| Literature DB >> 23711280 |
Wentao Li1, Shuqing Liu, Yang Wang, Feng Deng, Weidong Yan, Kun Yang, Huanchun Chen, Qigai He, Catherine Charreyre, Jean-Christophe Audoneet.
Abstract
BACKGROUND: Porcine circovirus type 2 (PCV2) is the causal agent of postweaning multisystemic wasting syndrome (PMWS), which has severely impacted the swine industry worldwide. PCV2 triggers a weak and atypical innate immune response, but the key genes and mechanisms by which the virus interferes with host innate immunity have not yet been elucidated. In this study, genes that control the response of primary porcine alveolar macrophages (PAMs), the main target of PCV2, were profiled in vitro.Entities:
Mesh:
Substances:
Year: 2013 PMID: 23711280 PMCID: PMC3680065 DOI: 10.1186/1471-2164-14-353
Source DB: PubMed Journal: BMC Genomics ISSN: 1471-2164 Impact factor: 3.969
Figure 1Immunofluorescence antibody staining for PCV2-infected PAMs. Intracytoplasmic bright green fluorescence (fluorescein isothiocyanate) is seen in PCV2-infected PAMs. (A) Bright microscopy image of mock-inoculated PAMs. (B) Mock-inoculated PAMs. (C) PCV2-infected PAMs at 24 HPI. (D) PCV2-infected PAMs at 48 HPI. (B-D) were stained with PCV2 Cap protein-specific monoclonal antibody. Magnification: ×400.
Functional grouping of genes differentially expressed (≥2-fold and P < 0.05, n = 3) between PCV2-infected and mock-infected control
| Immune response | |||||||
| | rho GDP dissociation inhibitor beta | ARHGDIB | 2.16 | 0.41 | 1.21 | 13.11 | NM_001009600 |
| | CMRF35-like molecule 1 | CLM1 | 2.35 | 0.95 | 1.38 | 13.11 | AY457047 |
| | cathepsin C | CTSC | 2.12 | 3.06 | 1.74 | 11.46 | NM_001814 |
| | cathepsin S | CTSS | 0.5 | 1.09 | 0.77 | 19.25 | M90696.1 |
| | Fc fragment of IgG low affinity II b receptor | FCGR2B | 3.47 | 0.54 | 1.85 | 8.49 | NM_001033013 |
| | neutrophil cytosolic factor 4 | NCF4 | 2.62 | 0 | 2.12 | 6.28 | NM_000631 |
| Humoral immune response | |||||||
| | chemokine ligand 16 | CCL16 | 3.85 | 4.64 | 3.24 | 4.93 | NM_004590; |
| | CD74 molecule | CD74 | 3.94 | 0 | 3.43 | 0.58 | NM_213774 |
| | complement factor D | CFD | 0.36 | 0.41 | 0.59 | 2.88 | NM_001928 |
| | C-type lectin domain family 2, member B | CLEC2B | 2.83 | 1.62 | 2.10 | 1.09 | NM_005127 |
| Inflammatory response | |||||||
| | chemokine ligand 3-like 3 | CCL3L3 | 7.58 | 0 | 2.46 | 1.64 | NM_001001437 |
| | chemokine Ligand 5 | CCL5 | 1.53 | 14.04 | 2.25 | 2.44 | AK312212 |
| | chemokine ligand 5 | CXCL5 | 32.28 | 0 | 12.96 | 0 | EU176356 |
| | chemokine ligand 7 | CXCL7 | 2.75 | 0.95 | 3.57 | 1.97 | NM_213862.1 |
| | interleukin-6 | IL6 | 2.26 | 4.65 | 1.36 | 13.43 | NM_214399.1 |
| | S100 calcium binding protein A1 | S100A1 | 0.31 | 0.41 | 0.40 | 0.71 | NM_006271 |
| | S100 calcium binding protein A12 | S100A12 | 10.98 | 0 | 5.13 | 1.09 | FJ263393.1 |
