Elucidating the Pseudomonas aeruginosa fatty acid degradation pathway: identification of additional fatty acyl-CoA synthetase homologues.

The fatty acid (FA) degradation pathway of Pseudomonas aeruginosa, an opportunistic pathogen, was recently shown to be involved in nutrient acquisition during BALB/c mouse lung infection model. The source of FA in the lung is believed to be phosphatidylcholine, the major component of lung surfactant. Previous research indicated that P. aeruginosa has more than two fatty acyl-CoA synthetase genes (fadD; PA3299 and PA3300), which are responsible for activation of FAs using ATP and coenzyme A. Through a bioinformatics approach, 11 candidate genes were identified by their homology to the Escherichia coli FadD in the present study. Four new homologues of fadD (PA1617, PA2893, PA3860, and PA3924) were functionally confirmed by their ability to complement the E. coli fadD mutant on FA-containing media. Growth phenotypes of 17 combinatorial fadD mutants on different FAs, as sole carbon sources, indicated that the four new fadD homologues are involved in FA degradation, bringing the total number of P. aeruginosa fadD genes to six. Of the four new homologues, fadD4 (PA1617) contributed the most to the degradation of different chain length FAs. Growth patterns of various fadD mutants on plant-based perfumery substances, citronellic and geranic acids, as sole carbon and energy sources indicated that fadD4 is also involved in the degradation of these plant-derived compounds. A decrease in fitness of the sextuple fadD mutant, relative to the ΔfadD1D2 mutant, was only observed during BALB/c mouse lung infection at 24 h.

Introduction

Pseudomonas aeruginosa is an important human pathogen [1], [2] responsible for myriad of infections of the human body [3]–[11]. This ubiquitous bacterium is also a leading cause of mortality and morbidity in patients with cystic fibrosis (CF) [1], [2].

Phosphatidylcholine (PC), the major component of lung surfactant [12], was suggested as a potential nutrient source for pathogenesis during P. aeruginosa infection of the CF lung [13]. The major carbon source within the PC molecule comes from the two highly reduced long-chain fatty acids (LCFA). Many fatty acid degradation (β-oxidation) genes are expressed by P. aeruginosa during CF lung infection (e.g. fadD1: PA3299, fadD2: PA3300, fadA5: PA3013, and fadB5: PA3014) [13] and mutants defective in the fatty acid (FA) degradation pathway were reported to have decreased fitness during mouse lung infection [14]. A link between FA degradation genes and virulence was also observed [14] and P. aeruginosa can chemotax towards FA [15]. Furthermore, FA was shown to modulate type three-secretion system expression in this bacterium [16].

Despite the connection between virulence and FA degradation during infections, not all genes involved in P. aeruginosa FA degradation are characterized (Fig. 1A). In contrast, genes needed by Escherichia coli for aerobic β-oxidation (fadL, fadD, fadE, and fadBA [17]–), anaerobic FA degradation (fadK and fadIJ [21]), and auxiliary genes (fadH [22] and fadM [23]) are well characterized. For an exogenous FA to be degraded by this pathway, it must first be transported by the membrane transporter (FadL) into the cell [24]. FA is then activated with the use of adenosine triphosphate (ATP) and coenzyme A (CoASH) by FadD (fatty acyl-CoA synthetase, FACS) [19], [25]. The activated FA molecule can then proceed through the β-oxidation pathway (Fig. 1A). In E. coli, genes encoding enzymes needed for β-oxidation (fadL, fadD, fadE, and fadBA) are repressed in the absence of FAs by the transcriptional regulator FadR. Acyl-CoA of chain length ≥ C12∶0 can bind to FadR to induce FA degradation [18], [26], [27] resulting in growth on FA (> C10∶0). Cyclic AMP and receptor protein complex levels [28], presence of oxygen [29], and osmotic pressure [30] also affect expression of FA degradation genes in E. coli. However, the existence of a central regulator, such as fadR, is unknown in P. aeruginosa, and only a few fad-genes have been found to be regulated by a FA sensor, PsrA [31].

Figure 1

P. aeruginosa fatty acid degradation pathway (FA degradation).

(A) P. aeruginosa FA degradation model was based on the E. coli β-oxidation pathway. Known P. aeruginosa FA degradation enzyme homologues are indicated by numbers: FadD1 (PA3299), FadD2 (PA3300), FadD3 (PA3860), FadD4 (PA1617), FadD5 (PA2893), FadD6 (PA3924), FadAB1 (PA1736–PA1737), and FadBA5 (PA3013–PA3014). Abbreviations: FadA, 3-ketoacyl-CoA thiolase; FadB, cis-Δ3-trans-Δ2-enoyl-CoA isomerase, enoyl-CoA hydratase, 3-hydroxyacyl-CoA epimerase, and 3-hydroxyacyl-CoA dehydrogenase; FadD, fatty acyl-CoA synthetase; FadE, acyl-CoA dehydrogenase; FadL, outer membrane long-chain fatty acid translocase; OM, outer membrane; IN, inner membrane. (B) Alignment of FadD homologues motifs with E. coli FadD motifs. Amino acids with similar properties are assigned the same colors using CLC Sequence Viewer 6 software (www.clcbio.com).

P. aeruginosa exhibits greater metabolic capabilities for FA degradation than E. coli by growing aerobically on short, medium, and long-chain FAs as sole carbon and energy sources [31]. With a genome of 6.3 Mb, P. aeruginosa could potentially have more FA degradation genes than E. coli [32], suggesting possible redundancies and a higher level of complexity in this pathway. Three potential fadLs have been investigated thus far in P. aeruginosa and their exact role in FA transport still remains unclear [15]. Two fadBA operon homologues (fadAB1 and fadBA5) have been studied so far. The fadAB1 (PA1736 and PA1737) operon was shown to be strongly induced by medium-chain fatty acids (MCFA, C10∶0 and C12∶0) and, to a lesser extent, LCFA (C14∶0–C18∶1 Δ9) [33]. The fadBA5 (PA3014 and PA3013) operon was determined to be involved in LCFA metabolism and to be induced by LCFA, especially oleate (C18∶1 Δ9) [31]. We have recently identified two FACS homologues of P. aeruginosa, fadD1 (PA3299) and fadD2 (PA3300) [14]. The FadD1 and FadD2 of P. aeruginosa were determined to have broad specificity for FA of different chain lengths. FadD1 has preference for LCFA whereas FadD2 has higher activities for shorter chain FAs. fadD1, fadD2, and fadD2D1 mutants showed growth defects when grown on minimal media with different length FAs as sole carbon sources. fadD1 was determined to be induced by LCFA and to be more important for growth on LCFA while fadD2 was important for growth on short-chain fatty acids (SCFA) and was induced by MCFA. The double mutant fadD2D1 displayed an impaired ability to grow on PC as a sole carbon source. This growth defect translated into decreased in vivo fitness during mouse lung infection, indicating that FadD1 and FadD2 may mediate P. aeruginosa replication in the CF lung [14]. However, the double mutant fadD2D1 was still able to grow on FA, suggesting the involvement of other fadD homologues in FA degradation [14].

We surveyed the P. aeruginosa genome for additional fadD homologues to gain more insight into the degradation of FAs in this bacterium. Four new fadD homologues PA1617, PA2893, PA3860, and PA3924 were identified out of 11 potential candidates. Through genetic analyses, their contribution to FA degradation was assessed. The final four candidates were determined to be FACS homologues, but PA1617 (fadD4) was found to be the major contributor to FA degradation. Involvement of the newly discovered fadD4 in catabolism of plant-derived acyclic terpenes suggests that the function of multiple FACS in P. aeruginosa is the degradation of compounds closely related to FAs. Growth defect on PC and decreased fitness in mouse lung of the sextuple fadD mutant supports the role of FA as a nutrient in vivo.

