with pSilencer, pSilencer/sh-IRF1, pcDNA3 or pcDNA3/IRF1. Paclitaxel (0.5 ppc) was added to the cells to induce apoptosis, and the TUNEL assay was performed to detect apoptosis in the transfected cells. The images in (A) show the paclitaxel-induced apoptosis of MGC803 cells, and the images in (B) show the paclitaxel-induced apoptosis of BGC823 cells. (C) The induced-apoptosis results are expressed quantitatively (n = 3, *p<0.05, **p<0.01).

The effects of the over-expression or knockdown of IRF1 in gastric adenocarcinoma cells on paclitaxel-induced apoptosis.

Gastric adenocarcinoma cells were transfected with pSilencer, pSilencer/sh-IRF1, pcDNA3 or pcDNA3/IRF1. Paclitaxel (0.5 ppc) was added to the cells to induce apoptosis, and the TUNEL assay was performed to detect apoptosis in the transfected cells. The images in (A) show the paclitaxel-induced apoptosis of MGC803 cells, and the images in (B) show the paclitaxel-induced apoptosis of BGC823 cells. (C) The induced-apoptosis results are expressed quantitatively (n = 3, *p<0.05, **p<0.01).

Restoration of IRF1 expression counteracts the effects of miR-23a

To validate whether the effects of miR-23a expression on cell growth and paclitaxel-induced apoptosis in MGC803 and BGC823 cells are mediated by IRF1, we transfected pri-miR-23a into MGC803 and BGC823 cells along with either the control pcDNA3 or pcDNA3/IRF1. Relative to the control, expression of pcDNA3/IRF1 reversed the negative effects of miR-23a on IRF1 protein expression in MGC803 cells and BGC823 cells (Fig. 7A). The ectopic expression of IRF1 reversed increased in cell viability caused by miR-23a from approximately 1.34-fold (p = 0.0048) to 0.74-fold (p = 0.0005) in MGC803 cells and from 1.41-fold (p<0.0001) to 1.01-fold (p<0.0001) in BGC823 cells compared to control group (Fig. 7B). Similar results were observed in the colony formation assay (Fig. 7C). The ectopic expression of IRF1 also counteracted the inhibition of paclitaxel-induced apoptosis caused by miR-23a expression in the TUNEL assay (Fig. 8 A and 8B). Relative to the control vector, the expression of the pcDNA3/IRF1 construct reversed the negative effects of miR-23a on paclitaxel-induced apoptosis from approximately 42%±8% (p<0.05) to 89%±9% (p<0.05) in MGC803 cells and approximately from 39%±7% (p<0.05) to 92%±8% (p<0.05) in BGC823 cells (Fig. 8C). These results suggest that IRF1 is a tumor suppressor, functions as a target of miR-23a and is involved in the miR-23a–mediated malignant phenotype of gastric adenocarcinoma cells.
Figure 7

Restoration of IRF1 counteracts the miR-23a-induced cellular phenotypes in gastric adenocarcinoma cells.

MGC803 and BGC823 cells were co-transfected with pri-23a and either pcDNA3-IRF1or pcDNA3; the pcDNA3 group was used as the control. (A) Proteins were extracted 48 h after transfection, and western blot analysis was used to detect IRF1 protein expression. The numerals above the western blot image show ratios of the densitometry of IRF1 and GAPDH when compared with the control. (B) The cell growth viability of BGC823 cells was determined by MTT assay at 72 h after transfection. (C) Cell clonogenicity was measured by colony formation assay. Pictures under the graph show the stained colonies (n = 3,* p<0.05).

Figure 8

Restoration of IRF1 counteracts the effect of miR-23a on paclitaxel-induced apoptosis in gastric adenocarcinoma cells.