| | S100 calcium binding protein A8 | S100A8 | 12.96 | 0 | 6.83 | 0 | FJ263391.1 |
| | S100 calcium binding protein A9 | S100A9 | 20.00 | 0 | 9.71 | 0 | FJ263392.1 |
| | serum amyloid A1 | SAA1 | 14.59 | 0.54 | 1.82 | 24.35 | NM_199161 |
| | secreted phosphoprotein 1 | SPP1 | 2.66 | 2.39 | 1.67 | 24.35 | AK296035 |
| | tumor necrosis factor, alpha-induced protein 6 | TNFAIP6 | 6.54 | 0 | 3.26 | 0.58 | NM_001159607 |
| Lipid biosynthesis | |||||||
| | Lysophosphatidic acid acyltransferase, delta | AGPAT4 | 2.34 | 0 | 1.48 | 0.58 | NM_020133 |
| | lysophosphatidic acid acyltransferase, zeta | AGPAT6 | 1.56 | 0.54 | 2.03 | 0 | NM_178819 |
| | alkylglycerone phosphate synthase | AGPS | 2.41 | 0.95 | 1.46 | 32.28 | NM_003659 |
| | farnesyl-diphosphate farnesyltransferase 1 | FDFT1 | 0.77 | 14.04 | 0.45 | 1.82 | AK297868 |
| | isopentenyl-diphosphate delta isomerase 1 | IDI1 | 0.84 | 26.53 | 0.46 | 2.88 | NM_004508 |
| | inositol-3-phosphate synthase 1 | ISYNA1 | 2.12 | 0.54 | 1.65 | 1.44 | NM_016368 |
| | stearoyl-CoA desaturase | SCD | 2.46 | 0.54 | 3.37 | 8.49 | AB208982 |
| | triosephosphate isomerase 1 | TPI1 | 3.00 | 0 | 2.11 | 3.33 | NM_000365 |
| Locomotion | |||||||
| | CD97 molecule | CD97 | 1.50 | 3.06 | 2.17 | 1.64 | NM_001784 |
| | coronin, actin binding protein, 1A | CORO1A | 2.64 | 0.54 | 1.26 | 4.65 | NM_007074 |
| | chemokine ligand 10 | CXCL10 | 7.69 | 4.93 | 2.58 | 1.07 | NM_001565 |
| | Kallmann syndrome 1 sequence | KAL1 | 0.43 | 1.44 | 0.46 | 4.65 | NM_000216 |
| | mitogen-activated protein kinase 1 | MAP2K1 | 2.03 | 0 | 1.17 | 1.7 | NM_002755 |
| | platelet factor 4 | PF4 | 4.15 | 0 | 3.80 | 1.64 | NM_002619 |
| | phosphatidic acid phosphatase type 2B | PPAP2B | 8.45 | 0.95 | 3.04 | 11.46 | NM_003713 |
| | prostaglandin-endoperoxide synthase 2 | PTGS2 | 5.75 | 0 | 5.41 | 0 | NM_001784 |
| Lyase activity | |||||||
| | aldolase C, fructose-bisphosphate | ALDOC | 3.08 | 0 | 2.18 | 3.33 | AK294157 |
| | carbonic anhydrase XIII | CA13 | 0.41 | 0.82 | 0.40 | 0.71 | NM_198584 |
| | enolase 1, (alpha) | ENO1 | 2.24 | 0 | 1.80 | 4.94 | AK298600 |
| | N-acetylneuraminate pyruvate lyase | NPL | 1.71 | 1.62 | 2.28 | 0 | AK297017 |
| | serine dehydratase | SDS | 7.58 | 0 | 9.14 | 0 | NM_006843 |
| Antigen processing and presentation | |||||||
| | Major histocompatibility complex, class II, DO alpha | DOA | 2.29 | 0 | 1.42 | 13.11 | NM_002119.3 |
| | Major histocompatibility complex, class II, DO beta | DOB | 17.85 | 2.39 | 3.78 | 1.64 | NM_002120.3 |
| | Major histocompatibility complex, class II, DQ alpha 1 | DQA1 | 2.07 | 1.62 | 1.37 | 9.21 | M33906.1 |
| | Major histocompatibility complex, class II, DQ beta 1 | DQB1 | 2.47 | 0 | 2.14 | 11.46 | M32577 |
| | Major histocompatibility complex, class II, DR alpha | DRA | 7.87 | 0 | 3.69 | 1.08 | NM_001134339 |