Results

Identification of P. aeruginosa Fatty acyl-CoA Synthetase Homologues

To identify fadD homologues of P. aeruginosa, E. coli FadD amino acid sequence was compared to P. aeruginosa PAO1 ORFs via BLAST [34]. The amino acid sequence of genes obtained in the search were further analyzed for the presence of ATP/AMP [19], [35]–[37] and fatty acid binding motifs [38]. Genes that encode eleven proteins containing amino acid sequences with high degree of similarity to the motifs found in E. coli FadD (Fig. S1) were chosen for complementation tests. Identity and similarity of the proteins range from 22% to 31% and from 37% to 52%, respectively (Table S1). When cloned into a high copy number pUC19 vector, only genes encoding PA3860, PA1617, PA2893, and PA3924 were found to complement the E. coli fadD (E2011) strain on minimal medium containing oleate (C18∶1 Δ9) and decanoate (C10∶0) (Table S1) and were designated fadD3, fadD4, fadD5, and fadD6, respectively. Their ATP/AMP and FA binding motifs show high degree of similarity to those of E. coli FadD (Fig. 1B).

All four P. aeruginosa fadD genes (fadD3, fadD4, fadD5, and fadD6) were tested further for their ability to support growth of E. coli fadD (E2011) on various FAs as a single copy on the E. coli chromosome. The E. coli fadD double mutant was used to ensure that FadR does not inhibit expression of other E. coli β-oxidation enzymes. Mini-Tn7 based complementation vectors were constructed and integrated into the E2011 chromosome at the attTn7 site and resulting strains were tested for growth on FAs (Table 1). As expected, wildtype E. coli control strain K-12 showed growth on longer FAs (C12∶0–C18∶1 Δ9) but not on the MCFA, C10∶0, or SCFAs (C4∶0–C8∶0). The E2011 and the integrated empty-vector control strain were not able to growth on any of the FAs. E2011 complemented with E. coli fadD (fadD) grew on C12∶0–C18∶1 Δ9 comparably to K-12. P. aeruginosa fadD3, fadD4, fadD5, and fadD6 genes individually allowed E2011 to grow on C14∶0–C18∶1 Δ9 to similar levels as K-12. fadD3 and fadD6 complemented E2011 to a lesser degree than fadD4 and fadD5 on C12∶0, and four fadD genes supported minimal growth of E2011 on C10∶0 to the same level as fadD. E2011 complemented with fadD, fadD3, fadD4, fadD5, or fadD6 did not grow on C4∶0–C8∶0, which was in agreement with previous observations that other E. coli FA degradation enzymes do not support metabolism of shorter FAs [39].

Table 1

Single copy complementation of the E.coli fadD mutant with P. aeruginosa fadD homologues.

	Growth on different carbon sources
Strain	C4∶0	C6∶0	C8∶0	C10∶0	C12∶0	C14∶0	C16∶0	C18∶1 Δ9	Glu
K12	–	–	–	–	+4	+5	+5	+5	+6
E2011 (fadD−/fadR− )	–	–	–	–	–	–	–	–	+6
E2011/attTn7::miniTn7-Gmr	–	–	–	–	–	–	–	–	+6
E2011/attTn7::fadDEc	–	–	–	+1	+5	+5	+5	+5	+6
E2011/attTn7::fadD3	–	–	–	+1	+3	+5	+5	+5	+6
E2011/attTn7::fadD4	–	–	–	+1	+5	+5	+5	+5	+6
E2011/attTn7::fadD5	–	–	–	+1	+5	+5	+5	+5	+6
E2011/attTn7::fadD6	–	–	–	+1	+2	+5	+5	+5	+6

Strains were grown on 1x M9 medium +1% (w/v) Brij-58 supplemented with 0.2% (w/v) fatty acids or 20 mM glucose (Glu) +0.25 mM IPTG for three days at 37°C.

– indicates no growth on a patch and+denotes growth.

+1 is very little growth whereas +6 is very heavy growth comparable to K12 on glucose at day 3.

Contribution of fadD3, fadD4, fadD5, and fadD6 to FA Degradation

To determine the role of the fadD homologues (fadD3, fadD4, fadD5, and fadD6) in P. aeruginosa FA degradation, strains with various combinations of fadD mutations were created. To prevent potential masking of phenotypes by fadD1 and fadD2, 15 mutants were constructed in the P. aeruginosa PAO1 ΔfadD1D2 background. Four triple, seven quadruple, four quintuple mutants and one sextuple mutant (Table 2) were tested for growth on C4∶0–C18∶1 Δ9 along with wildtype PAO1 and the ΔfadD1D2 mutant.

Table 2

Strains utilized in this study.

Strain	Lab ID	Relevant Properties	Source/reference
E. coli
K-12	E0577	Prototroph	ATCC #23740
E. coli fadD −/ fadR−	E2011	Kmr; fadD− (oldD88) fadR::Kmr	[14]
E2011/attTn7::miniTn7-Gmr	E2665	Gmr, Kmr; E2011 with miniTn7-Gmr vector inserted at attTn7 site	This study
E2011/attTn7::fadD3	E2666	Gmr, Kmr; E2011 with fadD3 inserted at attTn7 site	This study
E2011/attTn7::fadD4	E2667	Gmr, Kmr; E2011 with fadD4 inserted at attTn7 site	This study
E2011/attTn7::fadD5	E2799	Gmr, Kmr; E2011 with fadD5 inserted at attTn7 site	This study
E2011/attTn7::fadD6	E2798	Gmr, Kmr; E2011 with fadD6 inserted at attTn7 site	This study
E2011/attTn7::fadDEc	E2385	Gmr, Kmr; E2011 with fadDEc inserted at attTn7 site	This study
P. aeruginosa
PAO1	P007	Prototroph	[59]
ΔfadD4	P691	PAO1-fadD4::FRT	This study
ΔfadD4/attB::fadD4	P1041	Tcr; PAO1-fadD4::FRT/attB::miniCTX2-fadD4	This study
ΔfadD1D2	P177	PAO1-ΔfadD2D1::FRT	[14]
ΔfadD1D2D3	P678	PAO1-ΔfadD2D1::FRT/ΔfadD3::FRT	This study
ΔfadD1D2D4	P696	PAO1-ΔfadD2D1::FRT/fadD4::mFRT	This study
ΔfadD1D2D5	P246	PAO1-ΔfadD2D1::FRT/fadD5::FRT	This study
ΔfadD1D2D6	P969	PAO1-ΔfadD2D1::FRT/fadD6::FRT	This study
ΔfadD1D2D3D4	P698	PAO1-ΔfadD2D1::FRT/ΔfadD3::FRT/fadD4::mFRT	This study
ΔfadD1D2D3D5	P768	PAO1-ΔfadD2D1::FRT/ΔfadD3::FRT/fadD5::FRT	This study
ΔfadD1D2D3D6	P769	PAO1-ΔfadD2D1::FRT/ΔfadD3::FRT/fadD6::FRT	This study
ΔfadD1D2D4D5	P770	PAO1-ΔfadD2D1::FRT/fadD4::FRT/fadD5::FRT	This study
ΔfadD1D2D4D6	P771	PAO1-ΔfadD2D1::FRT/fadD4::mFRT/fadD6::FRT	This study
ΔfadD1D2D5D6	P722	PAO1-ΔfadD2D1::FRT/fadD5::FRT/fadD6::FRT	This study
ΔfadD3D4D5D6	P781	PAO1-ΔfadD3::FRT/fadD4::mFRT/fadD5::FRT/fadD6::FRT	This study
ΔfadD1D2D3D4D5	P772	PAO1-ΔfadD2D1::FRT/ΔfadD3::FRT/fadD4::mFRT/fadD5::FRT	This study
ΔfadD1D2D3D4D6	P773	PAO1-ΔfadD2D1::FRT/ΔfadD3::FRT/fadD4::mFRT/fadD6::FRT	This study
ΔfadD1D2D3D5D6	P726	PAO1-ΔfadD2D1::FRT/ΔfadD3::FRT/fadD5::FRT/fadD6::FRT	This study
ΔfadD1D2D4D5D6	P766	PAO1-ΔfadD2D1::FRT/ΔfadD3::FRT/fadD5::FRT/fadD6::FRT	This study
ΔfadD1D2D3D4D5D6	P767	PAO1-ΔfadD2D1::FRT/ΔfadD3::FRT/fadD4::mFRT/fadD5::FRT/fadD6::FRT	This study
ΔfadD1D2D3D4D5D6/mucA−	P973	Cbr; P767/mucA::pUC18	This study
ΔfadD1D2D3D4D5D6/complement	P1021	Gmr, Tcr; P767/attB::miniCTX2-fadD2D1D4/attTn7::miniTn7-fadD3-fadD5-fadD6	This study
ΔfadD1D2D3D4D5D6/complement/mucA−	P1028	Cbr, Gmr, Tcr; P767/attB::miniCTX2-fadD2D1D4/attTn7:miniTn7-fadD3-fadD5-fadD6/mucA::pUC18	This study