MGC803 and BGC823 cells were co-transfected with pcDNA3-IRF1 and either pri-23a or pcDNA3. Paclitaxel (0.5 ppc) was added to the cells after transfection to induce apoptosis. The TUNEL assay was then performed to detect paclitaxel-induced apoptosis in the transfected cells. The photos in Figure 8A show apoptotic MGC803 cells. The photos in Figure 8B show apoptotic BGC823 cells. (C) The induced-apoptosis results were expressed quantitatively (n = 3, *p<0.05, **p<0.01).

Restoration of IRF1 counteracts the miR-23a-induced cellular phenotypes in gastric adenocarcinoma cells.

MGC803 and BGC823 cells were co-transfected with pri-23a and either pcDNA3-IRF1or pcDNA3; the pcDNA3 group was used as the control. (A) Proteins were extracted 48 h after transfection, and western blot analysis was used to detect IRF1 protein expression. The numerals above the western blot image show ratios of the densitometry of IRF1 and GAPDH when compared with the control. (B) The cell growth viability of BGC823 cells was determined by MTT assay at 72 h after transfection. (C) Cell clonogenicity was measured by colony formation assay. Pictures under the graph show the stained colonies (n = 3,* p<0.05).

Restoration of IRF1 counteracts the effect of miR-23a on paclitaxel-induced apoptosis in gastric adenocarcinoma cells.

MGC803 and BGC823 cells were co-transfected with pcDNA3-IRF1 and either pri-23a or pcDNA3. Paclitaxel (0.5 ppc) was added to the cells after transfection to induce apoptosis. The TUNEL assay was then performed to detect paclitaxel-induced apoptosis in the transfected cells. The photos in Figure 8A show apoptotic MGC803 cells. The photos in Figure 8B show apoptotic BGC823 cells. (C) The induced-apoptosis results were expressed quantitatively (n = 3, *p<0.05, **p<0.01).

Discussion

The prior study by Nozawa showed that the loss of functional IRF-1 is critical for the development of human gastric cancers [24]. Consistent to our study, IRF-1 was shown to be a transcription factor which acts as a tumor suppressor in gastric cancer. It also demonstrated the loss of functional IRF1 is critical for the development of human gastric cancers. The loss of heterozygosity (LOH) observed in human gastric cancer strongly suggests the existence of tumor suppressor genes at the concerned locus. The IRF1 locus on chromosome 5q31.1 is one of the common minimal regions of LOH in gastric cancer. A prior study reported a case of gastric adenocarcinoma with a point mutation in the second exon of the IRF1 gene of the residual allele, leading to the production of functionally impaired IRF1 [25]. These alternations are an important mechanism of the IRF1-mediated regulation of carcinogenesis at the gene expression level. However, epigenetic mechanisms have been reported to contribute to the decreased expression of IRF1 in various cancers. Yamashita M et al. proposed that the epigenetic inactivation of IRF1 plays a key role in the tumorigenesis of gastric cancer and that the inhibition of DNA methylation may restore the antitumor activity of interferons through the up-regulation of IRFs [26], [27]. Kondo T et al. reported that a nuclear factor, nucleophosmin (NPM), inhibited the DNA-binding and transcriptional activity of IRF-1 in human cancer development. This mechanism represents an alternative pathway by which IRF1 may be inactivated [28]. Here, we have reported a post-transcriptional mechanism in which miR-23a directly targets IRF1 and down-regulates its expression level in gastric adenocarcinoma cell lines (Fig. 9). This conclusion was arrived at from our findings, which can be summarized in six major points. (a) We combined bioinformatic prediction software including TargetScan, PicTar, miRBase and mirnaviewer, with human gene associations for cell proliferation and apoptosis and compiled the resulting data using the AmiGO website. Interferon regulatory factor 1 was predicted to be a candidate target for further study. (b) We found that miR-23a is up-regulated, whereas IRF1 is down-regulated in gastric adenocarcinoma tissues compared with matched normal tissues. (c) miR-23a negatively regulated IRF1 at both the mRNA and protein level. (d) The expression of the EGFP reporter containing the 3′-UTR of IRF1 was inhibited when miR-23a was over-expressed. (e) The over-expression of IRF1 suppressed cellular proliferation and promoted apoptosis [29], [30]. (f) The expression of IRF1 was sufficient to counteract the miR-23a-mediated promotion of cellular proliferation and the repression of cell apoptosis.
Figure 9