| | Major histocompatibility complex, class II, DR beta 1 | DRB1 | 5.83 | 0.95 | 2.17 | 1.17 | AY770514.1 |
| Signal transducer activity | |||||||
| | guanine nucleotide binding protein (G protein), gamma 2 | GNG2 | 1.94 | 0.41 | 2.26 | 0.42 | NM_0530 |
| | regulator of G-protein signaling 1 | RGS1 | 1.02 | 58.23 | 0.47 | 4.25 | NM_002922 |
| | transforming growth factor, alpha | TGFA | 2.79 | 0 | 1.54 | 14.86 | AK312899 |
| | wingless-type MMTV integration site family, member 6 | WNT6 | 0.49 | 1.09 | 0.64 | 21.46 | NM_006522 |
| Antiviral immune response | |||||||
| | chemokine ligand 8 | CCL8 | 8.02 | 0 | 3.17 | 0 | NM_214214.1 |
| | extracellular matrix protein 1 | ECM1 | 2.01 | 0.54 | 2.89 | 0 | CB477333 |
| | IFN-gamma | IFNG | 0.49 | 0.41 | 3.18 | 0 | NM_213948.1 |
| | interleukin 18 | IL18 | 2.58 | 0.95 | 5.84 | 19.25 | NM_001562 |
| | ISG15 ubiquitin-like modifier | ISG15 | 1.56 | 10.92 | 2.51 | 0 | EU584557.1 |
| | interferon-stimulated gene 20 kDa protein | ISG20 | 1.49 | 61.10 | 2.20 | 4.94 | NM_002201 |
| | vasoactive intestinal peptide | VIP | 0.69 | 32.11 | 4.14 | 0 | NM_194435 |
| Apoptosis | |||||||
| | BCL2/adenovirus E1B 19kDa interacting protein 3 | BNIP3 | 3.69 | 0 | 2.61 | 2.88 | U15174.1 |
| | CD14 molecule | CD14 | 3.60 | 0 | 3.87 | 0 | NM_001097445 |
| | immediate early response 3 | IER3 | 5.46 | 0.41 | 2.21 | 1.64 | NM_003897 |
| | lectin, galactoside-binding, soluble, 1 | LGALS1 | 0.42 | 0.82 | 0.66 | 10.51 | NM_002305 |
| | interleukin 1 alpha | IL1A | 21.31 | 0 | 8.47 | 0 | NM_214029.1 |
| | interleukin 1, beta | IL1B | 18.69 | 0 | 10.33 | 2.88 | M15330.1 |
| | serine/threonine kinase 17a | STK17A | 1.53 | 1.62 | 2 | 1.64 | NM_00476 |
| | tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain | TNFRSF10D | 2.26 | 0 | 2.21 | 61.11 | NM_003840 |
| | tumor necrosis factor alpha | TNFα | 5.13 | 0.41 | 1.96 | 6.28 | EU682384.1 |
| Cell proliferation | |||||||
| | Betacellulin | BTC | 2.26 | 0.95 | 1.78 | 1.97 | NM_001729 |
| | epithelial membrane protein 1 | EMP1 | 0.49 | 0.82 | 0.62 | 2.88 | NM_001423 |
| | fatty acid binding protein 3, muscle and heart | FABP3 | 1.88 | 0.95 | 2.57 | 3.09 | NM_004102 |
| | fms-related tyrosine kinase 1 | FLT1 | 1.91 | 1.78 | 2.49 | 0 | NM_002019 |
| | interleukin 2 receptor, gamma | IL2RG | 1.39 | 6.28 | 2.06 | 1.07 | NM_000206 |
| | interleukin 8 receptor, beta | IL8RB | 1.33 | 45.16 | 3.41 | 0 | NM_001557 |
| | v-myc myelocytomatosis viral oncogene homolog | MYC | 0.75 | 14.04 | 0.29 | 0.71 | NM_002467 |
| pro-platelet basic protein | PPBP | 2.75 | 0.95 | 3.57 | 1.97 | NM_002704 | |
Note: The DE genes are presented with putative functions assigned by the GO term and manual annotation. Many genes with multiple functions were only listed in one category according to specific biology processes. FC: fold change; FC≥2: up-regulation (infection/control); FC≤0.5: down-regulation.