Abbreviations:

Cbr; carbenicilin resistance; Ec, E. coli; fadD, gene encoding fatty acyl-CoA synthetase; Flp, Sacchaomyces cerevisiae recombinase; FRT, Flp recognition target; Gmr, gentamicin resistance; Kmr, kanamycin resistance; mucA, anti-sigma factor, repressor of alginate biosynthesis in P. aeruginosa; Pa, P. aeruginosa; pheS, gene encoding a mutated α-subunit of phenylalanyl tRNA synthase; Tcr, tetracycline resistance.

As expected, all 17 mutant strains grew the same as PAO1 on glucose at 24 h and 96 h (Tables 3 and 4). On C4∶0, growth of all mutants was the same as PAO1 indicating that none of the fadD homologues contribute to the degradation of this FA or the differences were too small to be detected via plate-based growth assays. Throughout the study, the ΔfadD3D4D5D6 strain had the same growth as PAO1 on C6∶0–C18∶1 Δ9 indicating that FadD1 and FadD2 are most likely providing a majority of FACS activity in P. aeruginosa (Tables 3 and 4). No difference in growth was observed between ΔfadD1D2 strain and ΔfadD1D2D3, ΔfadD1D2D5, ΔfadD1D2D6, ΔfadD1D2D5D6, ΔfadD1D2D3D5, ΔfadD1D2D5D6, or ΔfadD1D2D3D6 on C6∶0–C18∶1 Δ9. There was significantly less growth for ΔfadD1D2D4 on C6∶0–C18∶1 Δ9 at 24 h in comparison to ΔfadD1D2, suggesting that fadD4 is important for degradation of all FAs from C6∶0 to C18∶1 Δ9.

Table 3

Growth of various P. aeruginisa fadD mutants on FAs after 24 h.

	Growth on different carbon sources
Strain	C4∶0	C6∶0	C8∶0	C10∶0	C12∶0	C14∶0	C16∶0	C18∶1 Δ9	Glu
PAO1	+2	+3	+4	+4	+3	+3	+3	+3	+4
ΔfadD1D2	+2	+2	+3	+3	+2	+3	+2	+3	+4
ΔfadD1D2D3	+2	+2	+3	+3	+2	+3	+2	+3	+4
ΔfadD1D2D4	+2	–	–	+1	+1	+1	+1	+1	+4
ΔfadD1D2D5	+2	+2	+3	+3	+2	+3	+2	+3	+4
ΔfadD1D2D6	+2	+2	+3	+3	+2	+3	+2	+3	+4
ΔfadD1D2D3D4	+2	–	–	–	–	+1	+1	+1	+4
ΔfadD1D2D3D5	+2	+2	+3	+3	+2	+3	+2	+3	+4
ΔfadD1D2D3D6	+2	+2	+3	+3	+2	+3	+2	+3	+4
ΔfadD1D2D4D5	+2	–	–	–	–	–	–	+1	+4
ΔfadD1D2D4D6	+2	–	–	–	–	+1	+1	+1	+4
ΔfadD1D2D5D6	+2	+2	+3	+3	+2	+3	+2	+3	+4
ΔfadD3D4D5D6	+2	+3	+4	+4	+3	+3	+3	+3	+4
ΔfadD1D2D3D4D5	+2	–	–	–	–	–	–	–	+4
ΔfadD1D2D3D4D6	+2	–	–	–	–	+1	+1	+1	+4
ΔfadD1D2D3D5D6	+2	+2	+1	+3	+1	+3	+1	+3	+4
ΔfadD1D2D4D5D6	+2	–	–	–	–	–	–	–	+4
ΔfadD1D2D3D4D5D6	+2	–	–	–	–	–	–	–	+4

Strains were grown on 1x M9 medium +1% (w/v) Brij-58 supplemented with 0.2% (w/v) fatty acids or 20 mM glucose (Glu).

– indicates no growth on a patch and+denotes growth:

+1 is very little growth.

+4 is a heavy growth comparable to PAO1 on glucose at 24 h.

+6 is a very heavy growth comparable to PAO1 on glucose at 96 h.

Table 4

Growth of various P. aeruginosa fadD mutants on FAs after 96 h.

	Growth on different carbon sources
Strain	C4∶0	C6∶0	C8∶0	C10∶0	C12∶0	C14∶0	C16∶0	C18∶1 Δ9	Glu
PAO1	+4	+6	+6	+6	+6	+6	+6	+6	+6
ΔfadD1D2	+4	+4	+4	+4	+4	+4	+4	+4	+6
ΔfadD1D2D3	+4	+4	+4	+4	+4	+4	+4	+4	+6
ΔfadD1D2D4	+4	+2	+1	+4	+4	+4	+4	+4	+6
ΔfadD1D2D5	+4	+4	+4	+4	+4	+4	+4	+4	+6
ΔfadD1D2D6	+4	+4	+4	+4	+4	+4	+4	+4	+6
ΔfadD1D2D3D4	+4	–	–	+2	+2	+4	+4	+4	+6
ΔfadD1D2D3D5	+4	+4	+4	+4	+4	+4	+4	+4	+6
ΔfadD1D2D3D6	+4	+4	+4	+4	+4	+4	+4	+4	+6
ΔfadD1D2D4D5	+4	–	–	+1	+3	+3	+4	+4	+6
ΔfadD1D2D4D6	+4	–	–	+4	+4	+4	+4	+4	+6
ΔfadD1D2D5D6	+4	+4	+4	+4	+4	+4	+4	+4	+6
ΔfadD3D4D5D6	+4	+6	+6	+6	+6	+6	+6	+6	+6
ΔfadD1D2D3D4D5	+4	–	–	–	–	–	+3	+3	+6
ΔfadD1D2D3D4D6	+4	–	–	+2	+2	+4	+4	+4	+6
ΔfadD1D2D3D5D6	+4	+4	+4	+4	+4	+4	+4	+4	+6
ΔfadD1D2D4D5D6	+4	–	–	+1	+3	+1	–	+1	+6
ΔfadD1D2D3D4D5D6	+4	–	–	–	–	–	–	–	+6

Strains were grown on 1x M9 medium +1% (w/v) Brij-58 supplemented with 0.2% (w/v) fatty acids or 20 mM glucose (Glu).