Distinct Mechanisms Used by IRF1 in gastric tumorigenesis

In post-transcription level, IRF1 expression level was suppressed and directly targeted by miR-23a, which plays an important role in tumorigenesis of gastric cancer. IRF1 gene deletion and methylation repressed its expression in gene expression and epigenetic level, respectively.

The results of this study suggest that miR-23a promotes the tumorigenesis of gastric adenocarcinoma by negatively regulating IRF1. As expected, IRF1 can also be regulated by other miRNAs [31]. IRF1 has been shown to be a functional target of hCMV-miR-UL 112 by fluorescent reporter assays [32]. Another study revealed that the down-regulation of miR-383 is associated with male infertility and testicular germ cell tumors through its targeting of IRF1 [33]. In acute promyelocytic leukemia cells, IRF1 expression is associated with miR-342 [34]. We also cannot exclude the possibility that other miRNAs may regulate the expression of IRF1 in gastric cancer cells. In addition to the finding that IRF1 behaves as a tumor suppressor gene in various cancers, it is also involved in the regulation of apoptosis by many pathways. Our study is consistent with previous studies that showed that IRF-1 induced apoptosis in gastric cancer cells [35]. In this study, we performed the TUNEL assay to show that IRF1 can inhibit cellular apoptosis in gastric adenocarcinoma cells. IRF1 has been shown to activate the caspase cascade and induce apoptosis in breast cancer, which can occur in a p53-dependent or p53-independent manner [36]. IRF1 is also known to activate caspase1, caspase3, caspase7, and caspase8 [37], [38].

Distinct Mechanisms Used by IRF1 in gastric tumorigenesis

In post-transcription level, IRF1 expression level was suppressed and directly targeted by miR-23a, which plays an important role in tumorigenesis of gastric cancer. IRF1 gene deletion and methylation repressed its expression in gene expression and epigenetic level, respectively. IRF1 was originally identified as a transcriptional activator in the interferon (IFN) system and has been shown to bind to the promoter regions of IFN α/β. Based on previous studies, a novel anti-cancer mechanism involving IFN-c/IRF1 signaling which down-regulates hTERT expression has been suggested [39]. It is well known that the type I and type II IFNs play important roles in regulating immune responses during bacterial and viral infections. Helicobacter pylori infection is believed to be the cause of most stomach cancer. In more detail, Helicobacter pylori are the main risk factor in 65–80% of gastric cancers [40]. The mucosal inflammatory response to H. pylori infection is complex and IRF1 make a role in this procedure [41]. IRF1 is an activator of IFNs that also has antiviral properties [42]. Epstein-Barr virus (EBV) DNA is found within the malignant cells of 10% of gastric cancers [43]. Schaefer et al. reported that IRF1 and IRF2 can constitutively activate the promoter of the EBV BamHI Q fragment [43], but whether miR-23a-mediated IRF1 suppression is involved in EBV infection in gastric cancer remains unknown. Various evidence has shown a correlation between IRF1 expression and EBV [44], HPV [45], HBV [46], [47], HIV [48] and West Nile virus infections. Whether IRF1 is related to EBV infection in gastric cancer needs further research. In summary, we have demonstrated that miR-23a down-regulates IRF1 expression by targeting the 3′UTR of IRF1 to regulate pro-proliferative and anti-apoptotic activity in gastric cancer cells. This reported role for miR-23a may provide new insight into the tumorigenesis of gastric cancer and suggests that miR-23a may have potential value as a diagnostic and treatment marker in cancers. The information of gastric adenocarcinoma tissues used in this study. (DOC) Click here for additional data file.
  48 in total

1.  IFNgamma restores breast cancer sensitivity to fulvestrant by regulating STAT1, IFN regulatory factor 1, NF-kappaB, BCL2 family members, and signaling to caspase-dependent apoptosis.