Priers used for qRT-PCR validation and additional expression profiling
| HPRT-1 a | Forward: | TCATTATGCCGAGGATTTGGA | 90 | DQ136030 |
| | Reverse: | CTCTTTCATCACATCTCGAGCAA | | |
| GAPDH b | Forward: | TGCCAACGTGTCGGTTGT | 120 | NG_007073.2 |
| | Reverse: | TGTCATCATATTTGGCAGGTTT | | |
| CD14 | Forward: | AGAGTTCAAAGAGTAGGGAA | 86 | NM_001097445.2 |
| | Reverse: | AACGCTATCTGTCCTCAC | | |
| GPNMB | Forward: | CCCTCACGAGCACCCTTGT | 91 | NM_001098584 |
| | Reverse: | AAGAAGCCAACGAAGACCAGGAT | | |
| ICAM1 | Forward: | GCAAGAAGATAGCCAACCA | 106 | NM_000201.2 |
| | Reverse: | TGCCAGTTCCACCCGTTC | | |
| IFNγ | Forward: | AAAGATAACCAGCCCATTC | 93 | NM_213948.1 |
| | Reverse: | GTCATTCAGTTTCCCAGA | | |
| IL6 | Forward: | CCTTCAGTCCAGTCGCCTTCTCC | 97 | NM_214399.1 |
| | Reverse: | GCATCACCTTTGGCATCTTCTTCC | | |
| IL8 | Forward: | CACTGTGAAAATTCAGAAATCATTGTTA | 105 | NM_213867.1 |
| | Reverse: | CTTCACAAATACCTGCACAACCTTC | | |
| ISG15 | Forward: | GGAGGGTAGGGAGGAGGGA | 108 | EU584557.1 |
| | Reverse: | ATGGGCGTCACACAGGCT | | |
| S100A1 | Forward: | GGGAGAACAGTTGAGCAGATGGT | 104 | NM_006271.1 |
| | Reverse: | GGAGGGAACAGCGGGATGAA | | |
| S100A12 c | Forward: | GGCATTATGACACCCTTATC | 168 | NM_001160272.1 |
| | Reverse: | GTCACCAGGACCACGAAT | | |
| S100A4 | Forward: | GGGGAAAAGGACGGATGAAGC | 96 | XM_001929560 |
| | Reverse: | GCAGGACAGGAAGACGCAGTA | | |
| S100A8 c | Forward: | GCGTAGATGGCGTGGTAA | 155 | FJ263391.1 |
| | Reverse: | GCCCTGCATGTGCTTTGT | | |
| S100A9 c | Forward: | CCAGGATGTGGTTTATGGCTTTC | 186 | NM_001177906.1 |
| | Reverse: | CGGACCAAATGTCGCAGA | | |
| TLR1 b | Forward: | TGCTGGATGCTAACGGATGTC | 102 | NM_001031775.1 |
| | Reverse: | AAGTGGTTTCAATGTTGTTCAAAGTC | | |
| TLR2 b | Forward: | TCACTTGTCTAACTTATCATCCTCTTG | 162 | AB085935.1 |
| | Reverse: | TCAGCGAAGGTGTCATTATTGC | | |
| TLR3 b | Forward: | AGTAAATGAATCACCCTGCCTAGCA | 112 | DQ647698.1 |
| | Reverse: | GCCGTTGACAAAACACATAAGGACT | | |
| TLR4 b | Forward: | GCCATCGCTGCTAACATCATC | 108 | AY535422.1 |
| | Reverse: | CTCATACTCAAAGATACACCATCGG | | |
| TLR5 | Forward: | CTCGCCCACCACATTA | 156 | FJ668383 |
| | Reverse: | TGAGGGTCCCAAAGAGT | | |
| TLR6 b | Forward: | AACCTACTGTCATAAGCCTTCATTC | 95 | NM_213760.1 |
| | Reverse: | GTCTACCACAAATTCACTTTCTTCAG | | |
| TLR8 b | Forward: | AAGACCACCACCAACTTAGCC | 105 | NM_214187.1 |
| | Reverse: | GACCCTCAGATTCTCATCCATCC | | |
| TLR9 b | Forward: | CACGACAGCCGAATAGCAC | 122 | AY859728.1 |
| | Reverse: | GGGAACAGGGAGCAGAGC | | |
| TNFα | Forward: | TGGTGGTGCCGACAGATGG | 102 | EU682384.1 |
| | Reverse: | GGCTGATGGTGTGAGTGAGGAA | | |
| VCAM1 | Forward: | TCAGGGAGGACACAAAGAAGGG | 135 | NM_213891.1 |
| Reverse: | AAACGGCAAACACCATCCAAAGT | |||
a from reference [21], b from reference [22], c from reference [9].