– indicates no growth on a patch and+denotes growth:

+1 is very little growth.

+4 is a heavy growth comparable to PAO1 on glucose at 24 h.

+6 is a very heavy growth comparable to PAO1 on glucose at 96 h.

Addition of fadD3, fadD5, or fadD6 mutation to ΔfadD1D2D4 strain in a quadruple mutant combination resulted in larger deficiencies in growth on FAs in comparison to the triple ΔfadD1D2D4 mutant (Tables 3 and 4), indicating that fadD3, fadD5, and fadD6 also take part in FA degradation and suggesting the dominance of FadD4 over these homologues. The ΔfadD1D2D3D4, ΔfadD1D2D4D5, and ΔfadD1D2D4D6 strains showed no growth on C6∶0 and C8∶0, even after four days, in contrast to the ΔfadD1D2D4 mutant (Table 4), indicating that fadD3, fadD5, and fadD6 are involved in the degradation of these FAs.

All quintuple mutants exhibited some level of growth on several FAs after 96 h (Table 4), whereas no growth was present for the sextuplet mutant combination (ΔfadD1D2D3D4D5D6), indicating that all four new fadD homologues contribute to FA degradation and that only six aerobic FACS genes are likely present in P. aeruginosa. Quintuple mutants with both fadD4 and fadD5 mutations (ΔfadD1D2D3D4D5 and ΔfadD1D2D4D5D6) were most deficient in FA degradation (Table 3). Growth patterns of the four quintuple mutants after 96 h (Table 4) suggest that fadD4, besides fadD1 and fadD2, is much more important for FA degradation than fadD3, fadD5, and fadD6 combined, and fadD5 contributes to FA degradation more than fadD3 and fadD6. Furthermore, by comparing the phenotypes of double, triple, and quadruple mutants at two time points (Tables 3 and 4) a hierarchy of contributions of fadD homologues to the degradation of different chain-length FAs can be assigned as follows: i) FadD4 degrades C6∶0–C18∶1 Δ9 (ΔfadD1D2D4 versus ΔfadD1D2 in Table 3); ii) FadD5 degrades C6∶0–C14∶0 (ΔfadD1D2D4D5 versus ΔfadD1D2D4 in Tables 3 and 4); iii) FadD3 degrades C6∶0-C12∶0 (ΔfadD1D2D3D4 versus ΔfadD1D2D4 in Tables 3 and 4); and iv) FadD6 degrades C6∶0–C12∶0 (ΔfadD1D2D4D6 versus ΔfadD1D2D4 in Tables 3 and 4).

fadD1 and fadD2 in Comparison to fadD3, fadD4, fadD5, and fadD6

The growth phenotypes of various combinatory mutants on FAs indicated that out of the newly discovered FACS genes (fadD3, fadD4, fadD5, and fadD6) fadD4 is most important for FA degradation (Tables 3 and 4), in addition to fadD1 and fadD2 [14]. To investigate further the contribution of fadD4 to FA degradation in comparison to fadD1 and fadD2, growth curve experiments were performed on SCFA, MCFA, and LCFAs with ΔfadD1D2D4, ΔfadD3D4D5D6, ΔfadD1D2D3D5D6, and ΔfadD1D2D4D3D5D6 mutants along with PAO1 and ΔfadD1D2 strains (Fig. 2). The growth experiments on FAs were conducted up to 30 h, which was sufficient to distinguish differences in growth patterns between various strains. The growth rates calculated from growth curves in Fig. 2 are presented in Table S3. The ΔfadD1D2 mutant strain had impaired growth in comparison to PAO1 on FAs (Fig. 2B–2E). The phenotype of ΔfadD1D2D3D5D6 in C6∶0–C18∶1 Δ9 (Fig. 2B–2E) was characterized by lower final optical density (OD) and/or longer lag phase than ΔfadD1D2, indicating that fadD3, fadD5, and fadD6 also contribute to FA degradation. In comparison to ΔfadD1D2 and ΔfadD1D2D3D5D6, ΔfadD1D2D4 exhibited very small amounts of growth, and no increase in turbidity was observed for ΔfadD1D2D3D4D5D6 on FAs (Fig. 2B–2E). The ΔfadD3D4D5D6 mutant had almost identical growth in comparison to PAO1 in C6∶0 and C18∶1 Δ9 (Fig. 2B and 2E). In C10∶0 and C14∶0 ΔfadD3D4D5D6 showed a similar final OD as PAO1 but longer lag phase (Fig. 2C and 2D). These data indicate that, although the activity of FadD4 is masked by the dominance of FadD1 and FadD2, the FadD4 plays a significant role in the degradation of FAs in P. aeruginosa.

Figure 2

fadD mutants and growth on FAs.

Various strains were grown on glucose (A), C6∶0 (B), C10∶0 (C), C14∶0 (D), and C18∶1 Δ9 (E) to investigate further the role of fadD4 in FA degradation in comparison to rest of homologues. These growth curves demonstrate the hierarchical dominance of fadD1, fadD2 and fadD4 over other fadDs. Growth experiments were performed twice and representative curves are shown.

Role of fadD Homologues in the Utilization of Plant-derived Acyclic Terpenes

One of the P. aeruginosa fadD homologues, fadD5 (PA2893; atuH), was proposed to be part of the acyclic terpenes utilization (ATU) pathway and to contribute to degradation of citronellol and geraniol (perfumery compounds found in plants) by activating citonellic acid (CA) and geranic acid (GA) through addition of CoASH [40]. However, mutation of PA2893 alone did not abolish growth on acyclic terpenes possibly suggesting the involvement of other homologue(s) [40]. To determine the role of fadD5 and other fadD homologues in degradation of acyclic terpenes as plant-derived nutrient sources, we grew PAO1 along with 17 combinatory fadD mutants in 1x M9 minimal media +1% (w/v) Brij-58 with 0.1% (w/v) of CA or GA (Fig. 3). All strains had similar OD measurements after one day of growth on glucose (Fig. 3A). After 24 h, all nine strains with the fadD4 mutation (triple, quadruple, quintuple, and sextuple combinations) had significantly lower OD for both compounds in comparison to PAO1 (20% or less) (Fig. 3C and 3E). All other mutants had comparable growth to PAO1 in CA and GA (82%–96% and 88%–115%, respectively). None of the strains with fadD4 mutations had higher OD in CA or GA at day six, than at day one, and the remainder of the mutants grew the same as PAO1 (Fig. S2). Since only strains with fadD4 mutations exhibited growth defects in CA and GA, involvement of FadD4 in degradation of these compounds was further investigated using the single fadD4 mutant (Fig. 3D and 3F). Single copy complementation returned growth of the ΔfadD4 mutant to PAO1 levels indicating that fadD4 is responsible for the majority of CA and GA degradation.

Figure 3

Growth phenotypes of various fadD homologues mutants on acyclic terpenes.