Authors:  Yanxia Ning; Rebecca B Riggins; Jennifer E Mulla; Haniee Chung; Alan Zwart; Robert Clarke
Journal:  Mol Cancer Ther       Date:  2010-05       Impact factor: 6.261

2.  DNA methylation of interferon regulatory factors in gastric cancer and noncancerous gastric mucosae.

Authors:  Masaki Yamashita; Minoru Toyota; Hiromu Suzuki; Masanori Nojima; Eiichiro Yamamoto; Seiko Kamimae; Yoshiyuki Watanabe; Masahiro Kai; Hirofumi Akashi; Reo Maruyama; Yasushi Sasaki; Hiroo Yamano; Tamotsu Sugai; Yasuhisa Shinomura; Kohzoh Imai; Takashi Tokino; Fumio Itoh
Journal:  Cancer Sci       Date:  2010-04-02       Impact factor: 6.716

3.  microRNA expression profile in undifferentiated gastric cancer.

Authors:  Takeyasu Katada; Hideyuki Ishiguro; Yoshiyuki Kuwabara; Masahiro Kimura; Akira Mitui; Yoichiro Mori; Ryo Ogawa; Koshiro Harata; Yoshitaka Fujii
Journal:  Int J Oncol       Date:  2009-02       Impact factor: 5.650

4.  Advanced gastric cancer in jordan from 2004 to 2008: a study of epidemiology and outcomes.

Authors:  Salah Y Abbasi; Hani El Taani; Adnan Saad; Ahmed Badheeb; Ala' Addasi
Journal:  Gastrointest Cancer Res       Date:  2011-07

5.  Epigenetic control of IRF1 responses in HIV-exposed seronegative versus HIV-susceptible individuals.

Authors:  Ruey-Chyi Su; Aida Sivro; Joshua Kimani; Walter Jaoko; Francis A Plummer; T Blake Ball
Journal:  Blood       Date:  2011-01-03       Impact factor: 22.113

6.  AMPKα modulation in cancer progression: multilayer integrative analysis of the whole transcriptome in Asian gastric cancer.

Authors:  Yon Hui Kim; Han Liang; Xiuping Liu; Ju-Seog Lee; Jae Yong Cho; Jae-Ho Cheong; Hoguen Kim; Min Li; Thomas J Downey; Matthew D Dyer; Yongming Sun; Jingtao Sun; Ellen M Beasley; Hyun Cheol Chung; Sung Hoon Noh; John N Weinstein; Chang-Gong Liu; Garth Powis
Journal:  Cancer Res       Date:  2012-03-20       Impact factor: 12.701

7.  Smad7 protein induces interferon regulatory factor 1-dependent transcriptional activation of caspase 8 to restore tumor necrosis factor-related apoptosis-inducing ligand (TRAIL)-mediated apoptosis.

Authors:  Suntaek Hong; Hye-Youn Kim; Jooyoung Kim; Huyen Trang Ha; Young-Mi Kim; Eunjin Bae; Tae Hyung Kim; Kang Choon Lee; Seong-Jin Kim
Journal:  J Biol Chem       Date:  2012-12-19       Impact factor: 5.157

8.  Frequent loss of heterozygosity at the interferon regulatory factor-1 gene locus in breast cancer.

Authors:  Luciane R Cavalli; Rebecca B Riggins; Antai Wang; Robert Clarke; Bassem R Haddad
Journal:  Breast Cancer Res Treat       Date:  2009-08-21       Impact factor: 4.872

9.  Interferon regulatory factor-1-induced apoptosis mediated by a ligand-independent fas-associated death domain pathway in breast cancer cells.