qRT-PCR validation of representative genes that are differentially expressed between control and PCV2-infected PAMs
| CD14 | NM_001097445.2 | 3.60 | 2.35(0.041) | 3.87 | 2.71(0.003) |
| GPNMB | NM_001098584 | −2.13 | −4.04(<0.0001) | −2.58 | −7.89(0.002) |
| ICAM1 | NM_000201.2 | 4.02 | 3.59(<0.0001) | 3.20 | 2.21(0.003) |
| IFNγ | NM_213948.1 | −2.04 | −2.76(0.005) | 3.18 | 5.09(0.006) |
| IL6 | NM_214399.1 | 2.26 | 4.60(0.001) | 1.36 | 2.47(0.001) |
| IL8 | NM_213867.1 | 4.86 | 8.65(0.001) | 5.03 | 5.36(0.008) |
| ISG15 | EU584557.1 | 1.56 | 1.37(0.006) | 2.51 | 2.83(0.031) |
| S100A1 | NM_006271 | −3.20 | −4.42 (0.001) | −2.49 | −1.87 (0.01) |
| S100A12 | NM_001160272.1 | 10.98 | 8.49(0.006) | 5.13 | 3.98(0.005) |
| S100A4 | XM_001929560 | −3.14 | −4.26(0.002) | −1.98 | −3.27(0.001) |
| S100A8 | FJ263391.1 | 12.96 | 15.47(<0.0001) | 6.83 | 4.34(0.003) |
| S100A9 | NM_001177906.1 | 20.00 | 16.56(0.007) | 9.71 | 6.21(0.025) |
| TLR1 | NM_001031775.1 | 2.76 | 2.29 (0.032) | 5.83 | 4.89(0.016) |
| TLR8 | NM_214187.1 | −4.35 | −3.01(0.002) | −1.14 | −1.72(0.004) |
| TLR9 | AY859728.1 | 2.47 | 4.66(0.012) | 1.43 | 2.24(0.0001) |
| TNFα | EU682384.1 | 5.13 | 5.36(0.016) | 1.96 | 2.53(0.022) |
| VCAM1 | NM_213891 | −2.33 | −7.54(0.001) | −2.90 | −4.83 (0.005) |
All reactions were performed in triplicate. FC: fold-change.
Figure 2Validation of microarray data by qRT-PCR analysis. Fold-changes of gene expression in the PAMs following PCV2 infection compared with the control group are shown. The fold-changes were calculated by the formula of 2-ΔΔ Ct. Data is presented as mean ± SD of triplicate reactions for each gene transcript.
Figure 3Validation of microarray data by ELISA. PCV2-induced changes in secreted levels of IFNγ (A), TNFα (B), IL-6 (C) and IL-8 (D). The protein levels in culture supernatants of mock-inoculated and PCV2-infected PAMs were measured by ELISA. Data are expressed as ng/L of three independent experiments. * 0.01
PCV2
-infected vs. mock-inoculated groups for the corresponding HPI.