Strains were grown in liquid 1x M9 medium +1% (w/v) Brij-58 supplemented with 20 mM glucose, 0.1% (w/v) of citronellic acid, or 0.1% (w/v) geranic acid at 30°C. Optical densities (ODs) of cultures were measured and compared to PAO1 at day one (A, C, and E). Growth of ΔfadD4 mutant and ΔfadD4/attB::fadD4 complement strain in different carbon source were compared to PAO1 and ODs from day six are presented (B, D, and F). Results shown are from representative experiments that were performed twice by measuring triplicate cultures.

fadD3, fadD4, fadD5, and fadD6 and Virulence in P. aeruginosa

A link between fadDs and production of virulence factors was previously observed in P. aeruginosa [14]. To determine if newly discovered homologues modulate virulence, single unmarked mutants ΔfadD3, ΔfadD4, ΔfadD5, ΔfadD6, along with ΔfadD1D2D3D4D5D6 strain and its complement were tested for production of proteases, lipases, phospholipases, and rhamnolipids. No difference in production of these virulence determinates was observed between PAO1 and all strains tested (data not shown).

Involvement of New fadD Homologues in PC Degradation and in vivo Growth

Our previous study indicated that the ΔfadD1D2 mutant had a decreased ability to degrade PC and was less fit in BALB/c mice lungs [14]. We hypothesized that the sextuple fadD mutant, which does not grow on FAs, would exhibit impaired growth on PC and have significantly decreased in vivo fitness. We first investigated the role of the four newly discovered FACS in PC degradation (Fig. 4A). Before death phase, ΔfadD1D2 exhibited slower growth rate and lower final turbidity than PAO1. ΔfadD1D2D4 had a longer lag phase in comparison to ΔfadD1D2 before reaching a similar OD, implying that fadD4 contributes to degradation of PC. The ΔfadD1D2D3D4D5D6 mutant further exhibited a significant growth defect on PC. The large differences in growth rate and final OD between the sextuple mutant and ΔfadD1D2D4 suggest that not only fadD4 but also fadD3, fadD5, and fadD6 are required for growth on PC, which contains a mixture of FA chain lengths.

Figure 4

Growth characteristics on PC and competition studies of fadD sextuple mutant.

(A) PAO1 and several mutant strains were individually grown on PC. Growth curves were performed twice and representative results are shown. (B) In vitro competition between ΔfadD1D2D3D4D5D6 and its competitor, ΔfadD1D2D3D4D5D6/complement (P1021), in different growth media after 24 h. (C) In vivo competition between ΔfadD1D2D3D4D5D6/mucA (P973) and its competitor, ΔfadD1D2D3D4D5D6/complement/mucA (P1028), in BALB/c mice lungs. Seven mice for each time point were inoculated with 6 x106 CFU/mouse. The geometric mean of competitive indices (CI) from each group is marked by red line. Mutant strain is less competitive than complement when CI<1. Total average lung CFU recovered form mice in each group are indicated above red line. * P<0.05 based on one sample t test.

When in vitro competition studies were conducted on the sextuple fadD mutant and its competitor the complemented sextuple fadD mutant, mutation of all six FACS genes did not affect fitness when the bacteria were grown in rich Luria Bertani (LB) medium, and minimal medium supplemented with casamino acids, glucose, glycerol, and choline (Fig. 4B). In contrast, the in vitro competitive index (CI) in oleate (C18∶1 Δ9) and PC were low (∼0.15 and ∼0.3, respectively) indicating that ΔfadD1D2D3D4D5D6 has a growth disadvantage on these carbon sources. The in vivo competition study showed that the sextuple fadD mutant was out numbered by its complement (Fig. 4C). An almost 10-fold increase in CFU per lung above inoculum (6 x106) was observed for both time points indicating bacterial replication in vivo. At 24 h, the amount of the sextuple fadD mutant was half of its complement, which is lower than the reported CI for the ΔfadD1D2 mutant at 24 h [14]. Even at 48 h the CI was significantly lower than 1, indicating that deletion of fadD genes decreases in vivo fitness of sextuple fadD mutant.

Discussion

Previous research on fadD1 and fadD2 indicated that more than two FACS genes are present in P. aeruginosa [14]. In this study, we focused on identification of additional fadD homologues. Four genes, fadD3, fadD4, fadD5, and fadD6 (PA3860, PA1617, PA2893, and PA3924, respectively) were found to encode FACS (Tables S1 and 1). Each of these genes contributes at a varying degree to FA degradation (Tables 3 and 4). Surprisingly, none of the new fadDs were involved in degradation of butyrate (C4∶0; Table 3). It is possible that other unidentified genes with acyl-CoA synthetase functions are responsible for growth on C4∶0. Butyrate could also be processed through the acetoacetate degradation pathway (ato), an alternative pathway for degradation of SCFA [41]. This could be possible since two homologues of both of E. coli acetoacetyl-CoA transferase complex proteins, AtoA and AtoD, are present in P. aeruginosa: PA2000 (identity 45% and similarity 62%), PA0227 (identity 28% and similarity 62%), PA1999 (identity 40% and similarity 64%), and PA5445 (identity 33% and similarity 55%), respectively.

Growth studies with various mutants using FAs as sole carbon and energy sources indicated that FACS homologues are not of equal physiological significance and that there are disparities in importance and FA preference between them. fadD1 and fadD2, along with fadD4, are responsible for almost all FA degradation and dominate over other homologues. When fadD1 and fadD2 are inactivated, the majority of growth on SCFAs, MCFAs and LCFAs is due to fadD4 (Tables 3 and 4, Fig. 2). In comparison, fadD3, fadD5, and fadD6 have small contributions to overall growth on FAs and their individual involvement can be only observed when fadD1, fadD2 and fadD4 are absent (Table 4). This is not unprecedented, since Pseudomonas putida FadD2 is only active when FadD1 is not present [42]. It could be possible that gene(s) ruled out by screening in E. coli for growth on LCFA (Table S1), might be involved in SCFA and/or MCFA degradation. However, lack of growth for the sextuple fadD mutant on C6∶0–C18∶1 Δ9 (Table 4) strongly indicates that P. aeruginosa has a total of six aerobic FACS genes.

P. aeruginosa is commonly found in soil, water, and on plant surfaces [43]–[45] and it is known to degrade over 70 different organic substances such as aromatic compounds, organic acids (e.g. isovalerate), alcohols, and acyclic terpenes (e.g., citronellol and geraniol) [44]. Sources of nutrients for pseudomonads on plant surfaces have not been determined. Citronellol and geraniol (perfumery compounds and possible bacterial nutrient sources found in plants) are degraded through the acyclic terpene utilization (ATU) pathway, β-oxidation pathway, and leucine/isovalerate utilization pathway [40], [46]. The fadD5 (PA2893 or atuH) was proposed to be part of ATU and to be involved in activation of the CA and GA intermediates of the pathway. However, fadD5 was confirmed experimentally not to be part of ATU, and other homologues were thought to be also involved and to ‘mask’ the phenotype [40]. We investigated the possible role of fadD homologues in the degradation of acyclic terpenes, and we reasoned that combination of various fadD mutations would allow involvement of FACS homologues in ATU to be assessed. Surprisingly, fadD5 along with fadD1, fadD2, fadD3, and fadD6 had minimal if any contributions to the degradation of CA and GA (Fig. 3). Interestingly, fadD5 is located right next to genes known to be involved in ATU and seems to be the last gene in atuABCDEFGH cluster [40]. On the other hand, fadD4 is not only involved in ATU but it is almost solely responsible for degradation of these compounds as can be observed from growth phenotypes of the single fadD4 mutant and its complement (Fig. 3D and 3F). Notably, homologues of fadD4 with high similarity are present in Pseudomonas fluorescens (e.g., Pfl01_4205 in Pf0-1, 72% identity and 84% similarity), Pseudomonas protegens (e.g., PFL_1744 in strain Pf-5, 71% identity and 82% similarity), and Pseudomonas mendocina (e.g., MDS_2302 in strain NK-01, 75% identity and 87% similarity) and some strains of these pseudomonads are known to degrade acyclic terpenes [40], [47].