Authors:  M T Stang; M J Armstrong; G A Watson; K Y Sung; Y Liu; B Ren; J H Yim
Journal:  Oncogene       Date:  2007-04-23       Impact factor: 9.867

10.  A new molecular network comprising PU.1, interferon regulatory factor proteins and miR-342 stimulates ATRA-mediated granulocytic differentiation of acute promyelocytic leukemia cells.

Authors:  M L De Marchis; M Ballarino; B Salvatori; M C Puzzolo; I Bozzoni; A Fatica
Journal:  Leukemia       Date:  2009-01-08       Impact factor: 11.528

View more
  34 in total

1.  The Mammalian response to virus infection is independent of small RNA silencing.

Authors:  Simone Backes; Ryan A Langlois; Sonja Schmid; Andrew Varble; Jaehee V Shim; David Sachs; Benjamin R tenOever
Journal:  Cell Rep       Date:  2014-06-19       Impact factor: 9.423

2.  Down-regulation of miR-23a inhibits high glucose-induced EMT and renal fibrogenesis by up-regulation of SnoN.

Authors:  Haiping Xu; Fuyun Sun; Xiuli Li; Lina Sun
Journal:  Hum Cell       Date:  2017-07-13       Impact factor: 4.174

Review 3.  miRNA polymorphisms and risk of gastric cancer in Asian population.

Authors:  Hai-Bing Hua; Ting-Ting Yan; Qing-Min Sun
Journal:  World J Gastroenterol       Date:  2014-05-21       Impact factor: 5.742

4.  Oncogenic Ras inhibits IRF1 to promote viral oncolysis.

Authors:  Y Komatsu; S L Christian; N Ho; T Pongnopparat; M Licursi; K Hirasawa
Journal:  Oncogene       Date:  2014-10-27       Impact factor: 9.867

5.  Photodynamic therapy with a novel porphyrin-based photosensitizer against human gastric cancer.

Authors:  Jing-Jing Chen; Li-Jing Gao; Tian-Jun Liu
Journal:  Oncol Lett       Date:  2015-11-23       Impact factor: 2.967

Review 6.  MiRNA as potential biomarkers and therapeutic targets for gastric cancer.

Authors:  Vivian Yvonne Shin; Kent-Man Chu
Journal:  World J Gastroenterol       Date:  2014-08-14       Impact factor: 5.742

Review 7.  Helicobacter pylori infection: host immune response, implications on gene expression and microRNAs.

Authors:  Aline Cristina Targa Cadamuro; Ana Flávia Teixeira Rossi; Nathália Maciel Maniezzo; Ana Elizabete Silva
Journal:  World J Gastroenterol       Date:  2014-02-14       Impact factor: 5.742

8.  AKT/ERK activation is associated with gastric cancer cell resistance to paclitaxel.

Authors:  Gang Wu; Xue-Qian Qin; Jing-Jing Guo; Tian-Yi Li; Jin-Hong Chen
Journal:  Int J Clin Exp Pathol       Date:  2014-03-15

9.  Gastric adenocarcinoma microRNA profiles in fixed tissue and in plasma reveal cancer-associated and Epstein-Barr virus-related expression patterns.

Authors:  Amanda L Treece; Daniel L Duncan; Weihua Tang; Sandra Elmore; Douglas R Morgan; Ricardo L Dominguez; Olga Speck; Michael O Meyers; Margaret L Gulley
Journal:  Lab Invest       Date:  2016-03-07       Impact factor: 5.662

10.  microRNA Function Is Limited to Cytokine Control in the Acute Response to Virus Infection.

Authors:  Lauren C Aguado; Sonja Schmid; David Sachs; Jaehee V Shim; Jean K Lim; Benjamin R tenOever
Journal:  Cell Host Microbe       Date:  2015-12-09       Impact factor: 21.023

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.