The ability of P. aeruginosa to degrade lipids and FAs, especially the main component of lung surfactant PC, has been linked to replication of this opportunistic pathogen during infection of CF patients’ lungs [13]. Previously, we determined that ΔfadD1, ΔfadD2, and double ΔfadD1D2 mutants have decreased fitness in BALB/c mice due to their deficiencies in degradation of FAs and PC [14]. We hypothesized that P. aeruginosa strains with greater defects in utilization of FAs and PC in vitro will have larger disadvantages during in vivo growth. ΔfadD1D2D3D4D5D6 mutant exhibited the most significant growth defect in FAs and PC (Fig. 2, 4A and 4B), and similar level of virulence factors (i.e. proteases, hemolysins, lipases) production was observed between sextuple fadD mutant, its complement, and PAO1 (data not shown). The ΔfadD1D2D3D4D5D6 mutant had some decrease of in vivo fitness in comparison to the ΔfadD1D2 at 24 h (Fig. 4C and [14]); but at 48 h, ΔfadD1D2D3D4D5D6 mutant was not less fit in mice lungs than ΔfadD1D2 mutant. This latter result was surprising, as the impaired ability to utilize PC did not result in a more dramatic phenotype in vivo at 48 h (Fig. 4C). There are several possibilities, which could account for this unexpected phenotype. The sextuple mutant could utilize in vivo other constituents of PC such as choline and glycerol later in the infection. Additionally, pulmonary surfactants are composed of 10% proteins [48] and amino acids were suggested to be used by P. aeruginosa during lung infection [49] and could serve as an alternative nutrient source for sextuple fadD mutant. Other FACS genes (i.e. anaerobic which we could not identify because of limitations of our aerobic in vitro screening method) could be important for in vivo growth.

In summary, we have identified four additional FACS homologues of P. aeruginosa and determined their involvement in degradation of different FAs. The dual catabolic function of fadD4 (PA1617) for FAs and acyclic terpenes exemplifies the interconnection of metabolic pathways and multiple roles that FACS homologues play in this ubiquitous bacterium. Our in vivo data show that nutrient acquisition during lung infection is a complicated process, involving alterative pathways that require further investigation. Knowledge of all fadD genes needed for FA degradation significantly increases our understanding of the FA degradation pathway and its importance for in vivo replication of P. aeruginosa.

Materials and Methods

Ethics Statement

All animal experiments were approved by University of Hawaii at Manoa Institutional Animal Care and Use Committee (protocol no. 06-023-6) and were conducted in compliance with the NIH (National Institutes of Health) Guide for the Care and Use of Laboratory Animals.

Bacterial Strains and Growth Media

Strains and plasmids utilized in this study are listed in Tables 2, S2, and 5, respectively. All P. aeruginosa mutants constructed and utilized in this study are derived from strain PAO1. E. coli E1869 strain (Table S2) was routinely used for cloning and E. coli Δasd or ΔdapA strains (E464, E1353, and E2072, Table S2) were used for mobilization of plasmids as described previously [50]. E. coli and P. aeruginosa strains were cultured in rich and minimal media as described by Kang et al. [14] unless indicated otherwise. Fatty acids stocks were prepared as previously described [31].

General Molecular Techniques

Molecular techniques were performed as previously described [50]. Oligonucleotides (Table 6) were synthesized through Integrated DNA Technologies.

Table 6

Oligonucleotides primers utilized in this study.

Primer number and name	Sequencea
438; PA2893-BamHIb, c	5'-CAGTAGGATCCCACGGTGCTCAGAAGCGGT-3'
512; PA3924-BamHIb, c	5'-TGCTTGGGATCCGGGCGTTTCGGCGGTGTA-3'
1093; EcfadD-down-BamHIb	5′-AACGGGATCCTCAGGCTTTATTGTC-3′
1109; PA3924-NdeIb	5'-GTGTACGCCATATGCTGAATACCC-3'
1151; PA1221 BamHI-upd	5'-ACCGTGGATCCATTCTCATCGCTTTTCTCTC-3'
1152; PA1221 BamHI-downd	5'-AGCGCGTTTTCGTCGGCGAAGGATCCGACT-3'
1153; PA2557 BamHI-upd	5'-TGGGCGGATCCGCCTCTTGCGTTTACCTT-3'
1154; PA2557 BamHI-downd	5'-GAAAGCGAAGCTGCCACTCTTCAGGATCCGCGA GT-3'
1155; PA3860 BamHI-upd	5'-GAACGGGATCCAGTGTAAAGCATGTTGCCAG-3'
1156; PA3860 BamHI-downb, d	5'- CTGGAGGAAATCCACGACATCGGATCCTGGCT G-3'
1157; PA4198 BamHI-upd	5'-CCAGAGGATCCAGCCGTTTTCGACGCAGT-3'
1158; PA4198 BamHI-downd	5'-CGAACACGTCGTTGAGCAGGATCCGCATG-3'
1218; fadDEc-HindIII-upb	5'-TCATAAGCTTGGGGTTGCGATGAC-3'
1251; fadD3-NdeIb	5'-AACCCATATGAATCCGTCCCCATCG-3'
1252; PA3568-Up-HindIIId	5'-ACTCCAAGCTTCACTCACTGCTTCATC-3'
1253; PA3568-Down-SalId	5'-GGCTGGTCGACGAAGGCGTGTTGAA-3'
1254; PA1997-Up-BamHId	5'-CCTGTGGATCCAGCAGATGCAGGA-3'
1255; PA1997-Down-SmaId	5'-CTGAAGATGGCATTGTCG-3'
1256; PA0996-Up-BamHId	5'-CTTCTTGCTTGGTTGCC-3'
1257; PA0996-Down-BamHId	5'-CCAGCGGATCCTCCAGACACACATAGGA-3'
1258; PA2555-Up-HindIIId	5'-GCGTGAAGCTTCCGGCTACTCCATACA-3'
1259; PA2555-Down-KpnId	5'-CCGCCGGTACCCAGGAACACTCGATTT-3'
1260; PA1617-Up-HindIIId	5'-CTAGGAAGCTTCTGGCGCAACGACTACAA-3'
1261; PA1617-Down-EcoRIb, c, d	5'-GTTCAGTTGCTCCAGGTC-3'
1441; PA1614-HindIIIc	5'-GAAGCTTCATGACAGAGCAGCAAC-3'
1444; PA1617-NdeIb	5'-ATGCCATATGGTCACTGCAAATCGTCT-3'
2109; PA2893-upc, d	5'-GGCTATTTGCCGAAGTGC-3'
2110; PA3924-upc, d	5'-CGGATTCTATCTTGTGACC-3'

Restriction enzyme sequences are underlined.

Single copy complementation in E. coli.

Single copy complementation in P. aeruginosa.

fadD homologues cloning.

Potential P. aeruginosa fadD homologues were identified through BLAST [34] utilizing E. coli FadD sequence and alignment of E. coli FadD ATP/AMP [19], [35]–[37] and fatty acid binding motifs [38] with the FadD motifs of P. aeruginosa fadD homologues. Prediction of function of genes was obtained from Pseudomonas Genome Database (www.pseudomonas.com) [51]. PA2557, PA3860, and PA4198 were PCR amplified and cloned into pUC19 as BamHI fragments. The fadD homologues PA1617, PA1997, PA2555, PA3568, PA2893, and PA3924, were PCR amplified and cloned into pUC19 as HindIII/EcoRI, BamHI/SmaI, HindIII/KpnI, HindIII/SalI, and XbaI/BamHI fragments, respectively. For functional complementation testing, pUC19 vectors containing PAO1 fadD homologues were transformed into E. coli fadD strain (E2011) and the resulting transformants were patched onto 1x M9+1% (w/v) Brij-58+ ampicillin 100 µg/ml supplemented with 20 mM glucose, 0.2% (w/v) oleate (C18∶1 Δ9), or decanoate (C10∶0).

Single Copy Complementation of the E. coli fadD Mutant

To construct fadD3, fadD5, and fadD6 single copy complementation vectors, first fadD3, fadD5, and fadD6 PCR product were cloned into pET15b as NdeI/BamHI fragments. Next, the fadD3-His6, fadD5-His6, and fadD6-His6 BamHI/XbaI fragments were sub-cloned into miniTn7-Gmr yielding miniTn7-fadD3, miniTn7-fadD5 and miniTn7-fadD6. To construct the miniTn7-fadD4, first, the PCR product of fadD4 was cloned into pET28a as NdeI/EcoRI fragment. The fadD4-His6 fragment, obtained by EcoRI digest, blunt-ending, and XbaI digest, was sub-cloned into miniTn7-Gmr digested with the BamHI, blunt-ended and digested with XbaI. To construct miniTn7-fadD, the fadD PCR product was cloned as BamHI/blunt-end fragment into miniTn7-Gmr digested with XbaI, blunt ended and digested BamHI.

Various miniTn7 vectors were integrated into E2011 using pTNS2 [52]. For the complementation study, two colonies of K-12, E2011, E2011/attTn7::miniTn7-Gmr, E2011/attTn7::fadD, E2011/attTn7::fadD3, E2011/attTn7::fadD4, E2011/attTn7::fadD5, and E2011/attTn7::fadD6 were patched onto 1x M9 medium +1% (w/v) Brij-58+0.25 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) supplemented with 0.2% (w/v) FAs or 20 mM glucose. Plates were incubated for three days at 37°C and bacterial growth was scored from +1 to +6. Very little growth was marked as +1 and very heavy growth on a patch comparable to K12 on glucose at day three was marked as +6.

Construction of Mutant Strains of PAO1

The fadD3, fadD4, fadD5, and fadD6 gene replacement vectors were obtained as follows. pEX18T-fadD3-Gmr-pheS was constructed by digesting pUC19-PA3860 with MscI and SgrAI, blunt-ending, and ligating it with Gmr-pheS-FRT cassette that was SmaI excised from pwFRT-Gmr-pheS. The PA3860-Gmr-pheS fragment was excised from the resulting vector using BamHI and cloned into pEX18T. Similarly, pEX18T-fadD4-Gmr-pheS was obtained by first sub-cloning fadD4 gene as a HindIII/EcoRI fragment from pUC19-PA1617 into pEX18T, and fadD4 was deactivated at the XhoI site by inserting the Gmr-pheS cassette SalI excised from pmFRT-Gmr-pheS. pEX18T-fadD5-Gmr was constructed by cloning fadD5 PCR product (oligos #437 and #438) as BamHI/blunt-end fragment into pEX18T that was digested with BamHI and SmaI, and fadD5 was deactivated at the blunt-ended XhoI site by inserting the Gmr-FRT cassette SmaI excised from pPS856. To construct pEX18T-fadD6-Gmr, fadD6 PCR product (oligos #1093 and #512) was cloned as BamHI/blunt-end fragment into pEX18T that was digested with BamHI and SmaI, and fadD6 was deactivated at the blunt-ended KpnI site by inserting the Gmr-FRT SmaI excised cassette from pPS856.

pEX18T-fadD3-Gmr-pheS, pEX18T-fadD4-Gmr-pheS, pEX18T-fadD5-Gmr, and pEX18T-fadD6-Gmr gene replacement vectors were utilized as previously described [53] to obtain several mutant strains (P239, P243, P416, P677, P678, P685, P696, P698, P691, P722 P726, and P767). Unmarked mutations of fadD genes in various strains were obtained utilizing pFLP2 [53] or in one step via Flp mediated excision of Gmr-pheS-FRT cassettes utilizing mutated version of P. aeruginosa pheS gene [54] and chlorinated phenylalanine (cPhe) counter-selection by transiently expressing flp on the non-replicative plasmid, pCD13SK-flp-oriT, as described previously [55]. Mutations transfer from strains P685, P239, P416 into PAO1, P678, P696, P698, and P722 were done as previously described [56], followed by Flp mediated excision of Gmr-FRT or Gmr-pheS-FRT cassette, to obtain unmarked mutant strains P766, P768, P769, P770, P771, P772, P773, P969, and P972. Strain ΔfadD3D4D5D6 (P781) was constructed in the PAO1-ΔfadD3::FRT background by subsequent transfer of mutation from strains P685, P239, and P416 followed by Flp mediated excision of Gmr-FRT or Gmr-pheS-FRT cassette. Presence or absence of mutations of fadD2D1, fadD3, fadD4, fadD5, and fadD6 in all mutant strains were confirmed by PCR (data not shown).

Growth Phenotypes of Multiple fadD Mutants on Fatty Acids

To assess involvement of P. aeruginosa fadD homologues in FAs degradation, various strains (PAO1, double, triple, quadruple, quintuple, and sextuple fadD mutants) were purified on LB. After 24 h incubation at 37°C, two colonies of each strain were patched onto 1x M9 solid medium +1% (w/v) Brij-58 supplemented with 0.2% (w/v) FAs or 20 mM glucose. Plates were incubated at 37°C for four days. Growth of each strain was scored from +1 (little growth) to +6 (very heavy growth comparable to PAO1 on glucose at 96 h).

Growth Curves Experiments

To further characterize various fadD mutants of P. aeruginosa, growth curve studies were performed using FAs as sole carbon source as described previously [14]. Doubling time of various strains in log-phase (Table S3) was calculated as follow: doubling time  = [0.301(t2-t1)]/(logOD2-logOD1) [57].

Growth of fadD Mutants on Acyclic Terpenes

The ΔfadD4/attB::fadD4 strain was constructed using a single copy complementation vector miniCTX2-fadD4, which was obtained by cloning the fadD4 PCR product (oligos #1443 and #1261) as HindIII and EcoRI fragment into miniCTX2 and integrated into ΔfadD4 mutant chromosome as described previously [58]. Stocks of citronellic (Sigma) and geranic acid (Sigma) (3% (w/v)) were prepared by neutralizing the compounds with equal molar sodium hydroxide and dissolving in 1% (w/v) Brij-58. PAO1 and various fadD mutants were grown overnight (14–16 h), starter culture were prepared as described by Kang et al. [14] and inoculated at 200-fold dilution into 1x M9 minimal medium +1% (w/v) Brij-58 supplemented with 0.1% (w/v) of citronellic acid, 0.1% (w/v) geranic acid or 20 mM glucose. Triplicate cultures were shaken at 30°C and optical densities were measured at day one and day six.

Virulence Factors Production

Lipase, protease, phospholipase, and rhamnolipd productions by fadD mutants were tested as previously described [14].

In vitro and in vivo Competition Studies

For in vitro and in vivo in competition studies, the ΔfadD1D2D3D4D5D6 strain was complemented with fadD2D1 and fadD4 cloned into miniCTX2 and fadD3, fadD5, and fadD6 cloned into miniTn7-Gmr. MiniCTX2-fadD2D1D4 complementation vector, was constructed by cloning fadD4 gene PCR product (oligos #1443 and #1261) as HindIII/blunt-end fragment into miniCTX2-fadD2D1 digested with XhoI, blunt-ended and digested with HindIII. To construct miniTn7-fadD3-fadD5-fadD6 vector, first fadD3 was sub-cloned as BamHI fragment from pUC19-PA3890 into miniTn7-Gmr, resulting in miniTn7-PA3860. The fadD6 was amplified with oligos #512 and #2210 and cloned as a BamHI/XbaI fragment into miniTn7-Gmr, resulting in miniTn7-PA3924. The fadD5 was amplified with oligos #438 and #2109 and digested with BamHI, blunt-ended, and digested with XbaI. To construct the final vector, the miniTn7-PA3924 was digested with XbaI, blunt-ended and digested with NdeI and the 2.5 kb fragment (containing fadD6) was cloned simultaneously along with fadD5 fragment into miniTn7-PA3860 digested with NdeI and SpeI. Integration of these plasmids into the P. aeruginosa chromosomes was performed as previously described ([58] and [52]).

The in vitro competition between ΔfadD1D2D3D4D5D6 and its complement (strain P1021) on LB, or casamino acids (CAA), choline, glucose, glycerol, oleate (C18∶1 Δ9) or PC was performed as described previously [14].

The in vivo competition study was performed as previously described [14]. Briefly, mucA was inactivated in the PAO1-ΔfadD1D2D3D4D5D6 and its complement strains utilizing pUC18-'mucA'. Equal amounts of alginate overproducing sextuple mutant and its complement were resuspended in their own supernatants and mixed. Fourteen BALB/c mice were inoculated intratracheally with 6 x106 colony forming units (CFU) of mixture of mutant (strain P973) and complement (strain P1028) as described previously [14]. At each time point (24 h and 48 h) seven mice were humanly euthanized, lungs were homogenized in 0.85% (w/v) saline and serial dilutions were plated on LB and LB+tetracycline 100 µg/ml to determine the total CFU and the complemented strain CFU. The competitive index (CI) was calculated as described [14].

Alignment of motifs of potential fatty acyl-CoA synthetase homologues. Amino acids with similar properties are assigned the same colors using CLC Sequence Viewer 6 software (www.clcbio.com).

(TIF)

Click here for additional data file.

Growth phenotypes of various homologues mutants on acyclic terpenes at day six. Strains were grown in liquid 1x M9 medium +1% (w/v) Brij-58 supplemented with 0.1% (w/v) of citronellic acid or 0.1% (w/v) geranic acid at 30°C. Optical densities (ODs) of cultures were measured and compared to PAO1.

(TIF)

Click here for additional data file.

Potential FadD homologues of identified through BLAST and tested for complementation in (E2011).

(DOC)

Click here for additional data file.

Additional strains utilized in this study.

(DOC)

Click here for additional data file.

Doubling time in minutes (min) of various strains in log-phase were calculated from growth curves in .

(DOCX)

Click here for additional data file.

Table 5

Plasmids used in this study.

Plasmid	Lab ID	Relevant Properties	Source/reference
miniCTX2	E0076	Tcr; P. aeruginosa site specific integration vector	[58]
miniCTX2-fadD2D1	E2143	Tcr; fadD2D1 cloned into miniCTX2	[14]
miniCTX2- fadD2D1D4	E2811	Tcr; fadD4 gene cloned into miniCTX2-fadD2D1	This study
miniCTX2-fadD4	E2589	Tcr; fadD4 gene cloned into miniCTX2	This study
miniTn7-Gmr	E2643	Apr, Gmr; pUC18R6Kmini-Tn7 [52] with FRT8-Gmr cassette and lac promoter cloned	Laboratory collection
miniTn7-fadD3	E2645	Apr, Gmr; fadD3 cloned into miniTn7-Gmr	This study
miniTn7-fadD4	E2647	Apr, Gmr; fadD4 cloned into miniTn7-Gmr	This study
miniTn7-fadD5	E2793	Apr, Gmr; fadD5 cloned into miniTn7-Gmr	This study
miniTn7-fadD6	E2794	Apr, Gmr; fadD6 cloned into miniTn7-Gmr	This study
miniTn7-fadDEc	E2378	Apr, Gmr; E. coli fadD cloned into miniTn7-Gmr	This study
miniTn7-PA3860	E2377	Apr, Gmr; fadD3 with native rbs cloned into miniTn7-Gmr	This study
miniTn7-PA3924	E2854	Apr, Gmr; fadD6 with native rbs cloned into miniTn7-Gmr	This study
miniTn7-fadD3-fadD5-fadD6	E2860	Apr, Gmr; fadD3, fadD5, and fadD6 with native rbs cloned into miniTn7-Gmr	This study
pCD13SK-flp-oriT	E0783	Spr; suicidal Flp-expressing plasmid	[33]
pET15b	E0047	Apr; T7 expression vector	Novagen
pET15b-fadD3	E2658	Apr; pET15b with fadD3 gene	This study
pET15b-fadD5	E1127	Apr; pET15b with fadD5 gene	This study
pET15b-fadD6	E2790	Apr; pET15b with fadD6 gene	This study
pET28a	E0158	Kmr; T7 expression vector	Novagen
pET28a-fadD4	E2644	Kmr; pET28a with fadD4 gene	This study
pEX18T	E0055	Apr; gene replacement vector	[53]
pEX18T-fadD3-Gmr -pheSPa	E2438	Apr, Gmr; Gmr-pheSPa-FRT cassette inserted into fadD3	This study
pEX18T-fadD4-Gmr -pheSPa	E2506	Apr, Gmr; Gmr -pheSPa-mFRT cassette inserted into fadD4	This study
pEX18T-fadD5-Gmr	E0828	Apr, Gmr; Gmr-FRT cassette inserted into fadD5	This study
pEX18T-fadD6-Gmr	E1476	Apr, Gmr; Gmr-FRT cassette inserted into fadD6	This study
pFLP2	E0067	Apr; broad-host range Flp expressing plasmid	[53]
pmFRT-Gmr-pheSPa	E2382	Apr, Gmr; plasmid with Gmr -pheSPa-mFRT cassette	Laboratory collection
pPS856	E0050	Apr, Gmr; plasmid with Gmr-FRT cassette	[53]
pTNS2	E1189	Apr; helper plasmid for Tn7 transposition system	[52]
pUC18-'mucA'	E1907	Apr; pUC18 with internal fragment of mucA cloned	[14]
pUC19	E0014	Apr; cloning vector	[60]
pUC19-PA1617	E2472	Apr; PAO1 PA1617 gene cloned into pUC19	This study
pUC19-PA3860	E2356	Apr; PAO1 PA3860 gene cloned into pUC19	This study
pwFRT-Gmr-pheSPa	E2380	Apr, Gmr; plasmid with Gmr -pheSPa-FRT cassette	Laboratory collection

Abbreviations:

Apr, ampicillin resistance; lac, E. coli lactose operon; rbs, ribosomal binding site; Spr, streptomycin resistance.